Взаимодействие с мРНК из протопластов растений

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы представляем протокол захвата сигналов, примененный к протопластам листьев Arabidopsis thaliana leaf mesophyll. Этот метод критически полагается на ультрафиолетовое сшивание in vivo и позволяет изолировать и идентифицировать растительные мРНК-связывающие белки из физиологической среды.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

РНК-связывающие белки (RBPs) определяют судьбы РНК. Они участвуют во всех путях биогенеза РНК и особенно вносят свой вклад в посттранскрипционную регуляцию генов (ПГРР) мессианных РНК (мРНК). В последние несколько лет ряд связанных с мРНК протеомами из клеточных линий дрожжей и млекопитающих успешно изолировали с помощью нового метода, называемого «захват млекопитающих мРНК», который позволяет идентифицировать мРНК-связывающие белки (mRBP) Непосредственно из физиологической среды. Метод состоит из ультрафиолетового (УФ) сшивки in vivo , вытягивания и очистки комплексов рибонуклеопротеинов мессенджера (mRNPs) гранулами олиго (dT) и последующей идентификации сшитых белков с помощью масс-спектрометрии (MS). Совсем недавно, применяя тот же метод, сообщалось о нескольких растительных мРНК-связанных протеомах из разных источников ткани Arabidopsis : этиолированные проростки, ткань листьев,Протопласты листьев мезофилла и культивируемые корневые клетки. Здесь мы представляем оптимизированный метод захвата мРНК-методом для протопластов листьев Arabidopsis thaliana leafes, тип клеток, который служит универсальным инструментом для экспериментов, которые включают в себя различные клеточные анализы. Условия для оптимального выхода белка включают количество исходной ткани и продолжительность УФ-облучения. В мРНК-связанном протеоме, полученном из среднемасштабного эксперимента (10 7 клеток), обнаружены RBP, отмеченные наличием РНК-связывающей способности, и были идентифицированы многие новые RBP. Эксперимент может быть увеличен (10 9 клеток), и оптимизированный метод может быть применен к другим типам растительных клеток и видам, чтобы широко изолировать, каталогизировать и сравнивать связанные с мРНК протеомы в растениях.

Introduction

Эукариоты используют множественные регуляторные пути биогенеза РНК для поддержания клеточных биологических процессов. Среди известных типов РНК мРНК очень разнообразна и обладает кодирующей способностью белков и их изоформ 1. Путь ПТРГ направляет судьбы пре-мРНК 2 , 3 . RBP из разных семейств генов контролируют регуляцию РНК, а в PTGR специфические mRBPs направляют мРНК через прямые физические взаимодействия, образуя функциональные mRNP. Таким образом, идентификация и характеристика mRBPs и их mRNPs имеет решающее значение для понимания регуляции метаболизма клеточной мРНК 2. За последние три десятилетия различные методы in vitro, включая анализ сдвига электрофоретической подвижности РНК (REMSA), систематическую эволюцию лигандов с помощью экспоненциальных анализов обогащения (SELEX), основанный на библиотечных конструкциях, RNA Bind-n-Seq (RBNS), радиоактивно меченых или количественныхФлуоресцентные анализы связывания РНК, рентгеновская кристаллография и ЯМР-спектроскопия 4 , 5 , 6 , 7 , 8 , 9 - широко применяются к исследованиям RBP, главным образом из клеток млекопитающих. Результаты этих исследований RBP млекопитающих можно искать через РНК-связывающую базу данных протеина (RBPDB), которая собирает опубликованные наблюдения 10 .

Хотя эти подходы in vitro являются мощными инструментами, они определяют связанные мотивы РНК из заданного пула последовательностей РНК и поэтому ограничены в их способности обнаруживать новые целевые РНК. То же самое верно и для вычислительных стратегий для прогнозирования генома ОДП, которые основаны на сохранении белковой последовательности и структуры 15. Чтобы преодолеть это, новый экспериментальный метод haЧто позволяет идентифицировать мотивы РНК, с которыми взаимодействует RBP, а также для определения точного местоположения привязки. Этот метод, называемый «сшивка и иммунопреципитация» (CLIP), состоит из ультрафиолетового сшивания in vivo с последующим иммунопреципитацией 11 . Ранние исследования показали, что фотоактивация ДНК и РНК-нуклеотидов может происходить при длинах волн возбуждения УФ-лучей, превышающих 245 нм. Реакция через тимидин, по-видимому, благоприятствует (ранг в порядке уменьшения фотореактивности: dT ≥ dC> rU> rC, dA, dG) 12 . Используя УФ-излучение с длиной волны 254 нм (УФ-С), было обнаружено, что ковалентные связи между нуклеотидами РНК и остатками белка создаются в пределах лишь нескольких ангстрем (Å). Явление, таким образом, называется «нулевой длиной» сшивки РНК и RBP. За этим может следовать строгая процедура очистки Dure с небольшим фоном 13 , 14 .

Стратегия, дополняющая CLIP, заключается в том, чтобы объединить UV-сшивание in vivo с идентификацией белка для описания ландшафта RBP. Ряд таких геномных мРНК-связанных протеомов был выделен из дрожжевых клеток, эмбриональных стволовых клеток (ESCs) и клеточных линий человека ( т.е. HEK293 и HeLa) с использованием этого нового экспериментального подхода, называемого «захват мРНК-взаимодействием» 18 , 19 , 20 , 21 . Метод состоит из ультрафиолетового сшивки in vivo с последующей очисткой mRNP и протеомикой на основе MS. Применяя эту стратегию, было обнаружено много новых «лунных светящихся» RBP, содержащих неканонические RBD, и стало ясно, что больше белков обладает способностью связываться с РНК, чем предполагалось ранее«> 15 , 16 , 17. Использование этого метода позволяет использовать новые приложения и возможность отвечать на новые биологические вопросы при исследовании RBP. Например, недавнее исследование исследовало сохранение связанного с мРНК протеомом (основной RBP Протеом) между клетками дрожжей и человека 22 .

Было обнаружено, что RBP растений уже участвуют в росте и развитии ( например , в посттранскрипционной регуляции времени цветения, циркадных часов и экспрессии генов в митохондриях и хлоропластах) 24 , 25 , 26 , 27 , 28 , 29 , Кроме того, предполагается, что они выполняют функции в клеточных процессах, реагирующих на абиотические стрессы ( например, холод, засуха, sa(ABA)) 31 , 32 , 33 , 34 . В геноме Arabidopsis thaliana имеется более 200 предсказанных генов RBP, основанных на мотивах мотивов распознавания РНК (RRM) и K homology (KH); В рисе было отмечено около 250 35 , 36 . Примечательно, что многие предсказанные ОСП, по-видимому, уникальны для растений ( например, не ортологий метазоанов примерно до 50% предсказанных ОКРБ Arabidopsis, содержащих домен RRM) 35 , предполагая, что многие могут выполнять новые функции. Функции большинства прогнозируемых ОДП остаются нехарактерными 23 .

Выделение мРНК-связанных протеомов из этиолированных проростков Arabidopsis , листовой ткани, культивируемых корневых клеток и протопластов листьев мезофилла посредством использованияНедавно был зарегистрирован захват мРНК-взаимодействием 38 , 39 . Эти исследования демонстрируют сильный потенциал систематической каталогизации функциональных RBP на заводах в ближайшем будущем. Здесь мы представляем протокол для захвата мРНК-захвата из протопластов растений ( т. Е. Клеток без клеточных стенок). Протопласты мезофилла листа Arabidopsis thaliana являются основным типом листовых клеток. Изолированные протопласты обеспечивают оптимальный доступ к ультрафиолетовому излучению. Этот тип клеток можно использовать в анализах, которые временно экспрессируют белки для функциональной характеристики 40 , 41 . Кроме того, протопластика была применена к нескольким другим типам растительных клеток и видам 42 , 43 , 44 ( например, Petersson et al ., 2009; Bargmann and Birnbaum, 2010; Hong и др ., 2012).

<P class = "jove_content"> Метод включает в общей сложности 11 шагов ( рисунок 1A ). Сначала собирают протопласты листьев Arabidopsis (этап 1) и затем подвергают ультрафиолетовому облучению с образованием сшитых mRNP (стадия 2). Когда протопласты лизируют в условиях денатурации (этап 3), сшитые mRNPs высвобождаются в буфере для лизиса / связывания и вытягиваются бусинами олиго-d (T) 25 (этап 4). После нескольких раундов строгих промывок mRNP очищают и далее анализируют. Денатурированные пептиды mRBPs расщепляются протеиназой K до того, как сшитые мРНК очищаются и качество РНК проверяется qRT-PCR (этапы 5 и 6). После обработки РНКазой и концентрации белка (стадия 7) качество белка контролируется электрофорезом на основе полиакриламидного геля SDS (SDS-PAGE) и окрашиванием серебром (этап 8). Различие в структурах полос белка может быть легко визуализировано между сшитым образцом (CL) и несшитым образцом (не-CL;Отрицательный контрольный образец из протопластов, который не подвергается УФ-облучению). Идентификация белков достигается с помощью протеомики на основе MS. Белки из образца CL отделяют одномерным электрофорезом на полиакриламидном геле (1D-PAGE) для удаления возможного фонового загрязнения, «расщепляют в геле» в короткие пептиды с использованием трипсина и очищают (этап 9). Нано-фазовая жидкостная хроматография, связанная с масс-спектрометрией (нано-LC-MS), позволяет определять количество определенных белков в мРНК-связанном протеоме (этап 10). Наконец, идентифицированные mRBP характеризуются и каталогизируются с использованием биоинформационного анализа (этап 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Изоляция протопластов листьев Arabidopsis Leaf

ПРИМЕЧАНИЕ. Протопласты листьев мезофилла листа Arabidopsis по существу изолированы, как описано Yoo et al ., 2007, с несколькими модификациями 40 .

  1. Рост растений
    1. Замачивайте приблизительно 200 семян экотипа Arabidopsis thaliana Col-0 в стерилизованной воде в течение 2 дней при 4 ° C в темноте для расслоения.
      ПРИМЕЧАНИЕ. Этого количества семян достаточно для одного образца без CL и одного образца CL (см. Шаг 1.3).
    2. Приготовить горшки с 50% ( об. / Об. ) Смесью почвы и вермикулита и впитать горшки с дистиллированной водой в поддон для влаги почвы.
    3. Высевайте и распределите слоистые семена на влажной почве. Не покрывайте семена дополнительным почвом, потому что семена Арабидопсиса нуждаются в свете для прорастания.
      ПРИМЕЧАНИЕ. Условия роста растений - 12 часов светлого / 12-часового темного цикла при 23 ° C,С интенсивностью света 100 мкмоль м -2 с -1 , в комнате для роста в течение 5 недель до цветения. Также можно использовать 4-недельные растения 40 .
      ПРИМЕЧАНИЕ. Все описанные материалы и реагенты с этапа 1.2.1 - этап 3.2.3 предназначены для двух образцов ( например, один образец без CL (контрольный образец, который не подвергается облучению УФ-С) и один образец CL (исследование Образец, который подвергается облучению УФ-С)).
  2. Получение раствора изотонического фермента
    1. Сделайте 80 мл первичного раствора изотонического фермента (400 мМ маннита, 20 мМ KCl и 20 мМ буфера MES (рН 5,7)) и немедленно нагрейте раствор в инкубаторе 60 ° C в течение 10 мин.
    2. Добавьте 1,2 г целлюлазы R10 (вес / объем 1,5%) и 0,32 г Macerozyme R10 (вес / объем) 0,4% порошок в теплом первичный раствор изотоническим фермента.
    3. Осторожно доведите порошок фермента до раствора, осторожно перемешайте. РэпМедленно нагревают раствор в инкубаторе 60 ° C в течение 10 минут, пока раствор фермента не станет светло-коричневым.
    4. Охлаждают раствор на льду в течение 3 мин и добавляют к раствору 800 мкл 1 М CaCl 2 и 800 мкл 10% ( мас. / Об. ) BSA.
    5. Гомогенизируйте раствор путем пипетирования и фильтрации через фильтр 0,22 мкм. Аликвоте это окончательное решение изотонического фермента в две крупномасштабные чашки Петри (150 мм x 20 мм).
  3. Подготовка полосок листьев розетки Arabidopsis
    ПРИМЕЧАНИЕ: 150 листов для каждой чашки Петри рекомендуется для одного образца без CL или одного образца CL.
    1. Выбрать и сократить в общей сложности 300 полностью расширены 2 - го - 3 - го или -паре настоящего листьев ( в среднем: 3 - 4 за розетку) в 0,5- до 1-мм листовых полос с использованием нового и резкое бритву.
    2. Перенесите и погрузите полоски сразу в раствор изотонического фермента.
      ПРИМЕЧАНИЕ. Чтобы избежать контакта со светом, всегда закрывайте tОн Петри с алюминиевой фольгой. Не раздавливайте листья. Убедитесь, что все полоски погружены в раствор и не плавают на поверхности.
  4. Выделение протопластов листьев мезофилла листа Arabidopsis
    1. Поместите покрытые алюминиевой фольгой чашки Петри в вакуумные эксикаторы и инфильтрируйте полоски листьев под вакуумом в течение 30 мин. Затем инкубируйте чашки Петри в темноте, не встряхивая при комнатной температуре в течение 2,5 часов.
    2. Осторожно и коротко встряхните посуду горизонтально вручную, пытаясь полностью выпустить протопласты в раствор фермента.
  5. Сбор и подсчет протопластов
    1. Отфильтруйте суспензию протопласта через нейлоновую сетку от 35 до 75 мкм. Аликвот фильтрата каждого образца в две круглодонную трубку объемом 50 мл (приблизительно 20 мл фильтрата в каждой пробирке).
    2. Промыть каждую чашку Петри 10 мл буфера W5 (154 мМ NaCl, 125 мМ CaCl
    3. Вращайте все четыре трубки в течение 5 мин при 100 × g для осаждения протопластов. Удалите супернатант и осторожно ресуспендируйте гранулы протопласта в каждой пробирке с 10 мл буфера W5.
      ПРИМЕЧАНИЕ. При ресуспендировании гранул протопласта осторожно переверните трубу вверх дном и осторожно вращайте трубку вручную, пока гранулы не исчезнут. Не пипетируйте гранулу непосредственно, чтобы не повредить клетки.
    4. Повторите шаг 1.5.3 один раз и объедините суспензию протопласта из двух пробирок каждого образца в одну круглодонную трубку объемом 50 мл. Держите трубки на льду.
    5. Подсчитайте протопласты с помощью гемоцитометра.
      ПРИМЕЧАНИЕ. Каждые 20 клеток в пределах 25 кубов равны 2 × 10 5 протопластов / мл. 150 листьев должны давать приблизительно 1 × 10 7 клеток.Модулируйте равное общее количество протопластов в образцах, отличных от CL и CL.
    6. Храните протопласты на льду в течение 30 минут. Затем вращают трубки в течение 5 мин при 100 × g. Удалите супернатант и ресуспендируйте протопласты в каждой пробирке с 20 мл раствора MMg (400 мМ маннит, 15 мМ MgCl 2 и 4 мМ буфера MES (рН 5,7)).

2. Сшивание мРНК-белка in vivo путем ультрафиолетового облучения

ПРИМЕЧАНИЕ. Храните пробирку для образцов, отличную от CL, на льду. Образец CL должен быть немедленно облучен ультрафиолетом.

  1. Перенесите суспензию протопласта, содержащую 1 × 10 7 клеток из пробирки для образцов CL, в новую крупномасштабную чашку Петри (150 мм x 20 мм) и добавьте 30 мл ледяного раствора MMg для покрытия поверхности пластины. Распространяйте клетки во всем буфере MMg, осторожно пипетируя. Немедленно поместите чашку Петри без верхней крышки в УФ-сшивающее устройство.
    ПРИМЕЧАНИЕ. Высота между УФ-лампойИ чашка Петри составляет 8 см.
  2. Облучают образец с ультрафиолетовым светом с длиной волны 254 нм и интенсивностью УФ-излучения 0,00875 Вт / см 2 в течение 1 мин, 3 мин или 5 мин. После облучения быстро аликвотируйте суспензию протопласта в две новые 50-миллилитровые круглодонковые трубки. Промойте нижнюю часть блюда дополнительными 5 мл ледяного раствора MMg, чтобы собрать оставшуюся часть протопластов и добавить эту клеточную суспензию в эти две трубки.
    ПРИМЕЧАНИЕ. В качестве оптимального условия выбрано 1 мин. Объяснение можно найти в Представительских результатах .

3. Лицеирование протопластов в условиях денатурирования

  1. Получение гранул протопласта для лизиса
    1. Прокрутите пробирку для пробы не-CL вместе с двумя пробирками для образцов CL со стадии 2 при 100 × g в течение 5 минут и отбросьте супернатант. Поместите пробирку протопласта образца non-CL обратно на лед.
    2. Добавьте 10 мл ледяного раствора MMg в каждую пробирку для образцов CL, genПовторно ресуспендируют гранулы и объединяют их в одну трубку с круглым дном диаметром 50 мл. Вращайте трубку со скоростью 100 мкг в течение 5 мин. После удаления надосадочной жидкости держите пролетарный осадок пробы образца CL на льду.
  2. Литрат протопластов и гомогенизация липидов протопластов
    1. Добавить 9 мл ледяного лизиса / связывающего буфера (500 мМ LiCl, 0,5% ( мас. / Об.) Додецилсульфата лития (LiDS), 5 мМ дитиотреитола (DTT), 20 мМ Трис-HCl (pH 7,5) и 1 мМ EDTA (pH 8,0)) в клеточный осадок каждого образца. Грубо лизируйте протопласты путем пипетирования вверх и вниз примерно 20 раз, пока суспензия не станет однородно светло-зеленой.
    2. Пропустите протопласт-лизат два раза через стеклянный шприц объемом 50 мл с узкой иглой (0,9 × 25 мм 2 ) для гомогенизации. Инкубируйте лизат на льду в течение 10 мин. Заморозить лизаты в жидком азоте и хранить при -80 ° C в течение 3 недель.

4. Отвод и очистка mRNPOligo-d (T) 25 Бусины

ПРИМЕЧАНИЕ. Все следующие описанные материалы и реагенты, начиная с этапа 4.1 до этапа 4.4, относятся только к одному образцу ( т. Е. К одному образцу , отличному от CL или к одному образцу CL). Лизат протопласта должен быть немедленно добавлен к пробиркам, содержащим гранулы, после того, как буферный раствор для лизиса / связывания буфера отбракован.

  1. Получение магнитных гранул олиго-d (T) 25 для захвата олиго (dT)
    1. Оттепель замороженного литрата протопласта при комнатной температуре. Когда лизат полностью разморожен, держите трубку с лизатом на льду.
    2. Аликвоту добавляли 1,8 мл магнитных гранул олиго-d (T) 25 (5 мг / мл) в 6 новых круглодонных микроцентрифужных пробирки объемом 2 мл на льду. В каждую пробирку тщательно промыть суспензию бусинок 600 мкл буфера для лизиса / связывания путем кратковременного пипетирования вверх и вниз и осторожно вращаться при 4 ° С в течение 2 мин. Держите бусины на льду.
  2. переплет
    1. МестоВсе 6 трубок, содержащих гранулы, в магнитную стойку при 4 ° C в течение 3 минут, что приведет к магнитному захвату гранул и очистке суспензии.
      ПРИМЕЧАНИЕ. Когда трубки помещаются в магнитную стойку, подождите, пока бусины не будут полностью захвачены, не менее 3 мин.
    2. Отбросьте супернатант и немедленно аликвоте 9 мл лизата протопласта в эти 6 пробирок. Хорошо перемешайте пипетированием до появления гомогенной коричневой суспензии и инкубируйте гранулы в литрате протопласта при 4 ° C в течение 1 часа, применяя мягкое вращение.
      ПРИМЕЧАНИЕ. Рекомендуется время инкубации от 30 минут до 1 часа.
  3. Мойка
    1. Поместите трубки обратно в магнитную стойку при 4 ° C в течение 3 минут. Когда все бусины захватываются сбоку от трубок, соберите протопластичный лизат в 6 новых круглых микроцентрифужных пробирок объемом 2 мл и временно храните их при 4 ° C. НЕ ОТПУСКАЙТЕ лизат протопласта немедленно; Поддерживать лизатПри 4 ° С.
    2. Добавить 1,5 мл ледяного промывочного буфера 1 (500 мМ LiCl, 0,1% (масса / объем ) LiDS, 5 мМ ДТТ, 20 мМ Трис-HCl (рН 7,5) и 1 мМ ЭДТА (рН 8,0)) к шарикам В каждой трубе. Повторно суспендируйте шарики и применяйте осторожное вращение в течение 1 мин. Поместите трубки обратно в магнитную стойку при 4 ° C в течение 3 минут и отбросьте супернатант. Повторите эту операцию промывки один раз.
    3. Повторите эту же процедуру этой стадии промывки дважды, используя 1,5 мл ледяного промывного буфера 2 (500 мМ LiCl, 5 мМ ДТТ, 20 мМ Трис-HCl (pH 7,5) и 1 мМ ЭДТА (рН 8,0)) и один раз используя 1,5 мл ледяного низкосолевого буфера (200 мМ LiCl, 20 мМ Трис-HCl (pH 7,5) и 1 мМ ЭДТА (рН 8,0)).
      ПРИМЕЧАНИЕ. Если mRNP были эффективно изолированы от лизата протопласта, на шаре гранул в образце CL должно появиться «гало», видимое вокруг шарика, на промывной буфере 2 ( рис. 1B ).
  4. элюирование
    1. Добавить 500 мклБуфера для элюирования (20 мМ Трис-HCl (pH 7,5) и 1 мМ ЭДТА (рН 8,0)) к шарикам в каждой пробирке. Аккуратно ресуспендируйте гранулы и инкубируйте при 50 ° C в течение 3 минут, чтобы высвободить поли (A) -ориентированные РНК. Осторожно ресуспендируйте бусины один раз пипетированием. Поместите трубки обратно в магнитную стойку при 4 ° C в течение 5 минут.
    2. Перенесите и объедините все элюенты (приблизительно 3 мл) в чистую, стерильную, не содержащую RNase, 15-мл коническую трубку на льду.
      ПРИМЕЧАНИЕ. Качество и количество РНК можно сразу определить с помощью спектрофотометра.
      ПРИМЕЧАНИЕ. Концентрация РНК каждого образца составляет приблизительно 10 нг / мкл, отношение A 260 / A 280 составляет 1,9. Отношение A 260 / A 280 должно составлять от 1,6 до 2,0, потому что изолированные поли (A) -устойчивые РНК обычно больше, чем 70%. Если концентрация РНК слишком низкая, увеличьте количество исходных протопластов до максимума 10 9 . образцыМожно замораживать в жидком азоте и выдерживать при 80 ° C для длительного хранения.
    3. Повторите шаг 4.2 до шага 4.4 для дополнительных двух раундов и повторно используйте гранулы олиго-d (T) 25, чтобы истощить поли (А) -устойчивые РНК из литрата протопласта.
      ПРИМЕЧАНИЕ. После трех раундов процедуры вытягивания должно быть в общей сложности 9 мл элюента для каждого образца, отличного от CL или CL. Выполните все работы при температуре 4 ° C, чтобы избежать деградации РНК. Выполните шаг 4.5 или шаг 4.6 для повторного использования или регенерации бусинок.
  5. Получение повторно используемых олиго-d (T) 25- гранул
    1. Промывайте бусинки дважды 1 мл ледяного буфера для элюирования и один раз 1 мл ледяного лизиса / связывающего буфера, чтобы отрегулировать концентрацию соли LiCl до 500 мМ.
    2. Следуйте шагу 4.1, отбросьте супернатант, перенесите сохраненный лизат протопласта в каждую пробирку и повторите всю процедуру с шага 4.2 до этапа 4.4 для дополнительных двух раундов.
  6. 25 бисер
    ПРИМЕЧАНИЕ. Бусины можно хранить и использовать для другого эксперимента (максимальное повторное использование - три раза).
    1. Следуйте шагу 4.4, добавьте 1 миллилитр 0,1 М NaOH к шарикам и инкубируйте, вращая при комнатной температуре в течение 5 мин. Для каждой пробирки дважды промывайте 1 мл промывочного буфера 1 и три раза 1 × PBS (pH 7,4), содержащую 0,1% Tween-20 для уравновешивания. Держите бусины из каждой пробирки в 300 мкл стерильного RNase-free 1x PBS (pH 7,4), содержащего 0,1% Tween-20 при 4 ° C для длительного хранения.
      ПРИМЕЧАНИЕ. Бусины, используемые для образцов Arabidopsis CL в этом эксперименте, могут быть использованы только для тех же образцов растений в следующий раз.

5. Обработка протеиназы К и очистка мРНК

  1. Лечение протеиназы K
    1. Добавьте 8 мкл раствора протеиназы K (2 мкг / мкл) в 1 мл элюента из каждого образца для переваривания белков с поперечной сшивкой. бромIefly вихрь.
  2. Очистка мРНК
    1. Инкубируйте элюент при 37 ° С в течение 1 часа. Очистите РНК с помощью набора для очистки РНК для удаления остаточных загрязнителей.
      ПРИМЕЧАНИЕ. После очистки РНК готовы к тестированию качества РНК с использованием анализа qRT-PCR.
      ПРИМЕЧАНИЕ. Также могут использоваться другие наборы, такие как мини-комплект РНК и реагент TRIzol. 14 .

6. Анализ qRT-PCR

  1. Обратная транскрипция
    1. Обеспечьте эффективный синтез первой цепи кДНК с использованием обратной транскрипционной системы с 1 мкг РНК в качестве матрицы. Разбавьте образец до 5 нг / мкл водой без нуклеазы.
  2. КДНК с использованием qRT-PCR
    1. Амплифицировать и количественно оценивать кДНК с использованием мастер-смеси qPCR и циклического ПЦР реального времени с 10 нг кДНК в качестве шаблона. Используйте следующую программу ПЦР: 95 ° C в течение 10 минут(Стадия 1, один цикл) и 95 ° С в течение 15 с и 60 ° С в течение 1 мин (стадия 2, 40 циклов).
      ПРИМЕЧАНИЕ. Используемый здесь контрольный ген был эндогенным внутренним контрольным геном UBQ10 (AT4G05320). Праймеры qRT-PCR для UBQ10 и 18S рРНК были описаны в Li et al ., 2014 и Durut et al ., 2014, соответственно 45 , 46 . Последовательности праймеров перечислены в таблице материалов .

7. Обработка РНКазой и концентрация мРБФ

  1. Лечение РНКазой
    1. Добавьте приблизительно 100 U коктейлей РНКазы, содержащих РНКазу А и РНКазу Т1, в 8 мл элюента. Включите образец отрицательного контроля с коктейлем RNase, в котором элюент заменяется водой, свободной от нуклеазы. Кратко встряхните и инкубируйте при 37 ° C в течение 1 часа.
  2. Концентрация mRBP
    1. После расщепления РНКазой концентрируйте элюентГ центробежных фильтров. Конечный объем составляет 75 мкл, при этом общий выход белка составляет приблизительно 2 мкг каждого образца после концентрации. Поместите образцы при -80 ° C для длительного хранения.

8. SDS-PAGE и серебряное окрашивание

  1. SDS-PAGE
    1. Смешайте 25 мкл концентрированного элюента (образец CL) или контрольный образец (образец без CL) с 15 мкл краска для нагрузки 2x. Нагреть образец при 95 ° С в течение 5 мин и загрузить его на геле SDS-PAGE, содержащем 5% гель для укладки и 12% разрешающий гель, включая маркер белка.
    2. Конденсируют белки при 60 В в течение 40 мин и отделяют при 160 В в течение приблизительно 1 ч, пока загружающий краситель не достигнет конца разрешающего геля.
  2. Анализ на окрашивание серебром
    1. Промойте гелем SDS-PAGE дважды с помощью ультрачистой воды в течение 5 минут каждый раз. Выполните окраску серебра белками, используя коммерческий набор для окрашивания серебром.
      ПРИМЕЧАНИЕ. Полосы белка должны отображаться в течение 5 мин. Если полосы видимы за 5 минут с очень светлым цветом, предлагается увеличить количество пусковых протопластов до максимума 10 9 .

9. Трипсин-дайджест белковых групп и пептидная очистка

  1. Трипсинский дайджест
    ПРИМЕЧАНИЕ: Запустите второй 1D-PAGE гель, взяв еще 25 мкл концентрированного раствора mRBP из каждого образца для идентификации mRBP; Гели, окрашенные серебром, не могут использоваться, поскольку они не совместимы с анализом MS.
    1. После запуска геля 1D-PAGE закрепите гель в фиксирующем растворе (50% ( об. / Об. ) Метаноле и 10% ( об. / Об. ) Уксусной кислоты) в течение 1 часа. Окрашивают гель в пятновом растворе (0,1% ( мас. / Об. ) Coomassie Brilliant Blue R-250, 50% ( об. / Об. ) Метанола и 10% ( об. / Об. ) Уксусной кислоты) в течение 20 мин с мягким встряхиванием. Назначают гель в растворе для растворения (40% ( об. / Об.) Метанола и 10% ( v/ Об.) Уксусной кислоты) в течение 1 часа. После удаления держите гель в 5% ( об. / Об.) Уксусной кислоте.
      ПРИМЕЧАНИЕ. Во время уничтожения новое решение для решения может быть заменено до тех пор, пока фон не будет полностью уничтожен.
    2. Вырежьте полосы интереса из геля. Вырезать полосы далее на кусочки приблизительно 1 мм 3 для последующего оптимального расщепления трипсином и экстракции пептидов. Гидратируйте части геля 50 мкл 100 мМ бикарбоната аммония (NH 4 HCO 3 ) в течение 10 мин. Полностью накройте части геля.
      1. Тщательно удалите гидратирующий раствор и дегидратируйте части геля ацетонитрилом (CH 3 CN) в течение 10 мин. Осторожно удалите раствор ацетонитрила.
      2. Повторите процесс от гидратации до обезвоживания дважды. Наконец, удалите раствор ацетонитрила.
        ПРИМЕЧАНИЕ. Время работы геля зависит от цели эксперимента. Длительное время позволяет хорошо разделять белки, поэтому окрашенный специфический гель запретDs можно вырезать для дальнейшего анализа. Если цель состоит в том, чтобы сохранить белки и удалить загрязняющие вещества, достаточно короткого времени работы.
    3. Добавить 500 мкл 6,6 мМ раствора DTT и инкубировать части геля в течение 10 мин. Удалите раствор DTT и дважды промойте гель кусочками 500 мкл 95% ( об. / Об. ) Раствора ацетонитрила.
      1. После промывки удалите раствор ацетонитрила и инкубируйте части геля с 500 мкл 55 мМ раствора йодауксусной кислоты (IAA) в течение 10 мин в темноте.
      2. После инкубации удалите раствор и снова промойте части геля 500 мкл 95% ( об. / Об. ) Раствора ацетонитрила. Высушите части геля.
    4. Вложите пол геля полностью в 25 мкл буфера для переваривания (50 мМ NH 4 HCO 3 , 5 мМ CaCl 2 и 6 нг / мкл трипсина) и держите на льду в течение 45 минут, чтобы трипсин проникал в гель. Инкубируйте части геля в течение ночи при 37 ° C для en Зиматическое переваривание.
  2. Пептидная очистка
    1. Добавьте 80 мкл 50 мМ NH 4 HCO 3 к частям геля в буфере для переваривания и вихревым повтором для извлечения триптических пептидов. Соберите экстракт. Повторите эту операцию экстракции дважды с помощью 80 мкл 50% ( об. / Об. ) CH 3 CN и 5% ( об. / Об. ) Муравьиной кислоты (FA).
      ПРИМЕЧАНИЕ. Общий конечный экстракт должен составлять примерно 240 мкл.
    2. Пул и концентрируют экстракты примерно до 10 мкл с помощью вакуумной концентрации или лиофилизации и добавляют 25 мкл 0,1% ( об. / Об. ) Водного раствора трифторуксусной кислоты (TFA). Удалите образцы с помощью столбцов μ-C18, следуя протоколу производителя.
    3. Элюируют пептиды с 4-10 мкл 60% ( мас. / Об. ) CH 3 CN и 0,1% ( об. / Об. ) FA. Лиофилизуйте (замораживайте-сухую) пептиды и храните их при -20 ° C до анализа.
Title "> 10. Нано-LC-MS

  1. Нано-фазовая жидкостная хроматография
    ПРИМЕЧАНИЕ. Выполните анализ LC-MS с помощью масс-спектрометра, который подключен к сети с помощью прибора для жидкостной хроматографии. Этот прибор должен быть оснащен колонкой С18 (размер частиц 2 мкм, размер пор 100 Å и размерность 50 мкм × 15 см).
    1. Ресуспендируют лиофилизированные пептиды в 16 мкл раствора (2% ( об. / Об. ) CH 3 CN и 0,1% ( об. / Об. ) FA). Внесите и загрузите 5 мкл раствора пептида со скоростью потока 5 мкл / мин на предварительном столбе C18 (размер частиц 3 мкм, размер пор 100 Å, нановипер и размер 75 мкм × 2 см).
    2. 10.1.2. Отдельные пептиды используют 95-минутный градиент с расходом 300 нЛ / мин. Во время этого градиента разделения увеличьте подвижную фазу В от 4% до 10%, от 10% до 25% и от 25% до 45% за 5 мин, 50 мин и 18 мин соответственно. Наконец, круто увеличьте подвижную фазу B до 95% за 1 мин. ПослеКаждый 95-минутный градиент разделения применяют встроенную стадию полоскания, содержащую 10-минутный градиент от 4% до 95% за 5 мин.
      ПРИМЕЧАНИЕ. Мобильная фаза A составляет 99,9% H 2 O и 0,1% ( об. / Об.) FA, а подвижная фаза B составляет 19,92% H 2 O, 80% ( мас. / Об.) CH 3 CN и 0,08% ( об. / Об.) ) FA.
  2. Масс-спектрометрический анализ
    1. Управляйте масс-спектрометром в режиме, зависящем от данных, с диапазоном масс от 400 до 1600 м / с.
    2. Выбирайте до десяти самых интенсивных ионов в MS1 для генерации спектров фрагментации. Установите разрешение до 70 000 полной ширины с половиной максимального (FWHM) для MS1 и 17 000 для MS2 с целью автоматической регулировки усиления (AGC) 30000000 и 1,000,000 ионов и максимального времени впрыска ионов (IT) 256 и 64 мс для MS1 И MS2, соответственно.
    3. Установите динамическое исключение на 10 с, чтобы избежать повторной фрагментации наиболее распространенных ионов.
      ПРИМЕЧАНИЕ. Здесь ионы с одним или более шести зарядовXcluded для MS2.
  3. Качественная протеомика: идентификация пептида и белка
    1. Анализ спектров фрагментации с использованием программного обеспечения, такого как программное обеспечение Peaks studio 47 , 48 , 49 .
      ПРИМЕЧАНИЕ. Другие пакеты программного обеспечения также доступны для идентификации пептидов, таких как NovoHMM 30 и PepNovo 37 для секвенирования novo и SEQUEST 54 и Mascot 55 для поиска базы данных.
    2. Объединить спектры с той же массой (разность <2 ppm) и время удерживания (<2 мин) и сохранить спектры с порогом качества выше 0,65 для поиска базы данных Swiss-Prot (версия: декабрь 2013 г.) для таксономии, установленной для модели Растение Arabidopsis thaliana . Используйте следующие параметры поиска: допуск массы прекурсора до 10 стр. / Мин через использование monОзиотопическая масса; Допуск массы до 20 мм; Трипсин в качестве фермента пищеварения, с максимум двумя пропущенными расщеплениями; Карбамидометилирование цистеина в качестве фиксированной модификации; Окисление метионина в качестве переменной модификации; И максимум 3 переменных посттрансляционных модификаций на пептид. После идентификации вручную устанавливайте пороговые значения для надежной идентификации пептида и белка, чтобы получить ложную скорость обнаружения (FDR) <5%.
  4. Количественная протеомика: статистический анализ данных масс-спектрометрии
    1. Используйте LC-MS ( например, Progenesis) для количественного определения количества протеомики без метки.
      ПРИМЕЧАНИЕ. Области пикового пептида MS1 (или интенсивность) связаны с пептидами, идентифицированными программным обеспечением студии в соответствии с их массой, с допущенной ошибкой максимум 10 ppm.
      ПРИМЕЧАНИЕ. Это программное обеспечение вычисляет изобилие пептида путем интегрирования областей пиков всех зарядовых состояний между 2 <Sup> + и 8 + . Количественные данные связаны с идентификацией пептида PEAKS с помощью встроенного сценария (согласование массы с допустимой ошибкой максимум 10 ppm).
    2. Вычислите средние изменения log2-fold (CL / non-CL) для каждого пептида. Группируйте складки изменений уникальных пептидов белком.
      ПРИМЕЧАНИЕ. В каждой группе окончательная смена фонового белка равна средним изменениям складок пептидов.
    3. Вычислите p-значение, используя t- критерий Стьюдента для каждой группы, чтобы оценить статистическую значимость. Примените программный пакет R (версия 3.3.0), чтобы исправить значения p для FDR всех групп, используя метод Benjamini-Hochberg (BH).
    4. Нарисуйте график вулкана, используя пакет функций «калибровать» (версия 1.7.2), совместимый с программным пакетом R (версия 3.3.0).
      ПРИМЕЧАНИЕ. Здесь значения p-значения, скорректированные с помощью log10 (-log10 (adj. P-value)), являются функцией изменений log2-fold всех идентифицированных белков. БелкиОбрабатываются как положительные удары в мРНК-связанном протеоме, если их log2-кратные изменения больше 2, с или без значимости.

11. Каталог идентифицированного промома, связанного с мРНК

  1. Классифицировать идентифицированные белки с шага 10 на три категории на основе элементов «молекулярных функций и биологического процесса» через базу данных онтологии генов (GO) и «семью и домен» через базу данных InterPro.
  2. Как категория I или «рибосомальные белки» содержат все обнаруженные рибосомальные белки, определяют белки из категории II или «основные RBPs» как содержащие аннотированные белковые домены, которые взаимодействуют с РНК или связываются с связыванием РНК с известными или неизвестными функциями в биологии РНК ,
  3. Поскольку белки с известными или неизвестными функциями в биологии РНК без аннотированных РНК-связывающих доменов помещаются в категорию III или «Кандидаты RBP», определяют ферменты из категории III на основе аннотаций из IБаза данных ntEnz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Мы наблюдали характерный ореол, который окружает гранулу шарика в образце CL, на этапе 4 промывки промывным буфером 2 ( фиг.1В ). Хотя это и не исследовалось, это явление, вероятно, можно объяснить интерференцией сшитых комплексов mRNP с агрегацией шариков во время магнитного захвата, вызывая образование более диффузного заполнителя. Это указывает на то, что захват олиго-d (T) 25 был эффективным 14 .

Значительно более высокие уровни контрольной мРНК UBQ10, чем 18S рРНК как в контроле CL, так и в CL, показаны на рисунке 1C . Это указывает на то, что мРНК обогащены элюентом из-за захвата олиго-d (T) 25 шариками, которые могут связываться только с поли (А) -устойчивыми мРНК. Эффективность захвата гранул олиго-d (T) 25 была дополнительно supp(Этап 8), как показано на фиг.1D после обработки РНКазой и концентрации mRBP (этап 7). Различие в структуре полосы белка между не-CL-регулятором и полосками пробы CL может быть четко обнаружено, а полосы белка, присутствующие в полосе контрольных образцов без CL, можно объяснить наличием РНКазы. Это иллюстрирует сильное обогащение mRBP в образце CL.

Эффективность сшивания можно контролировать, изменяя длительность ультрафиолетового облучения. Достаточное сшивание, но предотвращение повреждения протопластов и деградации РНК является оптимальным. На рисунке 1D были получены специфические образцы полос белка во всех образцах CL при сравнении различных периодов ультрафиолетового облучения (1, 3 и 5 мин). При такой же УФ-интенсивности (0,00875 Вт / см 2 ) наиболее оптимальные условия были обнаружены в течение 1 или 3 мин из-за неразличимогоИнтенсивность полосы белка. Более слабые интенсивности полос наблюдались с более длительным временем сшивания (5 мин). Мы рассматривали 1 мин как оптимальное условие, потому что более короткая продолжительность сшивания имеет дополнительное преимущество в упрощении переноса и сбора протопластов из чашки Петри. Протопласты могут быстро выпадать на дно чашки Петри во время УФ-облучения, потому что они прилипают к дну тарелки. Это затрудняет сбор и перенос их в пробирки после длительной ультрафиолетовой радиации.

Исходя из оптимизированных условий, идентификация белков из трех биологических копий впоследствии достигалась качественной и количественной протеомикой, которая была описана на этапах 9 и 10. При анализе качественной протеомикой ( рис. 1Е , справа) в общей сложности 341 белок Были идентифицированы в образцах CL, из которых 36 были найдены как в контроле без CL, так и вD CL, и только 8 белков были обнаружены в контрольном образце, отличном от CL. Эта огромная разница в количестве идентифицированных белков между обоими образцами согласуется с различными типами белковых зон ( рис. 1D ), поддерживая идею о том, что анализ SDS-PAGE и серебра - хороший инструмент для проверки эффективности олиго-d (T) 25 захвата шарика. В анализе с помощью количественной протеомики ( рис. 1Е , слева) в общей сложности 325 белков (сине-зеленого цвета) показали изменение log2-fold, большее 2. Среди этих белков 100 белков (синего цвета) имели небольшой p -значения выше уровня значимости. Поэтому они также были определены как положительные удары. Примечательно, что р-значения еще 225 белков (зеленого цвета) были больше 0,05, ниже уровня значимости из-за ограниченности данных. Другими словами, для каждого белка присутствовали малочисленные пептиды с высокой вариабельностью пептидных интенсификацийэс. Однако, поскольку все они были качественно обнаружены только в образцах CL, они считались положительными.

На основе баз данных GO и InterPro 50 (этап 11) эти 325 белков были далее классифицированы по категории I (рибосомные белки), категории II (основные RBP) и категории III (кандидатные RBP) ( рисунок 1F ). В категории I было 123 рибосомных белка, тогда как в категории II наблюдалось 70 аннотированных классических RBP. Эти две категории, которые содержат большинство аннотированных белков, связывающихся с молекулярной РНК-связыванием и РНК-биологией ( рис. 1F , справа) и которые занимают приблизительно 38% и 22% всего млекопитающего протеома, соответственно, указывают на высокую эффективность оптимизированного взаимодействия мРНК захватить. Последние 40% (132 кандидата ОДП) были отнесены к категории III из-за отсутствия обычных ОКР. Кроме того, большая частьРоль эринов в связывании РНК и биологических процессах РНК не была проверена ( рис. 1F , слева). Мы полагаем, что белки этой категории могут выявить новые функции в правилах РНК.

Рисунок 1
Рисунок 1: Блок-схема и результаты оптимизированного метода для обнаружения протеума, связанного с мРНК, из протопластов листьев Arabidopsis Leaf. ( A ) Основные этапы всего метода перечислены от 1 до 11. Предполагаемые клеточные и молекулярные процессы иллюстрируются фотографией и мультфильмами. Подробная информация для каждого шага была подробно описана в Протоколе. ( B ) Наблюдался ореол, окружающий гранулы шариков в образце CL, но не в контрольном образце, отличном от CL, во время этапа 4 стирки. ( C ) Сравнение относительной мРНК UBQ10 и 18S рРНКLs в не-CL-контроле и CL-образцах с помощью qRT-PCR (значения - среднее ± SD (n = 3); * и **: существенные различия с p <0,05 и <0,01). ( D ) Концентрированный белковый элюент контрольного образца, отличного от CL, по сравнению с образцами CL, облученными УФ-источником с непрерывной волной в течение 1, 3 и 5 мин, с интенсивностью УФ при 0,00875 Вт / см 2 . ( E ) Идентификация протеома, связанного с мРНК, протеомикой. В количественной протеомике, выполняемой программным пакетом Progenesis (слева), на графике вулкана отображаются средние изменения log2-fold (CL / non-CL) и связанные с ними p-значения (-log10 (значения p-значения)) Все белки. В качественной протеомике, выполненной программным пакетом Peaks (справа), белки в образцах проиллюстрированы на диаграммах Венна. Количество белков указано в цифрах. FDR на уровне пептида и белка составляет менее 5%. Количество белков внутри светло-коричневых фреймов считается положительным. ( et al ., 2016. Пожалуйста, нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Мы успешно применили захват мРНК-взаимодействий, разработанный для дрожжей и человеческих клеток, для протопластов листьев мезофилла. Листовые мезофильные клетки являются основным типом молочной ткани листьев растений. Основным преимуществом этого метода является то, что он использует сшивание in vivo для обнаружения белков из физиологической среды.

В этом протоколе мы в основном представляем ряд оптимизированных условий эксперимента ( например, количество протопластов для использования в качестве исходного материала и продолжительность ультрафиолетового облучения) 50 . Захваченные белки в образцах CL могут быть обнаружены только с помощью SDS-PAGE и окрашивания серебром, когда используется минимум 10 7 протопластов (средний размер) (шаг 1.5.5). Более низкие концентрации не дают наблюдаемой картины mRBP на SDS-PAGE и, вероятно, не должны использоваться для дальнейшего анализа протеомикой. Действительно, используя более 10 7 ячеек ( например, 10 9 вТакже возможен крупномасштабный эксперимент 20 . Результаты анализов на окрашивание серебром свидетельствуют о том, что ультрафиолетовое облучение в течение 1 мин с интенсивностью 0.00875 Вт / см 2, генерируемое УФ-источником с непрерывной волной, является оптимальным ( рис. 1D ). Высокая эффективность на критической стадии ( т. Е. Выведение и очистка mRNP с помощью шариков олиго-d (T) 25 , этап 4) подтверждается результатами анализов RT-qPCR, серебра и MS ( рисунок 1C ; 1D и 1E , справа). Комбинация качественной и количественной протеомики может помочь идентифицировать положительные RBP в области перекрытия между не-CL-контролем и образцами CL ( рис. 1E ). Большинство идентифицированных белков были RBP, ранее не аннотированные в наборах данных ( рис. 1F ). Мы представили эти ранее неизвестные РНК-связывающие белки в категории III в качестве кандидатов RBP <Sup class = "xref"> 50 ( рисунок 1F ). Изучение специфики привязки этих кандидатов RBP должно выполняться с использованием других методов, таких как ранее упомянутые методы CLIP 23 . Один пример, который исследует специфичность связывания RBP для регуляции его мишеней-мишенью мРНК в Arabidopsis с использованием CLIP 51, можно найти в Zhang et al ., 2015. Кроме того, альтернативный модифицированный метод PAR-CLIP, называемый фотоактивируемым- Усиленное с помощью рибонуклеозида (PAR-CL, 365 нм УФ-А) ранее было рекомендовано для исследования связанных с мРНК протеомами из дрожжей и клеток человека 14 , 23 . PAR-CL требует 4Su, который поглощается клетками и включается в зарождающиеся РНК во время метаболизма РНК и может быть высокореакционноспособным, образуя ковалентные связи с аминокислотами 52 при УФ-А (365 нм) irradiция. В настоящее время нет исследований, посвященных токсичности 4sU клеткам растений и эффективному поглощению экзогенного 4sU в протопласты мезофилла 53 . Тем не менее, мы полагаем, что станет возможным использовать как обычные CL (254 нм UV-C), так и PAR-CL (365 нм УФ-А) на растениях, что будет способствовать открытию и валидации различных RBP от физиологических Окружающей среды в будущем.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgements

Мы признаем лабораторию профессора Джориса Уиндикера, который предоставил УФ-сшивающее устройство, оснащенное обычной УФ-лампой. KG поддерживается исследовательским фондом KU Leuven и подтверждает поддержку гранта FWO G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics