Kordon Kanından Oluşan İndüklü Pluripotent Kök Hücrelerden Kondrojenik Pellet Oluşumu

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, kordon kanı mononükleer hücre kaynaklı insan kaynaklı pluripotent kök hücrelerden kondrojenik farklılaşma için bir protokol önermekteyiz.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

İnsan eklem kıkırdağı kendini tamir etme becerisine sahip değildir. Kıkırdak dejenerasyonu bu nedenle tedavi edici değil, konservatif tedaviler ile tedavi edilir. Halen hasar görmüş kıkırdağı ex vivo genişletilmiş kondrositler veya kemik iliği kaynaklı mezenkimal kök hücreler (BMSC) ile yenilemek için çaba sarf edilmektedir. Bununla birlikte, bu hücrelerin kısıtlı canlılığı ve istikrarsızlığı, kıkırdak yeniden yapılandırma alanındaki uygulamalarını sınırlar. İnsan kaynaklı pluripotent kök hücreler (hiPSC'ler), rejeneratif uygulamalar için yeni bir alternatif olarak bilimsel bir ilgi görmüştür. Sınırsız kendi kendini yenileme kabiliyeti ve çok potansiyeli ile hiPSC'ler, kıkırdak onarımı için yeni bir yedek hücre kaynağı olarak vurgulanmıştır. Bununla birlikte, yüksek miktarda yüksek kaliteli kondrojenik pelet elde edilmesi, klinik uygulamaları için büyük bir zorluk oluşturmaktadır. Bu çalışmada, kondrojenik diferansiyasyon için embriyo gövdesi (EB) ile üretilmiş büyüme hücreleri kullanılmıştır. Başarılı kondrojenez PCR ile veD lekelenmesi alsi mavisi, toluidin mavisi ve kolajen tip I ve II'ye karşı antikorlar (sırasıyla COL1A1 ve COL2A1). Kordon kanı mononükleer hücre kaynaklı iPSC'lerin (CBMC-hiPSC'lerin) kondrojenik peletlere diferansiyelleştirilmesi için ayrıntılı bir yöntem sunmaktayız.

Introduction

HİPSC'lerin kullanımı, çeşitli hastalıkların uyuşturucu taraması ve mekanik çalışmaları için yeni bir stratejiyi temsil etmektedir. Rejeneratif bir perspektiften hiPSC'ler, eklem kıkırdağı 1 , 2 gibi sınırlı iyileştirme kabiliyetine sahip hasarlı dokuların değiştirilmesi için potansiyel bir kaynaktır.

Doğal eklem kıkırdağının rejenerasyonu birkaç on yıl için zor olmuştur. Artiküler kıkırdak, yumuşak beyaz bir dokudur ve kemiklerin ucunu sürtünmeden korur. Bununla birlikte, zarar gördüğünde kendini yenilemek neredeyse imkansız kılan sınırlı rejeneratif kabiliyete sahiptir. Bu nedenle, kıkırdak yenilenmesine odaklanan araştırma, onlarca yıldır devam etmektedir.

Daha önce, in vitro olarak kondrojenik soya diferansiyasyon, genellikle diz eklemi 3'ten izole edilen BMSC'ler veya doğal kondrositler ile gerçekleştirildi. BitmişKondrojenik potansiyelleri, BMSC'ler ve doğal kondrositler, kondrojenezde kullanımlarını destekleyen çok sayıda avantaja sahiptir. Bununla birlikte, sınırlı genişleme ve kararsız fenotip yüzünden, bu hücreler eklem kıkırdak defekti rekonstrüksiyonu konusunda çeşitli sınırlamalarla karşı karşıya kalmaktadır. In vitro kültür koşulları altında, bu hücreler 3-4 geçitten sonra kendi özelliklerini kaybetme eğilimindedir ve bu da sonuçta onların farklılaşma yeteneklerini etkiler 4 . Ayrıca, doğal kondrositler durumunda, bu hücreleri elde ederken diz ekleminde ek hasar kaçınılmazdır.

BMSC'lerin veya doğal kondrositlerden farklı olarak, hiPSC'ler in vitro olarak sınırsız olarak genişleyebilir. Uygun kültür koşullarıyla, hiPSC'lerin kondrojenik farklılaşma için yedek bir kaynak olarak büyük potansiyeli vardır. Bununla birlikte, hiPSC'lerin içsel özelliklerini değiştirmek zordur 5 . Dahası, birkaç karmaşık in vitro süreç gerektirirPs hiPSCs'in kaderini belirli bir hücre türüne yönlendirmek için. Bu komplikasyonlara rağmen, yüksek kendiliğinden yenilenme kabiliyetleri ve kondrositleri de içeren hedeflenen hücrelere ayırma kapasiteleri nedeniyle hiPSC'lerin kullanımı hala önerilmektedir.

Kondrojenik farklılaşma, genellikle MSC benzeri progenitör hücreler kullanılarak pelet kültürü veya mikromüzk kültürü gibi üç boyutlu kültür sistemleri ile yapılır. HiPSC kullanıyorsa, MSC benzeri öncü hücreler üretmek için protokol mevcut protokollerden farklıdır. Bazı gruplar, fenotipi doğrudan MSC benzeri hücrelere dönüştürmek için hiPSC'lerin tek katmanlı kültürü kullanır 7 . Ancak, çoğu çalışma MSC 8 , 9 , 10 , 11'e benzeyen hücre büyümesi üretmek için EB'ler kullanır.

Kondrojayı indüklemek için çeşitli büyüme faktörleri kullanılır.Nesis. Genellikle, BMP ve TGFβ ailesi proteinleri tek başına veya kombinasyon halinde kullanılır. Farklılaşma, GDF5, FGF2 ve IGF1 12 , 13 , 14 , 15 gibi diğer faktörlerle de indüklenmiştir. TGFβ1'in MSC 16'da doza bağımlı bir tarzda kondrojenez uyarısı yaptığı gösterilmiştir. Diğer izotip ile karşılaştırıldığında, TGFβ3, TGFβ1, kıkırdak öncesi mezenşimal hücre yoğunlaşmasını arttırarak kondrojeneze neden olur. TGFβ3, mezenkimal hücre çoğalmasını önemli ölçüde arttırarak kondrojeneze neden olur17. Bununla birlikte, TGFβ3 araştırmacılar tarafından TGFβ1 7 , 10 , 18 , 19'dan daha sık kullanılır. BMP2, insan kondrojenik matris bileşenleri ile ilgili genlerin ekspresyonunu arttırırEklem kondrositlerinde in vitro koşullar altında 20 . BMP2, TGFβ proteinleri 21 ile kombinasyon halinde MSC'lerde kıkırdak oluşumu için kritik olan genlerin ekspresyonunu arttırır. Ayrıca, BMP2'nin Smad ve MAPK yolakları yoluyla TGFβ3'ün etkisini sinerjik olarak arttırdığı gösterilmiştir 22 .

Bu çalışmada CBMC-hiPSC'ler düşük ekli bir Petri kabında EB ortamı kullanılarak EB'lere toplandı. Gelişen hücreler, EB'leri jelatin kaplı bir çanağa tutturarak indüklenmiştir. Hücreleri kullanarak kondrojenik farklılaşma pelet kültürü ile gerçekleştirildi. Hem BMP2 hem de TGFβ3 ile yapılan muamele, hücreleri yoğun bir şekilde yoğunlaştırdı ve kondrojenik pelet oluşumu için hücre dışı matris (ECM) protein birikimine yol açtı. Bu çalışma, CBMC-hiPSC'leri kullanarak basit fakat etkin kondrojenik bir farklılaşma protokolünü önermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bu protokol, Katolik Üniversitesi'nin kurumsal gözden geçirme kurulu (KC12TISI0861) tarafından onaylandı. Yeniden programlama için kullanılan CBMC'ler doğrudan Seul St. Mary Hastanesi Kordon Kan Bankası'ndan alındı.

1. iPSC'lerden kondrojenik türev

  1. CBMC-iPSC üretimi
    1. Önceki çalışmamızda gösterilen protokolü kullanarak CBMC-hiPSC'ler üretin 23 .
    2. 15 mL konik tüp içinde kan hücrelerini toplayın ve bir hemositometre kullanarak sayın.
    3. 3 x 10 5 hücre hazırlayın ve 515 xg ve RT'de 5 dakika süreyle santrifüjleyin. Süpernatantı emilerek boşaltın ve hücreleri 0.5 mL kan hücresi ortamında tekrar süspanse edin.
    4. Hücreleri, kaplanmamış 24 delikli bir tabakın bir çukuruna aktarın ve üreticinin tavsiyelerine göre Sendai virüs karışımını ilave edin.
    5. Plakayı 1150 xg ve 30 ° C'de 30 dakika santrifüjleyin.
    6. kıçtaEr santrifüjleme, hücreleri gece boyunca (O / N) 37 ° C'de% 5 C02'de inkübe edin.
    7. Ertesi gün, transduced hücreleri bir matris kaplı kuyuya aktarın. 30 ° C'de 1150 xg'de plakayı santrifüjleyin.
    8. Santrifüjden sonra, süpernatantı çıkarın, 1 mL iPSC ortamı ilave edin ve% 5 CO 2'de 37 ° C'de hücre O / N'yi muhafaza edin.
    9. Ekli hücreleri 37 ° C'de ve% 5 CO 2'de muhafaza edin. Ortamı günlük olarak değiştirin, onu yeni iPSC ortamı ile değiştirin.
      NOT: Koloniler, transdüksiyon sonrası 14-21. Günde ortaya çıkacaktır.
  2. EB üretimi
    1. HiPSC'leri 37 ° C'de ve% 5 CO 2'de muhafaza edin. Ortamı günlük olarak değiştirin ve onu yeni Temel 8 (E8) orta ile değiştirin.
    2. E8 ortamında, vitronektin kaplı, 100 mm'lik bir çanakta 2 x 10 6 hiPSC hazırlayın.
    3. Kültür çanak E8 orta çıkarın ve steril fosfat tamponlu salin (PBS) ile yıkayın.
    4. 1 ekleML 1 mM etilendiamintetraasetik asit (EDTA) ile inkübe edin ve 37 ° C'de ve% 5 C02'de 2 dakika inkübe edin.
    5. Hücreleri 3 mL E8 ortamı ile hasat edin ve yeni bir 15 mL konik tüp aktarın. Hücreleri oda sıcaklığında (RT) 250 xg'de 2 dakika boyunca santrifüjleyin.
    6. Hücre peletini bozmadan süpernatantı aspire edin ve hücreleri 5 mL E8 ortamında tekrar süspansiyon haline getirin.
    7. Hemocytometer kullanarak hücreleri sayın ve her 100 mm Petri kabı için 2 x 10 6 hücre hazırlayın. Hazırlanan hücreleri 10 uM ko-ilişkili kinaz (ROCK) inhibitörü ile E8 ve EB ortamı (1: 1) içeren 10 mL'lik bir karışımda tekrar süspanse edin.
    8. 37 ° C'de ve% 5 C02'de agregasyon için hücreleri O / N inkübe edin.
    9. Ertesi gün, pipetleme yapılarak toplu EB'leri toplayın. Hücreleri 250 xg'de 1 dakika boyunca santrifüjleyin. Süpernatantı çıkarın ve 10 mL taze E8 ortamı içinde EB'leri tekrar süspanse edin.
    10. Oluşturulan EB'leri 5 gün boyunca büyütün, fres ile günlük değişiklikler yapınH E8 orta. Daha fazla olgunlaşma için, kültür ortamını E7 ortamına değiştirin. 37 ° C'de ve% 5 CO2'de 5 gün boyunca EB'leri muhafaza edin, taze E7 ortamıyla günlük orta değişimler yapın.
      NOT: E7 orta FGF2 içermeyen E8 ortamıdır.
  3. EB'lerden büyümekte olan hücre indüksiyonu
    1. 100 mm'lik bir tabağa 6 ml% 1 jelatin ekleyin ve 30 dakika boyunca 37 ° C'de ve% 5 CO 2'de inkübe edin.
    2. Jelatı alın ve kullanmadan önce 2-3 saat boyunca tamamen kurutun.
    3. EB'leri 50 mL'lik bir konik tüpe aktarın. EB'lerin konik borunun altına yerleşmesine izin verin. EB'leri rahatsız etmeden süpernatanı çıkarın.
    4. EB'leri 10 mL Dulbecco Modifiye Kartal Ortamı (DMEM)% 20 fetal sığır serumu (FBS) ile tekrar süspanse edin. EB'leri jelatin kaplı 100 mm'lik tabağa aktarın. 10 uM ROCK inhibitörü ekleyin.
    5. 37 ° C'de ve% 5 C02'de 7 gün boyunca hücreleri inkübe edin ve muhafaza edin. Temayı değiştirDiok her gün ROCK inhibitörü eklemeden.
  4. Kondrojenik pelet oluşumu
    1. Çanak kültür ortamı aspire ve PBS ile hücreleri üç kez yıkayın.
    2. 1 ml 1 mM EDTA uygulayın ve 37 ° C'de inkübe edin ve 2 dakika süreyle% 5 CO 2 .
    3. % 20 FBS ile 5 mL DMEM kullanarak hücreleri hasat edin ve yeni bir 15 mL konik tüp aktarın.
    4. Hücreleri 250 xg ve RT'de 2 dakika santrifüjleyin. Süpernatantı atın ve% 20 FBS ile 10 mL DMEM içinde pelet tekrar süspansiyon haline getirin.
    5. 40 μm hücre süzgeç kullanarak filtre ve hücre kümeleri atın ve tek hücreleri hasat. Hemocytometer kullanarak tekli hücreleri sayın.
    6. Hücreleri 250 xg ve RT'de 2 dakika santrifüjleyin. Süpernatantı alın ve her pelet için 3 x 10 5 hücre 300 mL'lik kondrojenik diferansiyasyon ortamı (CDM) ile 15 mL'lik konik bir tüp içine alın.
    7. Pelet oluşumu için, hücreleri 5 dakika süreyle santrifüjleyin.680 xg ve RT.
      NOT: Peletler, kondrojenik pelletlerin farklılaşması sırasında 15 mL konik tüplerde muhafaza edilir.
    8. Hücreleri gece boyunca 37 ° C'de ve% 5 C02'de inkübe edin.
    9. CDM'yi 2-3 günde bir değiştirin. Peletler 3 gün içinde düzleştirilmiş sfero morfolojileri sergileyecektir. Pelletleri, 37 ° C'de ve% 5 C02'de 21 gün boyunca muhafaza edin.

2. Boyama ile Kondrojenik Pellet Karakterizasyonu

  1. Kondrojenik gömme
    1. Gömülmeden önce, 58 ° C'de parafin hazırlayın ve eritin.
    2. 1,5 mL'lik bir tüpte oda sıcaklığında 2 saat boyunca 1 mL'lik% 4'lük paraformaldehit içinde topakları düzeltin.
      Dikkat: Paraformaldehit oldukça toksiktir. Göz, cilt veya müköz zarlarla temasından kaçının. Pozlamayı en aza indirin ve hazırlarken teneffüs etmeyi önleyin.
    3. Kasete bir kat tül yerleştirin ve sabit peletleri bir pipet yardımıyla aktarın. Topağı katlayarak örtün.E gazlı bez ve kaset kapağını kapatın.
    4. 100 mL% 70 etanol (EtOH) içinde iki kez, her biri 10 dakika dehidrasyon başlatın. Peletleri% 80 ve% 95 EtOH içinde sıralı 10 dakikalık yıkamalarla kurutun.
    5. Pelletleri 10 dakika boyunca% 100 EtOH'a aktarın. Taze EtOH ile üç kez tekrarlayın.
    6. "Temizleme" için, çözeltiyi 100 mL, 1: 1 EtOH ve ksilen karışımı, ardından her biri 10 dakika süreyle 1: 2 EtOH ve ksilen karışımı ile değiştirin. Kalan EtOH'yı, her biri 10 dakika süreyle% 100'lük ksilen içerisinde iki kez kuluçkalayarak temizleyin.
    7. Parafin infiltrasyonu için, peletleri sıralı ksilen ve parafin karışımlarında inkübe edin. Bütün parafin sızma işlemini 58 ° C'de gerçekleştirin. Pelletleri 100 mL, 2: 1 oranında ksilen ve parafin karışımı içinde 30 dakika inkübe edin.
    8. Çözeltiyi 100 mL 1: 1 ksilen ve parafin karışımıyla değiştirin ve 30 dakika inkübe edin.
    9. Çözeltiyi 100 mL 1: 2 ksilen ve parafin karışımıyla değiştirin ve 30 dak.
    10. Nihai sızma için, peletleri ilk% 100 parafin banyosuna aktarın ve 2 saat inkübe edin.
    11. Peletleri% 100 parafinin ikinci banyosuna aktarın ve O / N, 58 ° C'de inkübe edin.
    12. Ertesi gün, cımbız kullanarak pelletleri bir kalıba yavaşça aktarın. Parafin dağıtıcıdan kalıba parafin ekleyin. Parafin, 4 ° C'de 30 dakika süreyle katılaştınlır.
    13. Kesitleri 7 μm'de kesin ve kesitleri slaydın üzerine aktarın. Slaytların bir gece kurumasını bekleyin ve kullanıma hazır oluncaya dek slaytları oda sıcaklığında saklayın.
  2. Slayt hazırlığı
    1. Slaytları, 100 mL,% 100,% 90,% 80 ve% 70 EtOH ile sırayla 5 dakika boyunca hareket ettirerek çözünmesini sağlayın.
    2. Slaytları bir cam kavanoz içine yerleştirin ve musluk suyu ile 5 dakika boyunca durulayın.
  3. Alcian blue lekesi
    1. Slaytları 30 dakika boyunca 50 mL% 1 alc blue solüsyonunda inkübe edin.
      DEĞİLE: Alcian blue,% 3 asetik asit solüsyonunda seyreltilir. Asetik asit kullanarak pH'ı 2.5'e ayarlayın.
    2. Slaytları bir cam kavanoz içine yerleştirin ve musluk suyu ile 2 dakika boyunca durulayın.
    3. Slaytları deiyonize suda (DW) durulayın ve 2 dakika nükleer hızlı kırmızı solüsyonla kontrastlayın.
    4. Slaytları bir cam kavanoz içine yerleştirin ve 1 dakika musluk suyu ile durulayın.
    5. 2.3.5) Slaytları kurutun ve adımları 2.6'da takın.
  4. Toluidin mavisi boyama
    1. Slaytları 4 dakika boyunca 50 mL tolüidin mavisi solüsyonunda inkübe edin.
    2. Slaytları bir cam kavanoz içine yerleştirin ve musluk suyu ile 5 dakika boyunca durulayın.
    3. Adım 2.6'da sallamaları gidermek ve takmak için ilerleyin.
  5. İmmunohistokimyasal boyama
    1. Slaytları, endojen peroksidaz blokajı için 15 dakika boyunca% 3 H202'de inkübe edin.
    2. Tris-bu ile 1: 100 oranında seyreltilmiş 200 uL birincil antikor uygulayın (anti-COL1A1 ve -COL2A1)Slaytlara% 1 sığır serum albümini (BSA) ve% 5 normal keçi serumu (TBS) içeren fferled salin (TBS) ve 4 ° C'de O / N inkübe edin.
    3. Ertesi gün, slaytları bir cam kavanoz içine yerleştirin ve her biri 5 dakika boyunca üç kez% 0.1 polisorbat 20 (TBST) içeren 50 mL TBS ile yıkayın.
    4. Slaytlara, 200 mcL sekonder antikor (keçi anti-tavşan IgG antikoru, 1: 200 oranında TBS içinde seyreltilmiş TBS ve% 5 NGS) uygulayın ve oda sıcaklığında 40 dakika inkübe edin.
    5. Slaytları bir cam kavanoz içine yerleştirin ve 50 mL, her biri 5 dakika ile üç kez yıkayın.
    6. Sinyal amplifikasyonu için, HRP-konjuge streptavidin solüsyonunu slaytlara uygulayın ve 10 dakika inkübe edin.
    7. Slaytları bir cam kavanoz içine yerleştirin ve 50 mL, her biri 5 dakika ile üç kez yıkayın.
    8. DAB-peroksidaz substrat solüsyonunu karıştırın, her slayta 200 μL solüsyon uygulayın ve 1 dakika inkübe edin.
    9. Slaytları bir cam kavanoz içine yerleştirin ve musluk suyu ile 5 dakika boyunca durulayın.
    10. Counterstain1 dakika boyunca Mayer'in hematoksilen ile.
    11. Slaytları DW ile yıkayın.
    12. Adım 2.6'da sallamaları gidermek ve takmak için ilerleyin.
  6. Dehidrasyon ve montaj
    1. Slaytları 100 mL% 70,% 80,% 90 ve% 100 EtOH, 30 saniye boyunca sırayla hareket ettirerek suyunu alın.
    2. Slaytları her biri 1 dakika süreyle iki değişik ksilende daldırın.
    3. Lamelleri 50 mcL montaj solüsyonu ekleyin ve slaytlar üstüne koyun.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bu çalışmada, EB'lerden büyümekte olan hücreleri indükleyerek CBMC-hiPSC'lerden kondrojenik peletler oluşturduk. Kondrojenik farklılaşma, doğrulanmış yüksek pluripotensiteli CBMC-hiPSC'ler kullanılarak indüklendi. Protokolümüzün basit bir şeması Şekil 1A'da gösterilmiştir . Farklılaştırmadan önce, iPSC kolonileri genişletildi ( Şekil 1B ). Genişletilmiş iPSC'ler, farklılaşmayı başlatmak için EB'ler olarak toplandı ( Şekil 1C ). Oluşturulan EB'ler jelatin kaplı tabaklara ekim büyümesi hücrelerini uyarmak için tutturuldu ( Şekil 1D ). Daha sonra, büyümekte olan hücreler toplandı ve kondrojenik peletler oluşturmak için kullanıldı. 21 günlük farklılıktan sonra küçük boncuk benzeri kondrojenik peletler elde edildi ve daha ileri karakterizasyon için kullanıldı ( Şekil 1E ). İn vitro üretilen chonun kalitesiDrojeneik pelletler çeşitli deneylerle teyit edildi.

Gün 21'de kondrojenik pelletlerin kalitesini histolojik olarak değerlendirdik. Pozitif kontrol olarak BMSC kondrojenik peletler kullanıldı. Farklı kondrositler tarafından salgılanan ECM proteinlerinin birikimi, Şekil 2A'daki als mavisi ve toluidin mavisi boyaması ile teyit edildi. Lacuna ve proteoglikan üretimi gibi sağlıklı kıkırdağın temel özellikleri, farklılaşma süreci 21 gün boyunca devam ettikçe artmıştır. CBMC-hiPSC'lerden üretilen kondrojenik peletler, sağlıklı kıkırdakta ana ECM bileşeni olan COL2A1'yi ifade etmiştir ( Şekil 2B ). CBMC-hiPSC türevi pelletlerin COL2A1 ekspresyonu, BMSC türevi peletlerinkinden daha yüksekti. Fibrotik kıkırdak için bir markör olan tip I kollajeninin ekspresyonu, COL2A1'in ekspresyonuna kıyasla CBMC-hiPSC'den türetilmiş pelletlerde düşüktür. Gün-21 kondrojenik pelletlerde kıkırdak ECM proteinlerinin gen ifadesi, gerçek zamanlı PCR ile teyit edildi. CBMC-hiPSC türevi pelletlerin aggrecan (ACAN) ekspresyonu, BMSC türevi pelletlerin agrega (ACAN) ifadesine benzerdi ( Şekil 3A ). COL2A1 ifadesi, CBMC-hiPSC türevi peletlerde ( Şekil 3B ) önemli derecede yüksekti. Cinsiyet belirleyici bölge Y-box 9'un (Sox9), bir kondrojenik progenitör belirteçinin ekspresyonu da değerlendirildi. CBMC-hiPSClerden üretilen peletler yüksek düzeyde Sox9 ifade etmiştir ( Şekil 3C ). Bu genlerin CBMC-hiPSC kondrojenik topaklarda 21. günde BMSC kontrol topaklarla karşılaştırıldığında belirgin şekilde yukarı doğru düzenlendiğini teyit ettik. Bir hipertrofik markör COL1A1'in ekspresyonu değerlendirildi ( Şekil 3D ). CBMC-hiPSC türevi pelletlerde COL1A1 ifadesi, BMSC-deri'ye kıyasla azaldıVed topakları. Farklılaşma etkinliği, COL2A1'in COL1A1'e oranı ile analiz edildi ( Şekil 3E ). CBMC-hiPSC türevi pelletlerde oran artışı, COL1A1'e kıyasla COL2A1'in nispeten yüksek ekspresyonunu ortaya koymuştur. Sonuç olarak, CBMC-hiPSC'lerin kondrojenik farklılaşma kapasitesini teyit ettik. Üretilen CBMC-hiPSC türevi kondrojen peletlerin kalitesi, BMSC'lerin kalitesiyle uyumlu bir kaliteye sahiptir.

Şekil 1
Şekil 1: hiPSC'lerin kondrojenik farklılaşması. ( A ) hiPSC'lerden kondrojenik pelet üretimi şeması. ( B ) Oluşturulan CBMC-hiPSC'nin morfolojisi. ( C ) oluşturulan EBs Morfolojisi. ( D ) Jelatin kaplı bir kültür tabakına tutturulmuş EB'lerden türetilen gelişme hücreleri. ( E ) t Görüntüsü 21 günlük farklılaşmadan sonra kondrojenik pelet. Aralıkların birimleri milimetre olarak gösterilir. Ölçek çubukları = 200 μm. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

şekil 2
Şekil 2: Kondrojenik pelletin histolojik analizi. ( A ) Güneş 21'de kondrojenik peletlerin histolojik değerlendirmesi, alian mavi ve toluidin mavi boyama. ( B ) COL1A1 ve COL2A1 antikorları ile boyanan kondrojenik peletlerin immünohistokimyasal görüntüsü. Ölçek çubukları = 100 μm. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

1" > Şekil 3
Şekil 3: Kondrojenik pelletin gen ekspresyonu. ( A ) ACAN'ın göreceli gen ifadesi. ( B ) COL2A1'in göreceli gen ifadesi. ( C ) SOX9'un göreceli gen ifadesi. ( D ) COL1A1'in göreceli gen ifadesi. ( E ) COL1A1'in gen ekspresyonu. ( F ) COL10A1'in gen ekspresyonu. ( G ) COL2A1: COL1A1 gen ifadesinin oranı. Peletler toplandı ve 21 gün farklılaştıktan sonra analiz edildi. Veriler, gerçek zamanlı PCR kullanılarak elde edildi ve numune başına üçlü deneylerin ortalama standart hatası olarak gösterildi (n = 3). Gen ifadesi bir iç kontrol olarak GAPDH'ye normalize edildi. (* P <0.05, ** p <0.01, *** p <0.001).K "> Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Hücre numarası Gelişen hücre verimi Topak verimi
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tablo 1: MSC ve hiPSC'lerin verim karşılaştırması.

Hedef Adı yön Primer Dizisi Boyut
ileri TTCCGCGACGTGGACAT 77 bp
Ters TCAAACTCGTTGACATCGAAGGT
ACAN ileri AGCCTGCGCTCCAATGACT 107 bp
Ters TAATGGAACACGATGCCTTTCA
COL2A1 ileri GGCAATAGCAGGTTCACGTACA 79 bp
Ters CGATAACAGTCTTGCCCCACTTA
COL1A1 ileri CCCCTGGAAAGAATGGAGATG 148 bp
Ters TCCAAACCACTGAAACCTCTG

Tablo 2: Gerçek zamanlı PCR'de kondrojenik belirteçlere karşı primerler dizileri.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu protokol CBMC'lerden başarıyla hiPSC üretti. Yamanaka faktörleri 24 içeren bir Sendai viral vektörü kullanarak CBMC'leri hiPSC'ye yeniden programladık. Farklılaşmada üç vaka kullanıldı ve tüm deneyler bu protokolü kullanarak kondrojenik pelletleri başarıyla üretti. HiPSC'lerin kondrositlere 25 , 26 , 27 , 28 farklılaşması için protokoller çok sayıda çalışma rapor etmiştir. Bununla birlikte, kıkırdak rejenerasyonu ve iyileşmesi için bir aday olan CBMC-hiPSC'lerin kullanımını doğrulamak için ilave araştırmalara gerek vardır.

Kondrojenez, çeşitli somatik hücre tipleri 11 , 25 , 26 , 27 , 29'dan üretilen hiPSC'ler kullanılarak teyit edildi. Birçok rapor gösteriyorYeniden programlamada kullanılan somatik hücrenin kökeni, hiPSC 30 , 31 , 32 , 33'in farklılaşma sonuçlarını etkileyebilir. Kordon kanı HSC'ler ve MSC'lerle zenginleştirilmiş bir kaynaktır. Kan hücreleri veya MSC gibi kordon kanı türetilen hücreler arasındaki fark hakkında bir rapor mevcut değildir. Bununla birlikte, daha önceki çalışmalar, artiküler kondrositten türetilen hiPSC'lerin, kordon kanı veya deri fibroblastlarından 29 oluşturulan hiPSC'lere kıyasla kondrojeneze girme olasılığının daha yüksek olduğunu göstermiştir. Fibroblastlar, kardiyak progenitör hücreler ve endotel hücrelerinden üretilen hiPSC'leri kullanarak endotelyal farklılaşmanın sonuçları, orijin dokusunun, özellikle 10-20. 34 yaşlarındaki erken geçitlerde, terminal diferansiye iPSC türevinde dokuya spesifik somatik hafızayı yansıttığını göstermiştir. HiPSC'lerin erken pasajlarında, endotel hücre deriVed hiPSCs, endotelyal soylara daha verimli bir şekilde farklılaştı. Bununla birlikte, bu hücre soyları arasındaki önemli fark, hiPSC'lerde 20 pasajda kayboldu. Bu nedenle, klinik araştırmalarda kullanıldıklarında hiPSC'lerin erken pasajlarda taşıdığı somatik hafızayı dikkatlice düşünmek önemlidir.

Son zamanlarda, defektif eklem kıkırdağı onarmak için çeşitli prosedürler geliştirildi. Mikro-kırılma, doğal onarım için kemik iliğinin akını tetiklemek için kemikte birden fazla delik delerek yapılır 35 . Diz artroplastisi olarak da bilinen diz değiştirme, hasar görmüş kıkırdakları değiştirmek için kullanılır. Bununla birlikte, mikro kırma ciddi eklem kıkırdak hasarı için yararlı değildir ve diz değiştirmeleri için kullanılan araç her 10-15 yılda bir değiştirilmelidir.

Günümüzde hücre temelli tedaviler, kıkırdak tamiri için umut verici bir alternatif yöntemdir. Otolog kondrosit implantasyonu (ACI) genişHücre bazlı kıkırdak iyileşmesi için kullanılır. ACI, otolog kondrositleri kusur içine doğrudan enjekte ederek yapılır. Bununla birlikte, otolog kondrositler , in vitro yetiştirme koşulları altında fibroblast benzeri hücrelere dönüşürler. Otolog kondrositlerin hasat işlemi sırasında ek hasar da kaçınılmazdır. MSC'ler, kıkırdak iyileşmesi için bir hücre kaynağı olarak önerilmiştir. Kordon kanı, mühendislik kıkırdağı için yararlı ve erişilebilir bir MSC kaynağıdır 36 . Ancak, kordon kanı MSK'larının izole edilmesi için başarı oranı tartışmalı 37 , 38 . Kordon kanı MSC'lerinin başarılı şekilde izole edildiğini gösteren çok sayıda çalışma bulunmaktadır. Birkaç çalışma, kordon kan hacminin MSC izolasyon verim oranını etkileyebilecek kritik bir parametre olduğunu göstermiştir 36 , 39 . Yüksek kaliteli MSC'ler edinmek için hücrelerin geçişi de kritik önem taşır. Önceki çalışmalar,T MSC'lerin belli bir hücre bölünme sayısından sonra sınırlı bir ömrü vardır. Yaşlanmaya girerek, MSC'ler, herhangi bir normal somatik hücre 40'da olduğu gibi azalmış çoğalma ile karakterizedir. Bu nedenle, hücre yaşlanmasını ve kromozomal anormalliklerden kaçınmak için kordon kanından türetilmiş MSC'lerin altıncı pasajdan önce kullanılması gerekir 41 .

Bu kısıtlamalardan kaçınmak için insan iPSC'leri, yüksek verimlilikle kişiselleştirilmiş, hücre temelli terapi için yeni bir olasılık yarattı 11 . Kurulan hiPSC'ler teorik olarak sınırsız şekilde çoğalabilirler. Ayrıca, bağışçı ile aynı bağışıklık kimliğiyle , in vivo yerleştirildiklerinde reddetmeyi ve düşük yan etkileri önleyebilirler. Kordon kan bankalarının allojenik medikal tedaviler için hiPSC bankalarına geçişi muazzam ihtimal ve potansiyele sahiptir 42 . Homozigot HLA-tip CBMC'leri yeniden programlamadan önce tarama, allogeneik iPSC hatlarıR klinik tedavi. Homozigot iPSC hatları allograft transplantasyonundan sonra immünolojik reaksiyonları önleyebilir. Bu kavram, HLA-homozigot kıkırdak 11 üretmek suretiyle kıkırdak rejenerasyonuna da uygulanabilir.

Genellikle, kondrojenik farklılaşma iki kritik aşamada yapılır: EB'den türetilmiş büyüme hücrelerinin indüksiyonu ve pelet oluşumu. HiPSC'lerin EB'den türeyen büyümekte olan hücrelere ilk farkı, bunların kondrojenik farklılaşma potansiyelini arttırmak için kritik önem taşır. HiPSClerden farklı büyüme hücreleri işlevsel ve moleküler olarak BMSC 7 , 43'e benzemektedir. Önceki çalışmalar mezenkimal benzeri hücreleri indüklemek için ön ayırma adımı olarak tek tabaka kültürü veya EB kültürü kullandı 10 , 43 . Bununla birlikte, tek katmanlı kültürle doğrudan farklılaşma EB'lerin kullanımına kıyasla zaman almaktadır Ondrojenik peletler hipertrofik özelliklere sahip fibrokartilaje ayırma eğilimi gösterirler. Üretilen mezenkimal benzeri progenitör hücrelerin hücre morfolojisi ve kondrojenik farklılaşma potansiyelinin, hücre tek tabakasının 9 hücre yoğunluğuna göre büyük farklılık gösterdiği bildirilmiştir.

Büyüme hücrelerini indüklemek için EB'ler kullandık, bu da tek katmanlı kültürle karşılaştırıldığında nispeten hızlı ve basit bir yöntemdir. Bu protokolü kullanarak, nispeten az sayıda hiPSC kullanarak birçok pelet oluşturabildik ( Tablo 1 ). EB'lerin boyutu ve sayısı başarılı kondrojenik pelet kitlesel üretimi için kritikti. Bu nedenle, üretilen EB'lerin yarısından fazlasının 100 μm'den büyük olması için, E8 ortamında toplanmış EB'leri genişlettik. EB büyümesinden sonra, EB'leri FGF2 içermeyen E8 ortamında muhafaza ettik. Daha önce araştırmacılar, mezoderm soy indüksiyonu için üretilen EB'leri FGF2 olmadan korumuştuXref "> 9.

Daha iyi kalite için üretilen büyüme hücrelerini yüksek yoğunlukta korumaya çalışsak da, hala birçok kısıtlama söz konusudur. Üretilen büyüme hücrelerinin benzer bir morfolojiyi paylaştığını doğrularken de, hücreler hâlâ heterojen olabilir. Önceki çalışmalar, belirli bir hücre türü için sıralama yapmayı denedi; Bununla birlikte, bu prosedür düşük sayıda hücrenin toplanmasına neden olmuştur. Gelişmiş özelliklere sahip çok miktarda kondrojenik pelet üretmek için homojen dışa vurma hücrelerini daha geniş ölçekte izole etmek için yeni bir girişim gerekecektir.

Çeşitli gruplar, tek katmanlı veya EB kültürünü kullanarak hiPSC'lerden öncü hücreleri indüklemektedir. MSC'lere yüksek benzerlik gösteren progenitör hücrelerin indüksiyonu, daha yüksek kalitede kondrojenik pelletlerin elde edilmesinde anahtar olabilir. EB'lerden türetilen bu öncü hücreler MSC'lerinkine benzer özelliklere sahiptir. Bununla birlikte, bunun nedeniFibroblastik yapı. Bu nedenle, büyümekte olan hücreler hakkında ayrıntılı bir doğrulama çalışması gereklidir.

Bu çalışmada, nispeten büyük miktarlarda kondrojenik pellet oluşturabilen bir protokol önermekteyiz. CBMC-hiPSC kullanarak rejenere edilen kıkırdağın sağlıklı bir fenotipi gösterdiğini ve doku rejenerasyonu için materyal olarak kullanılabileceğini doğruladık. Bununla birlikte, daha ileri uygulama için daha kısa bir farklılaşma zaman çizelgesi ile geliştirilmiş bir yöntem gereklidir. Kıkırdak yenilenmesi için hücre malzemesi olarak gelecekte CBMC-hiPSC'lerin uygulanması için kıkırdağı yüksek düzeyde hiyalin ile doğrulamak için kalite kontrol standartlarının geliştirilmesi de gereklidir. Protokol basit ama etkili olup, pellet oluşumu öncesinde herhangi bir ek sıralama işlemi gerektirmez. Sonuç olarak, bu protokolü kullanarak, hastalığın modellenmesi, uyuşturucu taraması ve rejeneratif tıp üzerine yapılan çalışmalar için yüksek kaliteli kondrojenik pelletler üretilebilir.Kıkırdak doğası.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgements

Bu çalışma Sağlık Bakanlığı, Refah ve Aile İşleri Bakanlığı, Kore Cumhuriyeti (HI16C2177) tarafından yapılan Kore Sağlık Teknolojisi Ar-Ge projesinin bir hibesi tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics