ARNm Interactome Captura de Planta Protoplastos

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí, presentamos un protocolo de captura interactome aplicado a Arabidopsis thaliana protoplastos hoja mesófilo. Este método depende crıticamente de la reticulación UV in vivo y permite el aislamiento e identificación de proteınas de unión a mRNA de plantas desde un entorno fisiológico.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las proteínas de unión a ARN (RBPs) determinan el destino de los ARNs. Participan en todas las vías de la biogénesis del ARN y contribuyen especialmente a la regulación génica post-transcripcional (PTGR) de los ARN mensajeros (mRNAs). En los últimos años, se han aislado con éxito varios proteomas unidos a ARNm a partir de líneas de células de levaduras y mamíferos mediante el uso de un nuevo método denominado "captura de interactomas de mRNA", que permite la identificación de proteínas mRNA-binding (mRBPs) Directamente desde un entorno fisiológico. El método se compone de reticulación, pull-down y purificación de complejos de ribonucleoproteína mensajera (mRNPs) por bolas de oligo (dT) in vivo , y la posterior identificación de las proteínas reticuladas por espectrometría de masas (MS). Recientemente, aplicando el mismo método, se han reportado simultáneamente varios proteomas vegetales unidos a ARNm de diferentes fuentes de tejido de Arabidopsis : plántulas etioladas, tejido foliar,Protoplastos de mesófilo de hojas y células de raíces cultivadas. Aquí, presentamos el optimizado mRNA interactome método de captura de Arabidopsis thaliana hoja mesofilo protoplastos, un tipo de célula que sirve como una herramienta versátil para los experimentos que incluyen diversos ensayos celulares. Las condiciones para un rendimiento óptimo de la proteína incluyen la cantidad de tejido de partida y la duración de la irradiación UV. En el proteoma unido a ARNm obtenido a partir de un experimento de escala media (10 ^ { 7} células), se encontró que las RBP que tenían capacidad de unión a ARN estaban sobre-representadas y se identificaron muchas RBP nuevas. El experimento se puede ampliar (10 9 células), y el método optimizado se puede aplicar a otros tipos de células vegetales y especies para aislar, catalogar y comparar los proteomas unidos a mRNA en las plantas.

Introduction

Los eucariotas utilizan múltiples vías reguladoras de la biogénesis del ARN para mantener los procesos biológicos celulares. Entre los tipos conocidos de ARN, el ARNm es muy diverso y lleva la capacidad de codificación de las proteínas y sus isoformas 1. La ruta PTGR dirige los destinos de los pre-mRNAs 2 , 3 . RBPs de diferentes familias de genes controlan la regulación de ARN, y en PTGR, mRBPs específicos guían mRNAs a través de interacciones físicas directas, formando mRNPs funcional. Por lo tanto, la identificación y caracterización de mRBPs y sus mRNPs es fundamental para entender la regulación del metabolismo del mRNA celular 2. Durante las últimas tres décadas, varios métodos in vitro - incluyendo los ensayos de desplazamiento de movilidad electroforética de ARN (REMSA), evolución sistemática de ligandos mediante ensayos de enriquecimiento exponencial (SELEX) basado en constructos derivados de la biblioteca, RNA Bind-n-Seq (RBNS), radiomarcado o cuantitativoEnsayos de unión a ARN de fluorescencia, cristalografía de rayos X y espectroscopia de RMN 4 , 5 , 6 , 7 , 8 , 9 - se han aplicado ampliamente a estudios de RBP, principalmente a partir de células de mamífero. Los resultados de estos estudios de mamíferos RBPs se puede buscar a través de la RNA-binding Protein DataBase (RBPDB), que recoge las observaciones publicadas [ 10] .

Aunque estos enfoques in vitro son herramientas de gran alcance, que determinan los motivos de ARN unido de un determinado grupo de RNA de secuencias y por lo tanto, están limitados en su capacidad para descubrir nuevos ARN objetivo. Lo mismo es cierto para las estrategias computacionales para predecir el genoma de todo RBPs, que se basan en la conservación de la secuencia de proteínas y la estructura [ 15] . Para superar esto, un nuevo método experimental haSe ha establecido que permite la identificación de los motivos de ARN que un RBP de interés interactúa con, así como para la determinación de la ubicación precisa de la unión. Este método, denominado "reticulación e inmunoprecipitación" (CLIP), está compuesto de reticulación UV in vivo seguida por inmunoprecipitación 11 . Los primeros estudios han demostrado que la fotoactivación de nucleótidos de ADN y ARN puede ocurrir a una longitud de onda UV de excitación mayor que 245 nm. La reacción a través de la timidina parece ser favorecida (rango en orden de disminución de la fotoreactividad: dT ≥ dC> rU> rC, dA, dG) 12 . Usando luz UV con una longitud de onda de 254 nm (UV-C), se observó que se crean enlaces covalentes entre nucleótidos de ARN y residuos de proteína cuando están en el rango de sólo unos pocos Angstroms (Å). Por lo tanto, el fenómeno se denomina reticulación de "cero longitud" de RNA y RBP. Esto puede ser seguido por un procedimiento de purificación estricto Con poco fondo 13 , 14 .

Una estrategia complementaria al CLIP consiste en combinar la reticulación UV in vivo con la identificación de proteínas para describir el paisaje de las RBP. Se han aislado varios proteomas unidos a mRNA de este genoma de células de levadura, células madre embrionarias (ESCs) y líneas celulares humanas ( es decir, HEK293 y HeLa) usando este nuevo enfoque experimental, denominado "captura de interactomas de mRNA" 18 , 19 , 20 , 21 . El método se compone de reticulación UV in vivo seguida por purificación de mRNP y proteómica basada en MS. Mediante la aplicación de esta estrategia, se han descubierto muchas RBP no lineales que contienen RBDs no canónicos y se ha puesto de manifiesto que más proteínas tienen capacidades de unión a ARN de lo que se suponía anteriormente"> 15, 16, 17. El uso de este método permite nuevas aplicaciones y para la capacidad de responder a las nuevas preguntas biológicos en la investigación de las prácticas comerciales restrictivas. Por ejemplo, un estudio reciente ha investigado la conservación del proteoma ARNm unido (el núcleo RBP Proteoma) entre la levadura y las células humanas [ 22] .

Se ha descubierto que las RBP de las plantas están implicadas en el crecimiento y desarrollo ( por ejemplo , en la regulación post-transcripcional del tiempo de floración, el reloj circadiano y la expresión génica en mitocondrias y cloroplastos) 24 , 25 , 26 , 27 , 28 , 29 . Además, se piensa que desempeñan funciones en los procesos celulares que responden a tensiones abióticas ( por ejemplo, frío, sequía, saLinidad y ácido abscísico (ABA)) 31 , 32 , 33 , 34 . Existen más de 200 genes RBP predichos en el genoma de Arabidopsis thaliana , basados ​​en motivos de secuencia de dominio de reconocimiento de ARN (RRM) y homología K (KH); En el arroz, aproximadamente 250 se han observado 35 , 36 . Es notable que muchos RBPs predicho parecen ser únicos a las plantas ( por ejemplo, ningún orthologs del metazoan a aproximadamente el 50% de RBP predichas de Arabidopsis que contienen un dominio de RRM) 35 , sugiriendo que muchos pueden servir a nuevas funciones. Las funciones de la mayoría de las RBP predicho siguen sin caracterizar [ 23] .

El aislamiento de proteomas unidos a ARNm de plántulas etioladas de Arabidopsis , tejido foliar, células de raíces cultivadas y protoplastos de mesofilo de hoja mediante el uso deMRNA interactome captura se ha informado recientemente 38 , 39 . Estos estudios demuestran el fuerte potencial de catalogar sistemáticamente las RBP funcionales en las plantas en un futuro próximo. Aquí, presentamos un protocolo para mRNA interactome captura de protoplastos de plantas ( es decir, células sin paredes celulares). Los protoplastos de mesofila de la hoja de Arabidopsis thaliana son el tipo principal de células foliares. Los protoplastos aislados permiten el acceso óptimo de la luz UV a las células. Este tipo de células se puede utilizar en ensayos que transitoriamente expresar proteínas para la caracterización funcional [ 40 , 41] . Además, la protoplastía se ha aplicado a varios otros tipos de células vegetales y especies 42 , 43 , 44 ( por ejemplo, Petersson et al ., 2009; Bargmann y Birnbaum, 2010 y Hong et al ., 2012).

<P class = "jove_content"> El método abarca un total de 11 pasos ( Figura 1A ). Los protoplastos de mesofilo de hoja de Arabidopsis se aislan primero (etapa 1) y posteriormente se irradian con UV para formar mRNPs reticulados (etapa 2). Cuando los protoplastos se lisan en condiciones desnaturalizantes (etapa 3), los mRNP reticulados se liberan en tampón de lisis / unión y se extraen por perlas de oligo-d (T) 25 (etapa 4). Después de varias rondas de lavados rigurosos, los mRNP se purifican y se analizan adicionalmente. Los péptidos desnaturalizados de mRBPs son digeridos por proteinasa K antes de purificar los ARNm reticulados y la calidad de ARN se verifica mediante qRT-PCR (etapas 5 y 6). Después del tratamiento con RNasa y la concentración de proteína (etapa 7), la calidad de la proteína se controla mediante electroforesis en gel de poliacrilamida SDS (SDS-PAGE) y tinción con plata (etapa 8). La diferencia en los patrones de bandas de proteína puede visualizarse fácilmente entre una muestra reticulada (CL) y una muestra no reticulada (no CL;La muestra de control negativo de protoplastos que no está sometida a irradiación UV). La identificación de proteínas se logra mediante la proteómica basada en la EM. Las proteínas de la muestra de CL se separan mediante electroforesis unidimensional en gel de poliacrilamida (1D-PAGE) para eliminar la posible contaminación de fondo, se digieren en gel en péptidos cortos usando tripsina y se purifican (etapa 9). La cromatografía líquida de fase inversa nanométrica acoplada a espectrometría de masas (nano-LC-MS) permite la determinación de la cantidad de proteínas definitivas en el proteoma ligado al mRNA (paso 10). Finalmente, las mRBPs identificadas se caracterizan y catalogan usando el análisis bioinformático (paso 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Leaf Mesophyll Protoplast Aislamiento

NOTA: Los protoplastos de mesofilo de hoja de Arabidopsis se aislan esencialmente como se describe en Yoo et al ., 2007, con varias modificaciones 40 .

  1. Crecimiento de plantas
    1. Remoje aproximadamente 200 semillas de ecotipo Arabidopsis thaliana Col-0 en agua esterilizada durante 2 días a 4 ° C en la oscuridad para estratificación.
      NOTA: Este número de semillas es suficiente para una muestra no CL y una muestra CL (ver paso 1.3).
    2. Prepare las ollas con una mezcla al 50% ( v / v ) de tierra y vermiculita y remoje las ollas con agua destilada en una bandeja para mojar el suelo.
    3. Sembrar y distribuir las semillas estratificadas en suelo húmedo. No cubra las semillas con tierra adicional porque las semillas de Arabidopsis necesitan luz para la germinación.
      NOTA: Las condiciones de crecimiento de la planta son un ciclo de 12 h de luz / 12 h de oscuridad a 23 ° C,Con una intensidad de luz de 100 μmol m -2 s -1 , en una sala de crecimiento durante 5 semanas antes de la floración. También se pueden utilizar plantas de 4 semanas de edad 40 .
      NOTA: Todos los materiales y reactivos descritos en el paso 1.2.1 al paso 3.2.3 son para dos muestras ( es decir, una muestra no CL (la muestra de control que no está sometida a irradiación UV-C) y una muestra de CL Muestra sometida a irradiación UV-C)).
  2. Preparación de la solución enzimática isotónica
    1. Hacer 80 ml de solución de enzima isotónica primaria (manitol 400 mM, KCl 20 mM y tampón MES 20 mM (pH 5,7)) e inmediatamente calentar la solución en un incubador a 60ºC durante 10 min.
    2. Añadir 1,2 g de celulasa R10 ( p / v 1,5%) y 0,32 g de polvo de Macerozyme R10 ( p / v 0,4%) a la solución de enzima isotónica primaria caliente.
    3. Con cuidado, traiga el polvo de la enzima en solución aplicando una suave agitación. RapCalentar a temperatura ambiente la solución en un incubador a 60 ° C durante 10 min hasta que la solución enzimática sea de color marrón claro claro.
    4. Se enfría la solución en hielo durante 3 min y añadir 800 l de 1 M CaCl 2 y 800 l de 10% (w / v) de BSA a la solución.
    5. Homogeneizar la solución pipeteando y filtrando a través de un filtro de 0,22 μm. Alícuota de esta solución enzimática isotónica final en dos placas de Petri a gran escala (150 mm x 20 mm).
  3. Preparación de tiras de hojas de roseta de Arabidopsis
    NOTA: Se recomienda 150 hojas para cada placa de Petri para una muestra no CL o una muestra CL.
    1. Elige y cortar un total de 300 totalmente expandido 2 nd - o 3 rd -pair hojas verdaderas (media: 3 - 4 por roseta) en 0,5 a 1 mm de tiras de hoja usando un nuevo y agudo hoja de afeitar.
    2. Transferir y sumergir las tiras inmediatamente en la solución enzimática isotónica.
      NOTA: Para evitar cualquier contacto con la luz,Petri platos con papel de aluminio. No aplaste las hojas. Confirme que todas las tiras están sumergidas en la solución y no están flotando en la superficie.
  4. Aislamiento de protoplastos de mesofilo de hoja de Arabidopsis
    1. Coloque las placas de Petri cubiertas de aluminio en desecadores de vacío y infiltre las tiras de hojas a vacío durante 30 min. Posteriormente, incubar las placas de Petri en la oscuridad sin agitar a temperatura ambiente durante 2,5 h.
    2. Agitar suavemente y brevemente los platos horizontalmente a mano, tratando de liberar los protoplastos completamente en la solución enzimática.
  5. Recolección y recuento de los protoplastos
    1. Filtrar la suspensión de protoplastos a través de una malla de nylon de 35 a 75 μm. Alícuota el filtrado de cada muestra en dos tubos de fondo redondo de 50 ml (aproximadamente 20 ml de filtrado en cada tubo).
    2. Enjuagar cada placa de Petri con 10 ml de tampón W5 (NaCl 154 mM, CaCl 125 mM
    3. Girar los cuatro tubos durante 5 min a 100 xg para sedimentar los protoplastos. Deseche el sobrenadante y resuspenda suavemente los gránulos de protoplastos en cada tubo con 10 ml de tampón W5.
      NOTA: Cuando resuspenda los gránulos de protoplastos, invierta suavemente el tubo boca abajo y gire suavemente el tubo a mano hasta que desaparezcan los gránulos. No pipetee el pellet directamente para evitar dañar las células.
    4. Repita el paso 1.5.3 una vez y combine la suspensión de protoplastos de dos tubos de cada muestra en un tubo de 50 ml de fondo redondo. Mantenga los tubos en hielo.
    5. Cuente los protoplastos usando un hemocitómetro.
      NOTA: Cada 20 células dentro de 25 cubos equivale a 2 x 10 5 protoplastos / mL. 150 hojas deben producir aproximadamente 1 x 107 células.Modular para tener un número total igual de protoplastos en las muestras no CL y CL.
    6. Mantenga los protoplastos en hielo durante 30 min. Después, centrifugue los tubos durante 5 min a 100 x g. Descartar el sobrenadante y volver a suspender los protoplastos en cada tubo con 20 ml de solución MMg (manitol 400 mM, 15 mM MgCl 2, y el tampón 4 MES mM (pH 5,7)).

2. Reticulación in vivo de ARNm-proteína por irradiación UV

NOTA: Mantenga el tubo de muestra sin CL en hielo. La muestra CL debe ser inmediatamente irradiada con UV.

  1. Transferir la suspensión de protoplastos que contiene 1 x 10 7 células del tubo de muestra CL a una nueva placa de Petri a gran escala (150 mm x 20 mm) y agregar 30 ml de solución de MMg enfriada con hielo para cubrir la superficie de la placa. Se extienden las células en todo el buffer de MMg mediante pipeteado suave. Coloque inmediatamente la placa de Petri sin la cubierta superior en un aparato de reticulación UV.
    NOTA: La altura entre la lámpara UVY la placa de Petri es de 8 cm.
  2. Irradiar la muestra con 254 nm de luz de longitud de onda UV y 0,00875 W / cm 2 intensidad UV durante 1 min, 3 min, o 5 min. Después de la irradiación, alícuote rápidamente la suspensión de protoplastos en dos nuevos tubos de fondo redondo de 50 ml. Lavar el fondo del plato con un adicional de 5 ml de solución de MMg helada para recoger el resto de los protoplastos y añadir esta suspensión de células a estos dos tubos.
    NOTA: Se eligió 1 min como condición óptima. La explicación se puede encontrar en los Resultados Representativos .

3. Lisis de protoplastos bajo condiciones de desnaturalización

  1. Preparación de gránulos de protoplastos para la lisis
    1. Hacer girar el tubo de muestra no CL junto con los dos tubos de muestra CL del paso 2 a 100 xg durante 5 min y descartar el sobrenadante. Coloque de nuevo el tubo del gránulo protoplástico de muestra no CL sobre hielo.
    2. Añadir 10 ml de solución de MMg helada a cada tubo de muestra CL, genResuspender los gránulos y combinarlos de nuevo en un tubo redondo de 50 ml. Girar el tubo a 100 xg durante 5 min. Después de retirar el sobrenadante, mantenga la pastilla de protoplast del tubo de muestra CL sobre hielo.
  2. Lisis de protoplastos y homogeneización de lisado de protoplastos
    1. Se añaden 9 ml de lisis enfriada con hielo / tampón de unión (LiCl 500 mM, sulfato de dodecilo de litio al 0,5% ( p / v ) (LiDS), ditiotreitol 5 mM (DTT), Tris-HCl 20 mM (pH 7,5) EDTA (pH 8,0)) al gránulo celular de cada muestra. Lise lentamente los protoplastos pipeteando hacia arriba y hacia abajo aproximadamente 20 veces hasta que la suspensión es homogéneamente verde claro.
    2. Pasar el lisado de protoplastos dos veces a través de una jeringa de vidrio de 50 ml con una aguja estrecha (0.9 x 25 mm 2 ) para homogeneización. Incubar el lisado en hielo durante 10 min. Congelar los lisados ​​en nitrógeno líquido y almacenar a -80 ° C durante un máximo de 3 semanas.

4. Extracción y purificación de mRNPPor Oligo-d (T) 25 Cuentas

NOTA: Todos los materiales y reactivos descritos a continuación, desde el paso 4.1 al paso 4.4, son sólo para una muestra ( es decir, una muestra no CL o una muestra CL). El lisado de protoplastos debe añadirse inmediatamente a los tubos que contienen perlas después de que se descarta la lisis del sobrenadante de la perla / tampón de unión.

  1. Preparación de bolas magnéticas oligo-d (T) 25 para la captura de oligo (dT)
    1. Descongelar el lisado de protoplastos congelados a temperatura ambiente. Cuando el lisado está completamente descongelado, mantenga el tubo de lisado sobre hielo.
    2. Alícuota de 1,8 ml de perlas magnéticas de oligo-d (T) 25 (5 mg / ml) en 6 nuevos tubos de microcentrífuga de fondo redondo de 2 ml sobre hielo. En cada tubo, lavar la suspensión de perlas de forma homogénea con 600 μl de lisis / tampón de unión pipeteando brevemente arriba y abajo y girando suavemente a 4 ° C durante 2 min. Mantenga las cuentas en el hielo.
  2. Unión
    1. LugarTodos los 6 tubos que contienen las perlas en un estante magnético a 4 ° C durante 3 min, lo que dará lugar a la captura magnética de las perlas y el despeje de la suspensión.
      NOTA: Cuando los tubos se colocan en el estante magnético, espere hasta que las bolas estén completamente capturadas, al menos 3 min.
    2. Deseche el sobrenadante e inmediatamente alícuote 9 mL de lisado de protoplastos en estos 6 tubos. Mezclar bien pipeteando hasta que aparezca una suspensión parda homogénea e incube las perlas en el lisado de protoplastos a 4 ° C durante 1 h aplicando una rotación suave.
      NOTA: Se recomienda un tiempo de incubación de 30 min a 1 h.
  3. Lavado
    1. Coloque los tubos nuevamente en el estante magnético a 4 ° C durante 3 min. Cuando todas las perlas se capturan en el lado de los tubos, recoja el lisado de protoplastos en 6 nuevos tubos de microcentrífuga de fondo redondo de 2 ml y almacénelos temporalmente a 4 ° C. NO deseche el lisado de protoplastos inmediatamente; Mantener el lisadoA 4 ° C.
    2. Se añaden 1,5 ml de tampón de lavado 1 helado (LiCl 500 mM, LiDS 0,1% ( p / v ), DTT 5 mM, Tris-HCl 20 mM (pH 7,5) y EDTA 1 mM (pH 8,0)) a las perlas En cada tubo. Resuspender las perlas y aplicar una rotación suave durante 1 min. Coloque los tubos nuevamente en el estante magnético a 4 ° C durante 3 min y deseche el sobrenadante. Repita este paso de lavado con tampón de lavado una vez.
    3. Repetir el mismo procedimiento de este paso de lavado dos veces usando 1,5 ml de tampón de lavado 2 helado (LiCl 500 mM, DTT 5 mM, Tris-HCl 20 mM (pH 7,5) y EDTA 1 mM (pH 8,0)) y una vez usando 1,5 ml de tampón salino bajo en hielo (LiCl 200 mM, Tris-HCl 20 mM (pH 7,5) y EDTA 1 mM (pH 8,0)).
      NOTA: Si los mRNPs han sido aislados eficientemente del lisado de protoplastos, debería haber un "halo" visible alrededor del gránulo de talón en la muestra de CL durante el paso de lavado con el tampón de lavado 2 ( Figura 1B ).
  4. Elución
    1. Añadir 500 μlDe tampón de elución (Tris-HCl 20 mM (pH 7,5) y EDTA 1 mM (pH 8,0)) a las perlas en cada tubo. Resuspender suavemente las perlas e incubar a 50 ° C durante 3 min para liberar el poli (A)-ARNs colgados. Suavemente resuspender las perlas una vez por pipeteado. Coloque los tubos de nuevo en el estante magnético a 4 ° C durante 5 min.
    2. Transferir y combinar todos los eluyentes (aproximadamente 3 ml en total) a un tubo de fondo cónico limpio y estéril, libre de RNasa, de 15 ml sobre hielo.
      NOTA: La calidad y la cantidad de ARN se pueden determinar inmediatamente utilizando un dispositivo espectrofotómetro.
      NOTA: La concentración de ARN de cada muestra es de aproximadamente 10 ng / μl, con una relación A 260 / A 280 de 1,9. La proporción de A 260 / A 280 debe estar entre 1,6 y 2,0 porque los ARN aislados de poli (A) - cola son usualmente superiores al 70% de pureza. Si la concentración de ARN es demasiado baja, aumente el número de protoplastos de partida hasta un máximo de 10 9 . MuestrasPueden congelarse en nitrógeno líquido y mantenerse a 80 ° C para el almacenamiento a largo plazo.
    3. Repita el paso 4.2 al paso 4.4 durante dos rondas adicionales y reutilizar las perlas de oligo-d (T) 25 para agotar los ARNs de poli (A) -tail del lisado de protoplastos.
      NOTA: Después de tres rondas de procedimiento pull-down, debe haber un total de 9 ml de eluyente para cada muestra no CL o CL. Realizar todo el trabajo a 4 ° C para evitar la degradación del ARN. Siga el paso 4.5 o el paso 4.6 para volver a usar o regenerar las cuentas.
  5. Preparación de perlas oligo-d (T) 25 reutilizadas
    1. Lavar las perlas dos veces con 1 ml de tampón de elución enfriado con hielo y una vez con 1 ml de lisis enfriada con hielo / tampón de unión para ajustar la concentración de LiCl sal a 500 mM.
    2. Siga el paso 4.1, deseche el sobrenadante, transfiera el lisado de protoplastos almacenado en cada tubo y repita todo el procedimiento desde el paso 4.2 al paso 4.4 durante dos rondas adicionales.
  6. 25 cuentas
    NOTA: Las perlas se pueden almacenar y utilizar para otro experimento (la reutilización máxima es de tres veces).
    1. Siga el paso 4.4, agregue 1 mL de NaOH 0,1 M a las perlas e incube girando a temperatura ambiente durante 5 min. Para cada tubo, lavar dos veces con 1 mL de tampón de lavado 1 y tres veces con 1x PBS (pH 7,4) que contiene 0,1% de Tween-20 para equilibrar. Mantenga las perlas de cada tubo en 300 μl de 1x PBS estéril libre de RNasa (pH 7,4) que contenga Tween-20 al 0,1% a 4 ° C para almacenamiento a largo plazo.
      NOTA: Los granos utilizados para las muestras de Arabidopsis CL en este experimento solo pueden usarse para las mismas muestras de plantas la próxima vez.

5. Tratamiento con proteinasa K y purificación de mRNA

  1. Tratamiento con proteinasa K
    1. Añadir 8 μl de solución de proteinasa K (2 μg / μl) a 1 ml del eluyente de cada muestra para digerir las proteínas reticuladas con UV. BrVórtice salvaje
  2. Purificación de mRNA
    1. Incubar el eluyente a 37 ° C durante 1 h. Purificar el ARN utilizando el kit de purificación de ARN para eliminar los contaminantes residuales.
      NOTA: Después de la purificación, los ARN están listos para la prueba de calidad de ARN usando el ensayo de qRT-PCR.
      NOTA: También se pueden utilizar otros kits, como el mini kit de ARN y el reactivo TRIzol 14 .

6. Ensayo qRT-PCR

  1. Transcripción inversa
    1. Lograr una síntesis eficiente de ADNc de primera cadena utilizando el sistema de transcripción inversa, con 1 μg de ARN como plantilla. Diluir la muestra a 5 ng / μl con agua libre de nucleasa.
  2. Cuantificación de cDNA utilizando qRT-PCR
    1. Amplificar y cuantificar el cDNA utilizando la mezcla maestra qPCR y el ciclador de PCR en tiempo real, con 10 ng de cDNA como plantilla. Utilice el siguiente programa de PCR: 95 ° C durante 10 min(Etapa 1, un ciclo) y 95ºC durante 15 sy 60ºC durante 1 min (etapa 2, 40 ciclos).
      NOTA: El gen de referencia utilizado aquí era un gen de control interno endógeno, UBQ10 (AT4G05320). Los cebadores qRT-PCR para ARNr de UBQ10 y 18S se describieron en Li et al ., 2014 y Durut et al ., 2014, respectivamente 45 , 46 . Las secuencias de cebadores se enumeran en la Tabla de materiales .

7. Tratamiento de RNasa y Concentración de mRBP

  1. Tratamiento de RNasa
    1. Añadir aproximadamente 100 U de cóctel de RNasa que contiene RNasa A y RNasa T1 en 8 ml de eluyente. Incluir una muestra de control negativo con cóctel de RNasa en el que el eluyente se reemplaza por agua libre de nucleasa. Vórtice brevemente e incube a 37 ° C durante 1 h.
  2. Concentración de mRBP
    1. Después de la digestión con RNasa, concentrar el eluyente usinG unidades de filtro centrífugo. El volumen final es 75 μl, con un rendimiento total de proteína de aproximadamente 2 μg de cada muestra después de la concentración. Coloque las muestras a -80 ° C para el almacenamiento a largo plazo.

8. SDS-PAGE y tinción de plata

  1. SDS-PAGE
    1. Mezclar 25 μL del eluyente concentrado (muestra CL) o la muestra testigo (muestra no CL) con 15 μl de 2x colorante de carga. Calentar la muestra a 95 ° C durante 5 min y cargarlo en un gel de SDS-PAGE que contiene 5% de gel de apilamiento y 12% de gel de resolución, incluyendo un marcador de proteína.
    2. Condense las proteínas a 60 V durante 40 min y separe a 160 V durante aproximadamente 1 h hasta que el colorante de carga llegue al extremo del gel de resolución.
  2. Ensayo de tinción de plata
    1. Lavar el gel de SDS-PAGE dos veces con agua ultrapura durante 5 min cada vez. Realizar la tinción de plata de las proteínas con un kit comercial de tinte de plata.
      NOTA: Las bandas de proteína deben mostrarse en 5 minutos. Si las bandas son visibles más allá de 5 min con color muy claro, se sugiere aumentar el número de protoplastos de partida hasta el máximo de 10 9 .

9. Digest de tripsina de las bandas de proteínas y purificación de péptidos

  1. Tripsina digerida
    NOTA: Ejecutar un segundo gel de 1D-PAGE tomando otra solución de mRBP concentrada de 25 μl de cada muestra para identificación de mRBP; No se pueden usar geles te~nidos con plata porque no son compatibles con el análisis de EM.
    1. Después de ejecutar el gel de 1D-PAGE, fijar el gel en solución de fijación (metanol al 50% ( v / v ) y ácido acético al 10% ( v / v )) durante 1 h. Se tiñe el gel en solución de tinción (0,1% ( p / v ) de Coomassie Brilliant Blue R-250, 50% ( v / v ) de metanol y 10% ( v / v ) de ácido acético) durante 20 minutos con agitación suave. Destainer el gel en solución destain (40% ( v / v ) de metanol y 10% ( v/ V) de ácido acético) durante 1 h. Después de desecar, mantener el gel en ácido acético al 5% ( v / v ).
      NOTA: Durante la decoloración, la nueva solución destain puede ser reemplazada hasta que el fondo esté completamente descompuesto.
    2. Cortar las bandas de interés fuera del gel. Cortar las bandas más en trozos de aproximadamente 1 mm 3 para la posterior digestión de tripsina óptima y la extracción de péptidos. Hidratar las piezas de gel con 50 μl de bicarbonato de amonio 100 mM (NH 4 HCO 3 ) durante 10 min. Cubrir las piezas de gel completamente.
      1. Eliminar la solución hidratante cuidadosamente y deshidratar las piezas de gel con acetonitrilo (CH3CN) durante 10 min. Retire cuidadosamente la solución de acetonitrilo.
      2. Repita el proceso de hidratación a la deshidratación dos veces. Por último, eliminar la solución de acetonitrilo.
        NOTA: El tiempo de ejecución del gel depende del propósito del experimento. Una larga duración de los tiempos permite una buena separación de las proteínas, por lo que la tinción de gel específicoDs se pueden cortar para el análisis adicional. Si el propósito es mantener las proteínas y eliminar los contaminantes, un tiempo de ejecución corto es suficiente.
    3. Añadir 500 μl de solución de DTT 6,6 mM e incubar las piezas de gel durante 10 min. Se retira la solución de DTT y se lavan las piezas de gel dos veces con 500 μl de solución de acetonitrilo al 95% ( v / v ).
      1. Después del lavado, se retira la solución de acetonitrilo y se incuban las piezas de gel con 500 μl de solución de ácido yodoacético 55 mM (IAA) durante 10 minutos en la oscuridad.
      2. Después de la incubación, se retira la solución y se lavan de nuevo las piezas de gel con 500 μl de solución de acetonitrilo al 95% ( v / v ). Seque las piezas de gel.
    4. Insertar las piezas de gel completamente con 25 l de tampón de digestión (mM NH 4 HCO 3 50, 5 mM CaCl 2, y 6 ng / l de tripsina) y mantener en hielo durante 45 min para dejar que el tripsina permeado en el gel. Incubar las piezas de gel durante la noche a 37 ° C para en Digestión zymatic.
  2. Purificación de péptidos
    1. Añadir 80 l de 50 mM NH 4 HCO 3 a las piezas de gel en el tampón de digestión y vórtice varias veces para extraer los péptidos trípticos. Recoger el extracto. Repetir este paso de extracción dos veces con 80 μl de CH $$ CN al 50% ( v / v ) y ácido fórmico (FA) al 5% ( v / v ).
      NOTA: El extracto final total debe ser de aproximadamente 240 μl.
    2. Piscina y concentrar los extractos en aproximadamente 10 μ l por concentración de vacío o liofilización y añadir 25 μ l de 0,1% ( v / v ) solución acuosa de ácido trifluoroacético (TFA). Desalar las muestras con columnas μ-C18, siguiendo el protocolo del fabricante.
    3. Elución de los péptidos con 4 - 10 μ l de 60% ( p / v ) CH 3 CN y 0,1% ( v / v ) FA. Liofilizar (liofilizar) los péptidos y almacenarlos a -20 ° C hasta su análisis.
Título "> 10. Nano-LC-MS

  1. Cromatografía líquida de fase inversa nanométrica
    NOTA: Realice el análisis de LC-MS con un espectrómetro de masas acoplado en línea con un instrumento de cromatografía líquida. Este instrumento debe estar equipado con una columna C18 (partículas de 2 μm, tamaño de poro de 100 Å y dimensión de 50 μm x 15 cm).
    1. Resuspender los péptidos liofilizados en 16 μL de solución (2% ( v / v ) de CH $$ CN y 0,1% ( v / v ) de FA). Inyectar y cargar 5 μL de solución de péptido a una velocidad de flujo de 5 μL / min en una precolumna C18 (tamaño de partícula de 3 μm, tamaño de poro de 100 Å, nanoviper y dimensión de 75 μm x 2 cm).
    2. 10.1.2. Se separan los péptidos usando un gradiente de 95 minutos con un caudal de 300 nL / min. Durante este gradiente de separación, aumentar la fase móvil B de 4% a 10%, 10% a 25% y 25% a 45% en 5 min, 50 min y 18 min, respectivamente. Finalmente, aumentar abruptamente la fase móvil B hasta el 95% en 1 min. DespuésCada gradiente de separación de 95 minutos, aplicar una etapa de aclarado inherente que contiene un gradiente de 10 min de 4% a 95% en 5 min.
      NOTA: La fase móvil A es 99,9% de H2O y 0,1% (v / v) FA, y la fase móvil B es 19,92% H 2 O, 80% (w / v) CH 3 CN, y 0,08% (v / v ) FA.
  2. Ensayo de espectrometría de masas
    1. Operar el espectrómetro de masas en modo dependiente de datos con un rango de masa de 400 a 1.600 m / z.
    2. Seleccione hasta diez de los iones más intensos en MS1 ​​para generar los espectros de fragmentación. Establezca la resolución a 70.000 de ancho completo a la mitad de la máxima (FWHM) para MS1 y 17.000 para MS2, con un objetivo de control de ganancia automático (AGC) de 3.000.000 y 1.000.000 de iones y un tiempo máximo de inyección de iones (IT) de 256 y 64 ms para MS1 Y MS _ {2}, respectivamente.
    3. Establezca la exclusión dinámica a 10 s para evitar la fragmentación repetida de los iones más abundantes.
      NOTA: Aquí, los iones con uno o más de seis cargas son eXcluido para MS2.
  3. Proteómica cualitativa: identificación de péptidos y proteínas
    1. Analizar espectros de fragmentación utilizando software como Peaks studio software 47 , 48 , 49 .
      NOTA: Otros paquetes de software también están disponibles para la identificación de péptidos, tales como NovoHMM 30 y PepNovo 37 para la secuenciación de novo y SEQUEST 54 y Mascot 55 para la búsqueda de bases de datos.
    2. Combine los espectros con la misma masa (<2 ppm de diferencia) y los tiempos de retención (<2 min) y retenga únicamente espectros con un umbral de calidad superior a 0,65 para buscar en la base de datos Swiss-Prot (versión: diciembre de 2013) la taxonomía establecida para el modelo Planta Arabidopsis thaliana . Utilice los siguientes parámetros de búsqueda: una tolerancia de masa de precursores de 10 ppm a través del uso del monMasa oisotópica; Un fragmento de tolerancia de masa de 20 mmu; Tripsina como enzima de digestión, con un máximo de 2 escisiones perdidas; Carbamidometilación de cisteína como modificación fija; Metionina como la modificación variable; Y un máximo de 3 modificaciones post-traduccionales variables por péptido. Después de la identificación, establezca manualmente los umbrales de puntuación para la identificación fiable de péptidos y proteínas de modo que se obtenga una tasa de descubrimiento falso (FDR) <5%.
  4. Proteómica cuantitativa: análisis estadístico de datos de espectrometría de masas
    1. Utilizar LC-MS ( por ejemplo, Progenesis) para la cuantificación libre de etiquetas de los datos proteómicos.
      NOTA: Las áreas (o intensidad) de los pıptidos de péptido MS1 están unidas a los péptidos identificados por el software de estudio de acuerdo con su masa, con el error tolerado en un máximo de 10 ppm.
      NOTA: Este software calcula la abundancia de un péptido integrando las áreas de los picos de todos los estados de carga entre 2 <Sup> + y 8 + . Los datos cuantitativos están relacionados con la identificación del péptido PEAKS mediante un guión interno (emparejamiento de masas con el error tolerado en un máximo de 10 ppm).
    2. Calcular el promedio log2 veces cambios (CL / no-CL) para cada péptido. Agrupar los cambios de pliegue de los péptidos únicos por la proteína.
      NOTA: En cada grupo, el cambio de pliegue final de una proteína es igual al promedio de los cambios de pliegue de sus péptidos.
    3. Calcule el valor p usando el test t de Student para cada grupo para evaluar la significación estadística. Aplicar el paquete de software R (versión 3.3.0) para corregir los valores p para el FDR de todos los grupos utilizando el método Benjamini-Hochberg (BH).
    4. Dibuje el diagrama volcánico utilizando el paquete de funciones "calibrar" (versión 1.7.2) compatible con el paquete de software R (versión 3.3.0).
      NOTA: Aquí, los valores de p ajustados -log10 (-log10 (valor adj. P)) son una función de los cambios log2 veces de todas las proteínas identificadas. Las proteínas sonTratados como accesos positivos en el proteoma unido a mRNA si sus cambios de log2 veces son mayores que 2, con o sin significación.

11. Catálogo del proteoma identificado con mRNA

  1. Clasifique las proteínas identificadas del paso 10 en tres categorías basadas en los ítems de "funciones moleculares y proceso biológico" a través de la base de datos Gene Ontology (GO) y "familia y dominio" a través de la base de datos de InterPro.
  2. Como categoría I, o "proteínas ribosómicas", contienen todas las proteínas ribosomales detectadas, definen las proteínas de la categoría II, o "Principales RBPs", que contienen dominios de proteínas anotadas que interactúan con ARN o vinculan a ARN vinculante con funciones conocidas o desconocidas en la biología del ARN .
  3. Como las proteínas con funciones conocidas o desconocidas en la biología del ARN sin dominios anotados de unión a ARN se colocan en la categoría III, o "Candidate RBPs", definen las enzimas de la categoría III sobre la base de anotaciones de la INtEnz base de datos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Se observó un halo característico, que rodea el gránulo de gránulo en la muestra de CL, en el paso de lavado 4.3 con tampón de lavado 2 ( Figura 1B ). Aunque no se ha investigado, este fenómeno puede explicarse probablemente por la interferencia de los complejos mRNP reticulados con la agregación de gránulos durante la captura magnética, causando la formación de un agregado más difuso. Indica que la captura de perlas de oligo-d (T) 25 fue efectiva 14 .

Los niveles de ARNm de referencia de UBQ10 significativamente más altos que el ARNr de 18S tanto en muestras de control no CL como en muestras de CL se muestran en la Figura 1C . Esto indica que los ARNm están enriquecidos en el eluyente debido a la captura por bolas de oligo-d (T) 25 , que sólo pueden unirse a mRNAs de poli (A). La eficiencia de la captura de perlas de oligo-d (T) 25 fue(Etapa 8), como se muestra en la Figura 1D después del tratamiento con RNasa y la concentración de mRBP (etapa 7). Puede observarse claramente una diferencia en el patrón de bandas de proteína entre el control no CL y los carriles de muestra de CL y las bandas de proteína presentes en el carril de muestra de control no CL pueden explicarse por la presencia de RNasa. Esto ilustra el fuerte enriquecimiento de mRBPs en la muestra CL.

La eficacia de la reticulación puede controlarse variando la duración de la irradiación UV. Reticulación suficiente, pero la prevención de daños protoplastos y la degradación del ARN es óptima. En la Figura 1D , patrones de banda de proteína específica en todas las muestras de CL se obtuvieron al comparar diferentes tiempos de irradiación UV (1, 3 y 5 min). Bajo la misma intensidad UV (0,00875 W / cm 2), se encontraron las condiciones más óptimas para ser 1 o 3 min, debido a la indistinguiblesIntensidades de banda proteica. Se observaron intensidades de banda más débiles con el tiempo de reticulación más largo (5 min). Consideramos 1 min como la condición óptima porque una duración más corta de reticulación tiene la ventaja adicional de una transferencia y recogida más fácil de protoplastos de la placa de Petri. Los protoplastos pueden precipitarse rápidamente al fondo de la placa de Petri durante la irradiación UV porque se pegan al fondo del plato. Esto hace que sea más difícil de recoger y transferir a los tubos después de una mayor duración de la irradiación UV.

A partir de las condiciones optimizadas, la identificación de proteínas a partir de tres repeticiones biológicas se logró posteriormente mediante proteómica cualitativa y cuantitativa, que se describió en los pasos 9 y 10. En el análisis por proteómica cualitativa ( Figura 1E , derecha), un total de 341 proteínas Fueron identificados en CL muestras, de los cuales 36 se encontraron tanto en no-CL control unD CL muestras, y sólo 8 proteínas se detectaron en la no-CL control de la muestra. Esta enorme diferencia en el número de proteínas identificadas entre ambas muestras es coherente con los diferentes patrones de bandas de proteínas ( Figura 1D ), lo que apoya la idea de que el SDS-PAGE y el ensayo de tinción de plata son buenas herramientas para validar la eficiencia de oligo-d (T) 25 captura de cuentas. En el análisis de la proteómica cuantitativa ( Figura 1E , a la izquierda), un total de 325 proteínas (azul y verde) mostraron un cambio log2 veces mayor que 2. Entre estas proteínas, 100 proteínas (de color azul) -valores por encima del nivel de significación. Por lo tanto, también se definieron como éxitos positivos. Es notable que los p-valores de otras 225 proteínas (de color verde) fueron superiores a 0,05, por debajo del nivel de significación debido a la escasez de datos. En otras palabras, hubo abundantes péptidos abun- dantes presentes para cada proteína, con alta variabilidad de péptido intensi-Es Sin embargo, debido a que todos ellos fueron detectados cualitativamente sólo en muestras CL, se consideraron positivos.

Basándose en las bases de datos GO e InterPro 50 (etapa 11), estas 325 proteínas se clasificaron en categoría I (proteínas ribosómicas), categoría II (RBP principales) y categoría III (RBP candidatas) ( Figura 1F ). Hubo 123 proteínas ribosómicas en la categoría I, mientras que en la categoría II se observaron 70 RBP clásicas anotadas. Estas dos categorías -que contienen la mayoría de las proteínas anotadas que se enlazan a la unión del ARN molecular y la biología del ARN ( Figura 1F , derecha) y que ocupan aproximadamente el 38% y el 22% del proteoma total ligado al ARNm, respectivamente- indican la alta eficiencia del ARNm optimizado interactome capturar. El último 40% (132 RBP candidatos) se clasificaron en la categoría III debido a la falta de RBD convencionales. Además, la mayorSus papeles en ARN vinculante y ARN procesos biológicos no han sido validados ( Figura 1F , a la izquierda). Suponemos que las proteínas de esta categoría podría revelar funciones novedosas en las regulaciones de ARN.

Figura 1
Figura 1: Diagrama de flujo y resultados del método optimizado para descubrir el proteoma ligado a ARNm de los protoplastos de mesofilo de hoja de Arabidopsis . ( A ) Las etapas principales de todo el método se enumeran del 1 al 11. Los procesos moleculares y moleculares putativos son ilustrados por la foto y los dibujos animados. Los detalles de cada paso han sido intensamente descritos en el Protocolo. ( B ) Se observó un halo rodeando el gránulo de bolitas en la muestra de CL, pero no en la muestra de control no CL, durante la etapa de lavado 4.3. ( C ) Comparación del ARNm de UBQ10 relativo y del ARNr de 18SLs en muestras de control no CL y CL por qRT-PCR (los valores son media ± DE (n = 3); * y **: diferencias significativas con p <0,05 y <0,01). (D) Concentrado eluyente proteína de la no-CL muestra de control en comparación con muestras de CL irradiados por una fuente de UV de onda continua de 1, 3, y 5 min, con la intensidad UV a 0,00875 W / cm 2. ( E ) Identificación del proteoma unido a mRNA por proteómica. En la proteómica cuantitativa realizada por el paquete de software Progenesis (a la izquierda), la gráfica del volcán muestra los cambios log2 veces promedio (CL / no-CL) y los valores p ajustados relacionados (-log10 (valores adjuntos p)) Todas las proteínas. En la proteómica cualitativa realizada por el paquete de software Peaks (derecha), las proteínas en las muestras se ilustran en diagramas de Venn. La cantidad de las proteínas se muestra en números. El FDR en el péptido y los niveles de proteína es inferior al 5%. El número de proteínas dentro de los marcos de color marrón claro se consideran éxitos positivos. ( et al ., 2016. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aplicamos con éxito la captura de interactomas de mRNA, desarrollada para levaduras y células humanas, para plantar protoplastos de mesofilo en hojas. Las células del mesófilo de la hoja son el tipo principal de tejido de tierra en hojas de la planta. La principal ventaja de este método es que utiliza reticulación in vivo para descubrir las proteínas de un entorno fisiológico.

En este protocolo, presentamos principalmente una serie de condiciones experimentales optimizadas ( por ejemplo, el número de protoplastos a utilizar como material de partida y la duración de la irradiación UV) 50 . Las proteínas capturadas en las muestras de CL sólo pueden detectarse mediante SDS-PAGE y tinción con plata cuando se usa un mínimo de 10 7 protoplastos (escala media) (paso 1.5.5). Concentraciones más bajas no producen un patrón de mRBP observable en SDS-PAGE y probablemente no deberían usarse para un análisis posterior por proteómica. De hecho, el uso de más de 10 7 células ( por ejemplo, 10 9 enUn experimento a gran escala) también es posible [ 20] . Los resultados de los ensayos de tinción con plata sugieren que la irradiación UV durante 1 min con 0,00875 W / cm 2 de la intensidad generada por una fuente de onda continua UV es óptima (Figura 1D). Los resultados de los ensayos de RT-qPCR, tinción de plata, y MS soportan una alta eficiencia en el paso crítico ( es decir, reducción de mRNP y purificación por perlas oligo-d (T) 25 ) ( Figura 1C ; 1D , y 1E , derecha). La combinación de la proteómica cualitativa y cuantitativa puede ayudar a identificar los RBP positivos en la región de superposición entre el control no CL y CL muestras ( Figura 1E ). La mayoría de las proteínas identificadas fueron RBPs no anotado previamente en conjuntos de datos ( Figura 1F ]. Presentamos estas anteriormente desconocido RNA-proteínas de unión en la categoría III como candidato RBP <Sup class = "xref"> 50 ( Figura 1F ). La exploración de las especificidades de unión de estos candidatos RBPs debe hacerse utilizando otros métodos, tales como los métodos CLIP anteriormente mencionados [ 23] . Un ejemplo que investiga la especificidad de unión de una RBP para regular su transcripción de mRNA objetivo en Arabidopsis mediante el uso de CLIP 51 puede encontrarse en Zhang et al ., 2015. Además, un método alternativo modificado de PAR-CLIP, denominado photoactivatable- Ribonucleósido-reticulación mejorada (PAR-CL, 365-nm UV-A) también ha sido previamente recomendado para la investigación de mRNA-ligado a proteomas de la levadura y las células humanas [ 14 , 23] . El PAR-CL requiere 4Su, que es absorbido por células e incorporado en los ARN nacientes durante el metabolismo del ARN y puede ser altamente reactivo, formando enlaces covalentes con los aminoácidos 52 bajo irradiación UV-A (365 nm)Ción. Actualmente, no hay estudios centrados en la toxicidad de 4sU a las células vegetales y la absorción eficiente de exógenos 4sU en protoplastos mesófilo [ 53] . Sin embargo, creemos que será posible utilizar CL convencionales (254 nm UV-C) y PAR-CL (365 nm UV-A) en las plantas, lo que contribuirá al descubrimiento y validación de diversos RBPs desde el fisiológico Medio ambiente en el futuro.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

Reconocemos el laboratorio del Prof. Joris Winderickx, que proporcionó el aparato de reticulación UV equipado con la lámpara UV convencional. KG cuenta con el apoyo del fondo de investigación KU Leuven y reconoce el apoyo de la subvención FWO G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics