Cattura di Interactome mRNA da protoplasti vegetali

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui presentiamo un protocollo di cattura di interazione applicato ai protoplasti a foglia di Arabidopsis thaliana . Questo metodo si basa fondamentalmente sulla creazione di reticolazione UV in vivo e consente l'isolamento e l'identificazione delle proteine ​​legate alla mRNA da un ambiente fisiologico.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le proteine ​​legate all'RNA (RBPs) determinano le sorti degli RNA. Essi partecipano a tutte le vie di biogenesi dell'RNA e contribuiscono in particolare alla regolazione del gene post-trascrizionale (PTGR) di messaggeri RNA (mRNA). Negli ultimi anni, un certo numero di proteomi legati al mRNA da linee di cellule di lieviti e mammiferi sono stati isolati con l'utilizzo di un nuovo metodo chiamato "capture di intercommunicazione mRNA", che consente l'identificazione di proteine ​​legate alla mRNA (mRBPs) Direttamente da un ambiente fisiologico. Il metodo è composto da in-vivo ultravioletto (UV) reticolazione, abbattimento e purificazione di complessi ribonucleoproteine ​​messicani (mRNPs) da brani oligo (dT) e successiva identificazione delle proteine ​​reticolate mediante spettrometria di massa (MS). Molto recentemente, applicando lo stesso metodo, sono stati riportati simultaneamente diversi proteomi legati al mRNA vegetale provenienti da diverse origini tessutali di Arabidopsis : piantine etiolate, tessuti fogliari,Protoplasse della mesofila della foglia e cellule radicate coltivate. Qui presentiamo il metodo ottimizzato per la cattura di interoomi di mRNA per i protoplasti di mezophyll a foglia Arabidopsis thaliana , un tipo di cellule che serve come uno strumento versatile per esperimenti che comprendono diversi dosaggi cellulari. Le condizioni per la resa proteica ottimale includono la quantità di tessuto di partenza e la durata dell'irradiazione UV. Nel proteome legato al mRNA ottenuto da un esperimento di media scala (10 7 cellule), i RBP notati per avere capacità di legame di RNA sono stati sovrapresentati e sono stati identificati molti nuovi RBP. L'esperimento può essere scalato (10 9 cellule) e il metodo ottimizzato può essere applicato ad altri tipi di cellule vegetali e specie per isolare, catalogare e confrontare generalmente proteomi legati alle mRNA nelle piante.

Introduction

Gli eukarioti utilizzano percorsi di regolazione della biogenesi multipla di RNA per mantenere i processi biologici cellulari. Tra i tipi noti di RNA, l'mRNA è molto diversificato e porta la capacità di codifica delle proteine ​​e delle loro isoforme. 1. Il percorso PTGR indirizza le sorti dei pre-mRNA 2 , 3 . I RBP di diverse famiglie geniche controllano la regolazione dell'RNA, e in PTGR, mRBP specifici guidano mRNA attraverso interazioni fisiche dirette, formando mRNP funzionali. Di conseguenza, l'identificazione e la caratterizzazione dei mRBPs e dei loro mRNPs è fondamentale per la comprensione della regolazione del metabolismo cellulare mRNA 2. Negli ultimi tre decenni, i vari metodi in vitro , inclusi i REMSA (REMSA), l'evoluzione sistematica dei ligandi mediante esami di arricchimento esponenziale (SELEX) basato su costruzioni derivate dalla biblioteca, RNA Bind-n-Seq (RBNS), radiomarcato o quantitativoI campioni di RNA di fluorescenza, la cristallografia a raggi X e la spettroscopia NMR 4 , 5 , 6 , 7 , 8 , 9 sono stati ampiamente applicati agli studi di RBP, principalmente da cellule di mammiferi. I risultati di questi studi su RBP mammiferi possono essere ricercati tramite la RNA-binding Protein DataBase (RBPDB), che raccoglie le osservazioni pubblicate 10 .

Anche se questi approcci in vitro sono strumenti potenti, determinano i motivi di RNA vincolati da un dato pool di sequenze di RNA e quindi sono limitate nella loro capacità di scoprire nuovi target RNA. Lo stesso vale per le strategie di calcolo per prevedere RBP a livello genomico, che si basano sulla conservazione della sequenza e della struttura proteica 15 . Per superare questo, un nuovo metodo sperimentale haÈ stato stabilito che consente l'identificazione dei motivi RNA che interviene un RBP di interesse, nonché per la determinazione della posizione precisa di legame. Questo metodo, chiamato "crosslinking e immunoprecipitazione" (CLIP), è composto da in-vivo reticolazione UV seguito da immunoprecipitazione 11 . Studi iniziali hanno dimostrato che la fotoattivazione di nucleotidi di DNA e RNA può verificarsi a lunghezze d'onda UV di eccitazione maggiore di 245 nm. La reazione attraverso la timidina sembra essere favorita (rango in ordine di diminuzione della fotoreattività: dT ≥ dC> rU> rC, dA, dG) 12 . Utilizzando la luce UV con una lunghezza d'onda di 254 nm (UV-C), è stato osservato che i legami covalenti tra nucleotidi RNA e residui di proteine ​​sono creati quando nell'ambito di pochi Angstroms (Å). Il fenomeno è dunque chiamato "crosslinking" a zero lunghezza di RNA e RBP. Questo può essere seguito da una procedura di purificazione rigorosa Dura con poco sfondo 13 , 14 .

Una strategia complementare al CLIP è quella di combinare in vivo la reticolazione UV con l'identificazione delle proteine ​​per descrivere il paesaggio dei RBP. Un certo numero di tali proteomi legati al mRNA a livello genomico sono stati isolati da cellule staminali embrionali (ESCs) e linee cellulari umane ( cioè HEK293 e HeLa) utilizzando questo nuovo approccio sperimentale, chiamato "capture intercommunicazione mRNA" 18 , 19 , 20 , 21 . Il metodo è composto da in-vivo reticolazione UV seguita da purificazione mRNP e proteomica basata su MS. Applicando questa strategia, sono stati scoperti molti nuovi RBP "moonlighting" contenenti RBD non canonici, e è risultato chiaro che più proteine ​​hanno capacità di legame RNA rispetto a quanto precedentemente supposto"> 15 , 16 , 17. L'uso di questo metodo consente di nuove applicazioni e di capacità di rispondere a nuove domande biologiche durante l'analisi di RBP. Ad esempio, uno studio recente ha indagato sulla conservazione del proteome legato all'RNA (il nucleo RBP Proteome) tra il lievito e le cellule umane 22 .

I RBP vegetali sono già stati trovati coinvolti nella crescita e nello sviluppo ( ad esempio nella regolazione post-trascrizionale del tempo di fioritura, dell'orologio circadiano e dell'espressione genica in mitocondri e cloroplasti) 24 , 25 , 26 , 27 , 28 , 29 . Inoltre, si pensa di svolgere funzioni nei processi cellulari che rispondono a sollecitazioni abiotiche ( ad esempio, freddo, siccità, sLinità e acido abscisico (ABA)) 31 , 32 , 33 , 34 . Ci sono più di 200 geni RBP previsti nel genoma Arabidopsis thaliana , basato su motivi di sequenza di dominio RNA (RRM) e K homology (KH); Nel riso, circa 250 sono stati notati 35 , 36 . È notevole che molti RBP previsti sembrano essere unici per le piante ( ad esempio, nessun ortologo metazoico a circa il 50% dei RBP di Arabidopsis previsti contenenti un dominio RRM) 35 , suggerendo che molti potrebbero servire nuove funzioni. Le funzioni dei RBP più previste rimangono inarcabili 23 .

L'isolamento dei proteomi legati al mRNA da Arabidopsis piantine etiolate, tessuti a foglia, cellule radicate coltivate e protoplasti di mezofosina di foglie attraverso l'uso diRecentemente è stata segnalata la cattura di interagenti mRNA 38 , 39 . Questi studi dimostrano il forte potenziale di catalogare sistematicamente i RBP funzionali nelle piante nel prossimo futuro. Qui presentiamo un protocollo per la cattura di intero mRNA da protoplasti vegetali ( cioè cellule senza pareti cellulari). I protoplasti di mezophyll delle foglie Arabidopsis thaliana sono il tipo principale di cellule di foglie. I protoplasti isolati consentono l'accesso ottimale della luce UV alle cellule. Questo tipo di cellula può essere utilizzato in saggi che esprimono transitoriamente proteine ​​per la caratterizzazione funzionale 40 , 41 . Inoltre, la protoplastica è stata applicata a diversi altri tipi di cellule vegetali e specie 42 , 43 , 44 ( es. Petersson et al ., 2009; Bargmann e Birnbaum, 2010; Hong et al ., 2012).

<P class = "jove_content"> Il metodo comprende un totale di 11 passaggi ( Figura 1A ). I protoplasti di mezophyll a foglia Arabidopsis vengono prima isolati (fase 1) e successivamente irradiati UV per formare mRNPs reticolati (fase 2). Quando i protoplasti vengono lisati in condizioni di denaturazione (fase 3), i mRNP reticolati vengono rilasciati in tampone di lisi / legame e tirati da oligo-d (T) 25 brani (fase 4). Dopo diversi cicli di lavaggi rigorosi, i mRNPs vengono purificati e analizzati ulteriormente. I peptidi denaturati di mRBPs vengono digeriti mediante proteinasi K prima che i mRNA reticolati siano purificati e la qualità RNA è verificata da qRT-PCR (passaggi 5 e 6). Dopo la terapia con RNase e la concentrazione di proteine ​​(fase 7), la qualità della proteina è controllata mediante elettroforesi in poliacrilammide SDS (SDS-PAGE) e colorazione in argento (fase 8). La differenza di pattern di banda proteica può essere facilmente visualizzata tra un campione reticolato (CL) e un campione non reticolato (non CL;Il campione di controllo negativo da protoplasti che non è sottoposto ad irraggiamento UV). L'identificazione delle proteine ​​è ottenuta tramite proteomica basata su MS. Le proteine ​​del campione CL sono separate da un'elettroforesi a gel di poliacrilammide (1D-PAGE) unidimensionale per rimuovere eventuali contaminazioni di fondo, sono "in-gel digerite" in peptidi corti utilizzando la tripsina e vengono purificati (fase 9). La cromatografia liquida a fase inversa di fase nano accoppiata alla spettrometria di massa (nano-LC-MS) permette di determinare la quantità di proteine ​​definitive nel proteome legato al mRNA (fase 10). Infine, i mRBP identificati sono caratterizzati e catalogati utilizzando analisi bioinformatica (fase 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Leaf Mesophyll Protoplast Isolamento

NOTA: I protoplasti della mesopilita delle foglie Arabidopsis sono essenzialmente isolati come descritto da Yoo et al ., 2007, con diverse modifiche 40 .

  1. Crescita delle piante
    1. Immergere circa 200 Arabidopsis thaliana Col-0 semi di ecotipo in acqua sterilizzata per 2 giorni a 4 ° C nell'oscurità per la stratificazione.
      NOTA: Questo numero di semi è sufficiente per un campione non CL e un campione CL (vedere passo 1.3).
    2. Preparare le pentole con una miscela del terreno e del vermiculite del 50% ( v / v ) e immergere le pentole con acqua distillata in un vassoio per bagnare il terreno.
    3. Coltivare e distribuire i semi stratificati su terreno bagnato. Non coprire i semi con terreno addizionale perché i semi di Arabidopsis necessitano di luce per la germinazione.
      NOTA: Le condizioni di crescita delle piante sono un ciclo di 12 h di luce / 12 ore scuro a 23 ° C,Con un'intensità luminosa di 100 μmol m -2 s -1 , in una sala di crescita per 5 settimane prima della fioritura. Possono essere utilizzate anche piante di 4 settimane 40 .
      NOTA: Tutti i materiali e reagenti descritti dal punto 1.2.1 al passaggio 3.2.3 sono per due campioni ( cioè un campione non CL (il campione di controllo non sottoposto ad irraggiamento UV) e un campione CL (la ricerca Campione sottoposto ad irraggiamento UV-C)).
  2. Preparazione della soluzione enzimatica isotonica
    1. Preparare 80 ml di soluzione enzimatica primaria isotonica (400 mM di mannitolo, 20 mM KCl e 20 mM di MES buffer (pH 5,7)) e riscaldare immediatamente la soluzione in un incubatore a 60 ° C per 10 min.
    2. Aggiungere 1,2 g di cellulasi R10 (w / v 1,5%) e 0,32 g di Macerozyme R10 (w / v 0,4%) in polvere per soluzione enzimatica isotonica primario caldo.
    3. Portare con cautela la polvere dell'enzima in soluzione applicando una leggera agitazione. RapBruciare calda la soluzione in un incubatore a 60 ° C per 10 minuti fino a quando la soluzione enzimatica è chiara chiara.
    4. Raffreddare la soluzione su ghiaccio per 3 min e aggiungere 800 μl di 1 M CaCl 2 e 800 μl di 10% ( w / v ) BSA alla soluzione.
    5. Homogenizzare la soluzione pipettando e filtrando attraverso un filtro da 0,22 μm. Aliquota questa ultima soluzione enzimatica isotonica in due grandi piatti di Petri (150 mm x 20 mm).
  3. Preparazione delle strisce di foglie rosse Arabidopsis
    NOTA: 150 foglie per ogni piatto Petri sono consigliate per un campione non CL o un campione CL.
    1. Scegliere e tagliare un totale di 300 completamente espansa 2 ° - 3 ° o doppia coppia di foglie vere (media: 3 - 4 per rosetta) in da 0,5 a 1 mm strisce foglio utilizzando un nuovo e tagliente lametta.
    2. Trasferire e sommergere immediatamente le strisce nella soluzione enzimatica isotonica.
      NOTA: per evitare qualsiasi contatto con la luce, coprire sempre tPiatti di Petri con foglio di alluminio. Non schiacciare le foglie. Verificare che tutte le strisce siano sommerse nella soluzione e non galleggiare sulla superficie.
  4. Isolamento dei protoplasti di mesophyll a foglia Arabidopsis
    1. Posizionare i piatti di Petri ricoperti di fogli di alluminio in essiccatori a vuoto e infiltrarsi in strisce di foglia sotto vuoto per 30 min. Successivamente, incubare i piatti di Petri nelle tenebre senza scuotere a temperatura ambiente per 2,5 ore.
    2. Scuotete manualmente e brevemente i piatti orizzontalmente a mano, cercando di liberare completamente i protoplasti nella soluzione enzimatica.
  5. Raccolta e conteggio dei protoplasti
    1. Filtrare la sospensione protoplastica attraverso una maglia in nylon da 35 a 75 μm. Aliquota il filtrato di ciascun campione in due tubi rotondi da 50 mL (circa 20 mL di filtrato in ciascun tubo).
    2. Sciacquare ogni piatto di Petri con 10 mL di tampone W5 (154 mM NaCl, 125 mM CaCl
    3. Spin tutti i quattro tubi per 5 minuti a 100 xg per pelletare i protoplasti. Scartare il surnatante e riposare delicatamente i pellet protoplast in ciascun tubo con 10 mL di tampone W5.
      NOTA: Quando si sospendono i pellet protoplast, inumidire delicatamente il tubo e ruotare delicatamente il tubo a mano fino a quando i pellet sono scomparsi. Non pipettare direttamente il pellet per evitare di danneggiare le cellule.
    4. Ripetere il passaggio 1.5.3 una volta e combinare la sospensione protoplastica da due tubi di ciascun campione in un tubo da 50 millimetri di fondo rotondo. Mantenere i tubi sul ghiaccio.
    5. Conti i protoplasti usando un emocitometro.
      NOTA: Ogni 20 celle entro 25 cubi corrispondono a 2 x 10 5 protoplasti / ml. 150 foglie dovrebbero produrre circa 1 x 10 7 cellule.Modulare per avere un uguale numero totale di protoplasti nei campioni non CL e CL.
    6. Mantenere i protoplasti in ghiaccio per 30 min. Successivamente, ruotare i tubi per 5 minuti a 100 x g. Eliminare il supernatante e risospendere le protoplasti in ogni provetta con 20 ml di soluzione MMg (400 mM di mannitolo, 15 mM MgCl 2, e 4 mM MES (pH 5,7)).

2. In vivo mRNA-protein Crosslinking mediante irradiazione UV

NOTA: Tenere il tubo di campione non CL sul ghiaccio. Il campione CL deve essere immediatamente irradiato UV.

  1. Trasferire la sospensione protoplastica contenente 1 x 10 7 cellule dal tubo di campione CL a un nuovo piatto di grandi dimensioni di Petri (150 mm x 20 mm) e aggiungere 30 ml di soluzione MMg ghiacciata per coprire la superficie della lastra. Distribuire le cellule in tutto il buffer MMg con pipetta gentile. Immediatamente mettere il piatto di Petri senza la copertura superiore in un apparecchio di reticolazione UV.
    NOTA: L'altezza tra la lampada UVE il piatto di Petri è di 8 cm.
  2. Irradiate il campione con una luce UV a 254 nm e un'intensità UV di 0,00875 W / cm 2 per 1 min, 3 min o 5 min. Dopo l'irraggiamento, rapidamente aliquota la sospensione protoplastica in due nuovi tubi rotondi da 50 mL. Lavare il fondo del piatto con un ulteriore 5 ml di soluzione MMg ghiacciata per raccogliere il resto dei protoplasti e aggiungere questa sospensione cellulare a questi due tubi.
    NOTA: 1 min è stato scelto come la condizione ottimale. La spiegazione può essere trovata nei risultati rappresentativi .

3. Lysis di protoplast in condizioni di denaturazione

  1. Preparazione di pellet protoplast per lisi
    1. Spin il tubo di campione non CL insieme ai due campioni di campione CL dal passo 2 a 100 xg per 5 minuti e scartare il supernatante. Posizionare il tubo del pellet protoplast del campione non CL sul ghiaccio.
    2. Aggiungere 10 ml di soluzione MMg ghiacciata a ciascuna provetta CL, genRiutilizzare i pellets e ricomponirli in un tubo rotondo da 50 ml. Spin il tubo a 100 xg per 5 minuti. Dopo aver rimosso il surnatante, mantenere il pallone protoplast del tubo di campione CL sul ghiaccio.
  2. Protoplast lisi e omogeneizzazione del protoplast lisato
    1. Aggiungere 9 mi di lysis / buffer di legame ghiacciato (500 mM LiCl, 0,5% ( w / v ) di dodecil solfato di litio (LiDS), 5 mM Dithiothreitol (DTT), 20 mM Tris-HCl (pH 7,5) e 1 mM EDTA (pH 8,0)) al pellet di cellule di ciascun campione. Approssimativamente lipe i protoplasti pipettando verso l'alto e verso il basso circa 20 volte fino a quando la sospensione è verde omogeneamente chiaro.
    2. Passare il lisato protoplastico due volte attraverso una siringa da 50 ml con un ago stretto (0,9 x 25 mm 2 ) per l'omogeneizzazione. Incubare il lisato su ghiaccio per 10 min. Freeze i lisati in azoto liquido e conservare a -80 ° C per un massimo di 3 settimane.

4. mRNP di abbattimento e di purificazioneDa Oligo-d (T) 25 Perline

NOTA: Tutti i seguenti materiali e reagenti descritti, dal punto 4.1 al punto 4.4, sono soltanto per un campione (ad esempio, un campione non-CL oppure un campione CL). Il lisato protoplast deve essere aggiunto immediatamente ai tubi contenenti perline dopo che il lozo / legante di legame di supernatante di branco viene scartato.

  1. Preparazione di branelli magnetici oligo-d (T) 25 per la cattura di oligo (dT)
    1. Sciogliere il lisato protoplastico congelato a temperatura ambiente. Quando il lisato è completamente scongelato, mantenere il tubo di lisato sul ghiaccio.
    2. Aliquota 1,8 ml di oligo-d (T) 25 branelli magnetici (5 mg / ml) in 6 nuovi tubi microcentrifuga da 2 ml di fondo tondo su ghiaccio. In ogni tubo, lavare la sospensione del tallone omogeneamente con 600 μl di tampone di lisi / legame brevemente pipettando su e giù e ruotando delicatamente a 4 ° C per 2 min. Tenere le perline sul ghiaccio.
  2. Rilegatura
    1. PostoTutti i 6 tubi che contengono le perline in una cremagliera magnetica a 4 ° C per 3 minuti, che provocherà la cattura magnetica delle perle e la radura della sospensione.
      NOTA: quando i tubi sono posizionati nel rack magnetico, attendere che le perle siano completamente catturate, almeno 3 min.
    2. Scartare il supernatante e immediatamente aliquota 9 ml di lisato protoplastico in questi 6 tubi. Mescolare bene pipettando finché non appare una sospensione omogenea e incubare le perle in lisato protoplastico a 4 ° C per 1 h applicando una leggera rotazione.
      NOTA: Si consiglia un tempo di incubazione da 30 minuti a 1 ora.
  3. Lavaggio
    1. Riposizionare i tubi nel rack magnetico a 4 ° C per 3 min. Quando tutte le perle vengono bloccate sul lato dei tubi, raccogliere il lisato protoplastico in 6 nuovi tubi di microcentrifuga a due millimetri e memorizzarli temporaneamente a 4 ° C. NON scartare subito il lisato protoplastico; Mantenere il lisatoA 4 ° C.
    2. Aggiungere 1,5 ml di tampone di lavaggio ghiacciato 1 (500 mM LiCl, 0,1% ( w / v ) LiDS, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) e 1 mM EDTA (pH 8,0) In ogni tubo. Riposizionare le perle e applicare una rotazione delicata per 1 minuto. Riposizionare i tubi nel rack magnetico a 4 ° C per 3 minuti e scartare il surnatante. Ripetere questa fase di lavaggio con un tampone di lavaggio una volta.
    3. Ripetere la stessa procedura di questo periodo di lavaggio due volte utilizzando 1,5 ml di tampone di lavaggio ghiacciato 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) e 1 mM EDTA (pH 8,0) 1,5 ml di tampone a basso contenuto di sale ghiacciato (200 mM LiCl, 20 mM Tris-HCl (pH 7,5) e 1 mM EDTA (pH 8,0).
      NOTA: se i mRNPs sono stati isolati in modo efficace dal lisato protoplastico, dovrebbe esserci un "aureo" visibile attorno al pellet di perle nel campione CL durante la fase di lavaggio con il tampone di lavaggio 2 ( figura 1B ).
  4. eluizione
    1. Aggiungere 500 μLDi tampone di eluizione (20 mM Tris-HCl (pH 7,5) e 1 mM EDTA (pH 8,0)) alle perline in ogni tubo. Riposare delicatamente le perle e incubare a 50 ° C per 3 min per rilasciare i RNA poli (A). Riposizionare delicatamente le perle una volta pipettando. Riposizionare i tubi nella cremagliera magnetica a 4 ° C per 5 min.
    2. Trasferire e combinare tutti gli eluenti (circa 3 ml in totale) ad un tubo sterile a fondo conico da 15 ml, privo di RNasi, a ghiaccio.
      NOTA: la qualità e la quantità di RNA possono essere immediatamente determinati utilizzando un dispositivo di spettrofotometro.
      NOTA: La concentrazione di RNA di ciascun campione è di circa 10 ng / μL, con un rapporto A 260 / A 280 di 1,9. Il rapporto A 260 / A 280 deve essere compreso tra 1,6 e 2,0, in quanto gli RNA isolati da poli (A) sono solitamente superiori al 70% puro. Se la concentrazione di RNA è troppo bassa, aumentare il numero di protoplasti di partenza fino ad un massimo di 10 9 . CampioniPossono essere congelati in azoto liquido e mantenuti a 80 ° C per l'immagazzinamento a lungo termine.
    3. Ripetere il passaggio 4.2 al punto 4.4 per altri due turni e riutilizzare le perline oligo-d (T) 25 per ridurre i RNA poli (A) dal lattato protoplastico.
      NOTA: Dopo tre cicli di allontanamento, devono essere complessivamente 9 mL di eluente per ogni campione non CL o CL. Eseguire tutto il lavoro a 4 ° C per evitare il degrado dell'RNA. Seguire il passo 4.5 o il passaggio 4.6 per riutilizzare o rigenerare le perle.
  5. Preparazione di oligo-d (T) 25 riutilizzati
    1. Lavare le perline due volte con 1 ml di tampone di eluizione gelato e una volta con 1 ml di lysis / legame di legame ghiacciato per regolare la concentrazione di LiCl in sale a 500 mM.
    2. Seguire il punto 4.1, scartare il surnatante, trasferire il lisato protoplastico conservato in ogni tubo e ripetere l'intera procedura dal punto 4.2 al punto 4.4 per altri due cicli.
  6. 25 perline
    NOTA: i branelli possono essere memorizzati e utilizzati per un altro esperimento (il riutilizzo massimo è tre volte).
    1. Seguire il punto 4.4, aggiungere 1 mL di 0,1 M NaOH ai branchi e incubare ruotando a temperatura ambiente per 5 minuti. Per ogni tubo, lavare due volte con 1 mL di tampone di lavaggio 1 e tre volte con 1x PBS (pH 7,4) contenente 0,1% Tween-20 per l'equilibrazione. Tenere le perle da ogni tubo in 300 μL di sterile RNase-free 1x PBS (pH 7.4) contenente 0,1% di Tween-20 a 4 ° C per la conservazione a lungo termine.
      NOTA: i branelli utilizzati per i campioni Arabidopsis CL in questo esperimento possono essere utilizzati solo per gli stessi campioni di piante la prossima volta.

5. Proteinasi K trattamento e purificazione mRNA

  1. Proteinasi K trattamento
    1. Aggiungere 8 μL di soluzione proteinacea K (2 μg / μL) a 1 ml di eluente da ogni campione per digerire le proteine ​​reticolate UV. BrVortice iefly.
  2. Purificazione di mRNA
    1. Incubare l'eluente a 37 ° C per 1 h. Purificare l'RNA utilizzando il kit di purificazione RNA per rimuovere contaminanti residui.
      NOTA: Dopo la depurazione, gli RNA sono pronti per il test di qualità RNA utilizzando il test qRT-PCR.
      NOTA: Altri kit, come il kit RNA mini e il reagente TRIzol, possono anche essere utilizzati 14 .

6. Analisi qRT-PCR

  1. Trascrizione inversa
    1. Realizzare una sintesi efficiente del cDNA di primo strato utilizzando il sistema di trascrizione inversa, con 1 μg di RNA come modello. Diluire il campione a 5 ng / μl con acqua priva di nucleasi.
  2. CDNA quantificazione usando qRT-PCR
    1. Amplificare e quantificare il cDNA usando il mix master master qPCR e il ciclatore PCR in tempo reale, con 10 g di cDNA come modello. Utilizzare il seguente programma PCR: 95 ° C per 10 min(Fase 1, un ciclo) e 95 ° C per 15 s e 60 ° C per 1 min (fase 2, 40 cicli).
      NOTA: Il gene di riferimento utilizzato qui è stato un gene di controllo interno endogeno, UBQ10 (AT4G05320). I primer di qRT-PCR per URQ10 e 18R rRNA sono stati descritti in Li et al ., 2014 e Durut et al ., 2014, rispettivamente 45 , 46 . Le sequenze di primer sono elencate nella tabella dei materiali .

7. Trattamento RNase e concentrazione mRBP

  1. RNase trattamento
    1. Aggiungere circa 100 U di cocktail RNase contenente RNasi A e RNasi T1 in 8 mL di eluente. Includere un campione di controllo negativo con cocktail RNase in cui l'eluente è sostituito da acqua priva di nucleasi. Brevemente vortice e incubare a 37 ° C per 1 ora.
  2. Concentrazione mRBP
    1. Dopo la digestione della RNasi, concentrare la usin dell'eluaG unità filtranti centrifughe. Il volume finale è di 75 μL, con una resa proteica totale di circa 2 μg di ciascun campione dopo la concentrazione. Posizionare i campioni a -80 ° C per la conservazione a lungo termine.

8. SDS-PAGE e colorazione d'argento

  1. SDS-PAGE
    1. Mescolare 25 μL dell'elemento concentrato (campione CL) o del campione di controllo (campione non CL) con 15 μL di 2x colorante di caricamento. Riscaldare il campione a 95 ° C per 5 minuti e caricarla su un gel SDS-PAGE contenente gel di impilamento del 5% e gel di risoluzione del 12%, compreso un marcatore proteico.
    2. Condensare le proteine ​​a 60 V per 40 minuti e separare a 160 V per circa 1 h finché il colorante di carica raggiunge la fine del gel di risolvimento.
  2. Saggio di colorazione d'argento
    1. Lavare il gel SDS-PAGE due volte con acqua ultrapura per 5 minuti ogni volta. Eseguire la colorazione d'argento delle proteine ​​usando un kit di macchia argentina commerciale.
      NOTA: Le bande proteiche devono essere visualizzate entro 5 min. Se le bande sono visibili dopo 5 minuti con un colore molto chiaro, si consiglia di aumentare il numero di protoplasti di partenza fino al massimo di 10 9 .

9. Trypsin Digest di proteine ​​e purificazione peptidica

  1. La digestione del Trypsin
    NOTA: eseguire un secondo gel 1D-PAGE prendendo altri 25 μL di soluzione mRBP concentrata da ciascun campione per l'identificazione mRBP; I gel gelati in argento non possono essere usati poiché non sono compatibili con l'analisi MS.
    1. Dopo aver eseguito il gel 1D-PAGE, fissare il gel in soluzione di fissazione (50% ( v / v ) metanolo e 10% ( v / v ) acido acetico) per 1 h. Macinare il gel in soluzione di macchia (0,1% ( w / v ) Coomassie Brilliant Blue R-250, 50% ( v / v ) metanolo e 10% ( v / v ) acido acetico) per 20 minuti con agitazione leggera. Destain il gel in soluzione destain (40% ( v / v ) metanolo e 10% ( v/ V) acido acetico) per 1 h. Dopo destaining, mantenere il gel nell'acido acetico del 5% ( v / v ).
      NOTA: Durante il destainamento, la nuova soluzione destain può essere sostituita fino a che il fondo non sia completamente destainato.
    2. Tagliate le bande di interesse fuori dal gel. Tagliare le fasce ulteriormente in pezzi di circa 1 mm 3 per la successiva digestione ottimale della trippa e estrazione dei peptidi. Idratare i pezzi di gel con 50 μl di bicarbonato di ammonio 100 mM (NH 4 HCO 3 ) per 10 min. Coprire completamente i pezzi del gel.
      1. Rimuovere attentamente la soluzione idratante e disidratare i pezzi del gel con acetonitrile (CH 3 CN) per 10 min. Rimuovere con cautela la soluzione acetonitrile.
      2. Ripetere il processo dall'idratazione alla disidratazione due volte. Infine, rimuovere la soluzione acetonitrile.
        NOTA: Il tempo di esecuzione del gel dipende dallo scopo dell'esperimento. I tempi lunghi permettono una buona separazione delle proteine, quindi il divieto specifico del gel macchiatoDs può essere tagliato per ulteriori analisi. Se lo scopo è mantenere le proteine ​​e rimuovere i contaminanti, è sufficiente un breve periodo di tempo.
    3. Aggiungere 500 μl di soluzione DTT da 6.6 mM ed incubare i pezzi di gel per 10 min. Rimuovere la soluzione DTT e lavare due volte il gel con 500 μl di soluzione acetonitrile al 95% ( v / v ).
      1. Dopo il lavaggio, rimuovere la soluzione di acetonitrile e incubare i pezzi di gel con 500 μl di soluzione di acido iodoacetico (IAA) di 55 mM per 10 minuti nell'oscurità.
      2. Dopo l'incubazione, rimuovere la soluzione e lavare nuovamente i pezzi di gel con 500 μl di soluzione acetonitrile al 95% ( v / v ). Asciugare i pezzi del gel.
    4. Incorporare i pezzi di gel completamente con 25 ml di tampone di digestione (50 mM NH 4 HCO 3, 5 mM CaCl 2, e 6 ng / mL tripsina) e mantenere in ghiaccio per 45 minuti per consentire la tripsina permeare nel gel. Incubare i pezzi di gel overnight a 37 ° C per en Digestione zymatic.
  2. Purificazione del peptide
    1. Aggiungere 80 μl di 50 mM di NH 4 HCO 3 ai pezzi del gel nel tampone di digestione e vorticarsi ripetutamente per estrarre i peptidi tryptici. Raccogliere l'estratto. Ripetere questo passo di estrazione due volte con 80 μl di 50% ( v / v ) CH 3 CN e 5% ( v / v ) acido formico (FA).
      NOTA: L'estratto finale totale dovrebbe essere di circa 240 μL.
    2. Stabilire e concentrare gli estratti in circa 10 μL per concentrazione sotto vuoto o liofilizzazione e aggiungere 25 μl di soluzione trifluoroacetica (TFA) acquoso 0,1% ( v / v ). Desaltare i campioni con le colonne μ-C18, seguendo il protocollo del produttore.
    3. Eluire i peptidi con 4 - 10 μL di 60% ( w / v ) CH 3 CN e 0,1% ( v / v ) FA. Liofilizzare (liofilizzare) i peptidi e conservarli a -20 ° C fino all'analisi.
Titolo "> 10. Nano-LC-MS

  1. Cromatografia liquida a fase inversa di Nano
    NOTA: eseguire l'analisi LC-MS con uno spettrometro di massa che è online-accoppiato con uno strumento di cromatografia liquida. Questo strumento deve essere dotato di una colonna C18 (particella di 2 μm, dimensioni di pori di 100 μ e dimensione di 50 μm x 15 cm).
    1. Risospendere i peptidi liofilizzati in 16 ml di soluzione (2% (v / v) CH 3 CN e 0,1% (v / v) FA). Iniettare e caricare 5 μL di soluzione peptidica a una portata di 5 μL / min su una precolonna C18 (dimensione delle particelle di 3 μm, dimensione di pori di 100 μ, nanoviper e 75 μm x 2 cm in dimensione).
    2. 10.1.2. Separare i peptidi usando un gradiente di 95 min con una portata di 300 nL / min. Durante questo gradiente di separazione aumentare la fase mobile B dal 4% al 10%, dal 10% al 25% e dal 25% al ​​45% rispettivamente in 5 min, 50 min e 18 min. Infine, aumenta notevolmente la fase mobile B al 95% in 1 min. DopoCiascun gradiente di separazione di 95 min, applicare un passo di risciacquo intrinseco contenente un gradiente di 10 min dal 4% al 95% in 5 min.
      NOTA: Fase mobile A è del 99,9% H 2 O e 0,1% (v / v) FA, e mobile la fase B è 19.92% H 2 O, 80% (w / v) CH 3 CN, e 0,08% (v / v ) FA.
  2. Saggio di spettrometria di massa
    1. Funziona lo spettrometro di massa in modalità dati dipendente con una gamma di massa da 400 a 1.600 m / z.
    2. Selezionare fino a dieci degli ioni più intensi in MS1 ​​per generare gli spettri di frammentazione. Impostare la risoluzione a 70.000 di larghezza massima a metà massimo (FWHM) per MS1 e 17.000 per MS2 con un target di controllo di guadagno automatico (AGC) di 3.000.000 e 1.000.000 ioni e un tempo di iniezione massimo di 256 ms e 64 ms per MS1 E MS2, rispettivamente.
    3. Impostare l'esclusione dinamica a 10 s per evitare la ripetuta frammentazione degli ioni più abbondanti.
      NOTA: qui, gli ioni con uno o più di sei cariche sono eXcluded per MS2.
  3. Proteomica qualitativa: identificazione di peptide e proteine
    1. Analizzare gli spettri di frammentazione usando software come il software Peaks studio 47 , 48 , 49 .
      NOTA: Altri pacchetti software sono disponibili per l'identificazione dei peptidi, come NovoHMM 30 e PepNovo 37 per la sequenza de novo e SEQUEST 54 e Mascot 55 per la ricerca del database.
    2. Combinare gli spettri con la stessa massa (<2 ppm di differenza) e tempi di ritenzione (<2 min) e mantenere solo gli spettri con una soglia di qualità superiore a 0,65 per ricercare il database Swiss-Prot (versione: dicembre 2013) per la tassonomia impostata sul modello Pianta Arabidopsis thaliana . Utilizzare i seguenti parametri di ricerca: una tolleranza di massa del precursore di 10 ppm con l'utilizzo del monMassa oisotopica; Una tolleranza di massa di frammenti di 20 mmu; La tripsina come enzima della digestione, con un massimo di 2 divisioni mancanti; Cisina carbamidometilazione come modifica fissa; Ossidazione della metionina come modifica variabile; E un massimo di 3 variazioni post-traduzionali variabili per peptide. Dopo l'identificazione, impostare manualmente le soglie di punteggio per l'identificazione affidabile del peptide e della proteina in modo che si acquisisca un tasso di scoperta falso (FDR) <5%.
  4. Proteomica quantitativa: analisi statistica dei dati di spettrometria di massa
    1. Utilizzare LC-MS ( ad es. Progenesis) per la quantitazione senza etichetta dei dati proteomici.
      NOTA: le aree di picco del peptide MS1 (o intensità) sono collegate ai peptidi identificati dal software dello studio in base alla loro massa, con l'errore tollerato ad un massimo di 10 ppm.
      NOTA: Questo software calcola l'abbondanza di un peptide integrando le aree di picco di tutti gli stati di carica tra 2 <Sup> + e 8 + . I dati quantitativi sono collegati all'identificazione del peptide PEAKS mediante uno script inhouse (corrispondenza in massa con l'errore tollerato al massimo di 10 ppm).
    2. Calcolare le variazioni medio log2 (CL / non-CL) per ogni peptide. Raggruppare le modifiche dei peptidi unici per proteine.
      NOTA: in ciascun gruppo, il cambiamento finale di una proteina è uguale al cambio medio dei suoi peptidi.
    3. Calcolare il valore p utilizzando la t- test di Student per ciascun gruppo per valutare il significato statistico. Applicare il pacchetto software R (versione 3.3.0) per correggere i valori p per l'FDR di tutti i gruppi utilizzando il metodo Benjamini-Hochberg (BH).
    4. Disegnare la trama vulcanica utilizzando il pacchetto funzione "calibrare" (versione 1.7.2) compatibile con il pacchetto software R (versione 3.3.0).
      NOTA: qui i valori p-adjusted (-log10 (valore p-aggiuntivo)) -log10 sono una funzione delle modifiche log2-fold di tutte le proteine ​​identificate. Le proteine ​​sonoTrattati come colpi positivi nel proteome legato al mRNA se i loro cambiamenti log2 sono più di 2, con o senza significato.

11. Catalogo del proteomico legato al mRNA identificato

  1. Classificare le proteine ​​identificate dal punto 10 in tre categorie in base agli elementi di "funzioni molecolari e processo biologico" tramite il database di Ontologia (GO) e "famiglia e dominio" tramite il database InterPro.
  2. Poiché la categoria I, o le "proteine ​​ribosomali", contengono tutte le proteine ​​ribosomali rilevate, definiscono le proteine ​​della categoria II o "RBP principali", come contenenti domini proteici annotati che interagiscono con RNA o collegano l'associazione RNA con funzioni note o sconosciute in biologia RNA .
  3. Poichè le proteine ​​con funzioni conosciute o sconosciute nella biologia di RNA senza domini di legame RNA annotato vengono inseriti nella categoria III o "RBPs candidati" definiscono gli enzimi della categoria III basati su annotazioni del gruppo INtEnz database.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abbiamo osservato un aureo caratteristico che circonda il pellet di perle nel campione CL, nel punto di lavaggio 4.3 con il tampone di lavaggio 2 ( figura 1B ). Anche se non è stato studiato, questo fenomeno può probabilmente essere spiegato dall'interferenza dei complessi mRNP reticolati con l'aggregazione del branco durante la cattura magnetica, causando un aggregato più diffuso. Indica che la cattura di bead di oligo-d (T) 25 è stata efficace 14 .

I livelli di mRNA di riferimento di UBQ10 significativamente più elevati di 18S rRNA in entrambi i campioni di controllo non CL e CL sono mostrati in Figura 1C . Ciò indica che i mRNA sono arricchiti nell'elemento a causa della cattura da oligo-d (T) 25 perline, che possono legarsi solo a mRNA a poli (A). L'efficienza della cattura di oligo-d (T) 25 è stata ulteriormente suppOrted by SDS-PAGE e colorazione d'argento (fase 8), come mostrato nella Figura 1D dopo il trattamento con RNase e la concentrazione mRBP (fase 7). È possibile osservare chiaramente una differenza di pattern di banda proteica tra i tracciati non-CL e quelli del campione CL e le bande proteiche presenti nella corsia del campione di controllo non CL possono essere spiegate dalla presenza di RNase. Ciò illustra il forte arricchimento dei mRBP nel campione CL.

L'efficienza del reticolazione può essere controllata variando la durata dell'irraggiamento UV. È sufficiente un collegamento reticolato ma l'evasione di danni protoplastici e degradazione del RNA è ottimale. Nella figura 1D , sono stati ottenuti modelli specifici di banda proteica in tutti i campioni CL quando si confrontano diversi tempi di irradiazione UV (1, 3 e 5 min). Sotto la stessa intensità UV (0,00875 W / cm 2 ), le condizioni ottimali sono state trovate per 1 o 3 min, a causa dell'individuabileIntensità della banda delle proteine. Le intensità di banda più deboli sono state osservate con il tempo di reticolazione più lungo (5 min). Abbiamo considerato 1 min come condizione ottimale perché una durata più breve di reticolazione ha il vantaggio aggiuntivo di facilitare il trasferimento e la raccolta di protoplasti dal piatto di Petri. I protoplasti possono essere rapidamente precipitati nella parte inferiore del piatto di Petri durante l'irradiazione UV perché si attaccano al fondo del piatto. Ciò rende più difficile raccogliere e trasferirli nei tubi dopo una durata maggiore dell'irraggiamento UV.

Sulla base delle condizioni ottimizzate, l'identificazione di proteine ​​da tre repliche biologiche è stata successivamente ottenuta mediante proteomica qualitativa e quantitativa, descritta nei passaggi 9 e 10. Nell'analisi mediante proteomica qualitativa ( figura 1E , a destra), un totale di 341 proteine Sono stati identificati in campioni CL, di cui 36 sono stati trovati sia in controllo non CLD CL e solo 8 proteine ​​sono state rilevate nel campione di controllo non CL. Questa enorme differenza nei numeri di proteine ​​identificati tra i due campioni è coerente con i diversi modelli di banda proteica ( Figura 1D ), sostenendo l'idea che il saggio SDS-PAGE e argento-colorazione sono strumenti utili per convalidare l'efficacia dell'oligo-d (T) 25 cattura di branelli. Nell'analisi per proteomica quantitativa ( figura 1E , sinistra), un totale di 325 proteine ​​(blu e verde) mostravano una variazione di log2 più grande di 2. Tra queste proteine, 100 proteine ​​(blu) avevano p -valori al di sopra del livello di significatività. Quindi, sono stati definiti anche come colpi positivi. È notevole che i valori p di un'altra 225 proteine ​​(color verde) siano stati superiori a 0,05, al di sotto del livello di significatività dovuto alla dispersione dei dati. In altre parole, esistevano peptidi abbondanti abbondanti per ogni proteina, con elevata variabilità del peptide intensities. Tuttavia, poiché tutti sono stati individuati qualitativamente solo nei campioni CL, sono stati considerati positivi.

Sulla base dei database GO e InterPro 50 (fase 11), queste 325 proteine ​​furono ulteriormente classificate nella categoria I (proteine ​​ribosomali), categoria II (RBP principali) e categoria III (RBP candidati) ( Figura 1F ). C'erano 123 proteine ​​ribosomali nella categoria I, mentre nella categoria II sono stati osservati 70 RBP classici annotati. Queste due categorie che contengono la maggior parte delle proteine ​​annotate che legano l'associazione di RNA molecolare e la biologia di RNA ( figura 1F , a destra) e che occupano rispettivamente circa il 38% e il 22% dell'intero proteome legato al mRNA, indicano l'alta efficienza del interattivo mRNA ottimizzato catturare. Gli ultimi 40% (132 RBP candidati) sono stati classificati nella categoria III a causa della mancanza di RBD convenzionali. Inoltre, la maggior parte del thI ruoli di ruolo nei processi biologici RNA e RNA non sono stati convalidati ( Figura 1F , sinistra). Supponiamo che le proteine ​​di questa categoria possano rivelare nuove funzioni nelle regole RNA.

Figura 1
Figura 1: Diagramma di flusso e risultati del metodo ottimizzato per la scoperta del Proteome legato all'MRNA da Protoplaste di Mesophyll Leaf Arabidopsis . ( A ) Le fasi principali di tutto il metodo sono elencate da 1 a 11. I processi cellulare e molecolare di Putative sono illustrati dalla foto e dai cartoni animati. I dettagli per ogni passaggio sono stati descritti intensamente nel Protocollo. ( B ) Un alogeno è stato osservato intorno al pellet di branelli nel campione CL, ma non nel campione di controllo non CL, durante il passo di lavaggio 4.3. (C) Confronto delle relative leve UBQ10 mRNA e 18S rRNALs nei campioni di controllo non CL e CL da qRT-PCR (i valori sono media ± SD (n = 3); * e **: differenze significative con p <0,05 e <0,01). ( D ) Eluente proteico concentrato di campione di controllo non CL rispetto ai campioni CL irradiati da una sorgente UV a onda continua per 1, 3 e 5 min, con intensità UV a 0,00875 W / cm 2 . ( E ) Identificazione del proteome legato al mRNA mediante proteomica. Nella proteomica quantitativa eseguita dal pacchetto software Progenesis (a sinistra), la trama vulcanica visualizza le variazioni medio log2 (CL / non-CL) ei relativi valori p-adjusted (-log10 (p-valori aggiuntivi)) Tutte le proteine. Nella proteomica qualitativa eseguita dal pacchetto software Peaks (a destra), le proteine ​​nei campioni sono illustrate in diagrammi Venn. La quantità di proteine ​​è elencata in numeri. Il FDR a livello peptidico e proteico è inferiore al 5%. Il numero di proteine ​​all'interno dei fotogrammi marrone chiaro è considerato un colpo positivo. ( et al ., 2016. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Abbiamo applicato con successo la cattura di interazione di mRNA, sviluppata per le cellule di lievito e umano, per protoplasti di mesofila a foglia vegetale. Le cellule mezofiliche dei fogli sono il principale tipo di tessuto a base di foglie vegetali. Il principale vantaggio di questo metodo è che utilizza in-vivo incrociando per scoprire le proteine ​​da un ambiente fisiologico.

In questo protocollo, abbiamo principalmente presentiamo una serie di condizioni sperimentali ottimizzate (per esempio il numero di protoplasti da utilizzare come materiale e la durata dell'irradiazione UV iniziale) 50. Le proteine catturate nei campioni CL possono essere rilevati solo mediante SDS-PAGE e colorazione con argento quando un minimo di 10 7 protoplasti (medie dimensioni) viene utilizzato (fase 1.5.5). Le concentrazioni inferiori non producono un modello mRBP osservabile su SDS-PAGE e probabilmente non dovrebbero essere utilizzati per ulteriori analisi dalla proteomica. Infatti, utilizzando più di 10 7 cellule ( ad esempio, 10 9 inUn esperimento su larga scala) è anche possibile 20 . I risultati dei test di colorazione in argento suggeriscono che l'irraggiamento UV per 1 min con 0,00875 W / cm 2 di intensità generata da una sorgente UV a onda continua è ottimale ( Figura 1D ). L'alta efficienza alla fase critica ( vale a dire, la tiratura e la purificazione di mRNP da oligo-d (T) 25 branchi, fase 4) è supportata dai risultati dei test RT-qPCR, colorazione argentata e MS ( Figura 1C ; 1D e 1E , a destra). La combinazione di proteomica qualitativa e quantitativa può aiutare a identificare i RBP positivi nella regione di sovrapposizione tra i campioni CL e CL ( Figura 1E ). La maggior parte delle proteine ​​identificate erano RBP non precedentemente annotate in set di dati ( Figura 1F ). Abbiamo presentato queste proteine ​​vincolanti RNA in precedenza sconosciute nella categoria III come RBP candidati <Sup class = "xref"> 50 ( Figura 1F ). L'esplorazione delle specificità di binding di questi RBP candidati deve essere effettuata utilizzando altri metodi, come i metodi CLIP 23 precedentemente menzionati. Un esempio che esamina la specificità di legame di un RBP per regolare il suo trascritto bersaglio mRNA in Arabidopsis tramite l'uso di CLIP 51 può essere trovato in Zhang et al ., 2015. Inoltre, un metodo alternativo modificato da PAR-CLIP, chiamato photoactivatable- La reticolazione aumentata con ribonucleoside (PAR-CL, 365 nm UV-A) è stata precedentemente raccomandata per l'indagine di proteomi legati al mRNA da cellule di lievito e umano 14 , 23 . PAR-CL richiede 4Su, che viene assunto dalle cellule e incorporato in RNA nascenti durante il metabolismo RNA e può essere altamente reattivo, formando legami covalenti con gli amminoacidi 52 sotto UV-A (365 nm) irradizione. Attualmente, non ci sono studi che si concentrano sulla tossicità di 4sU alle cellule vegetali e sull'efficace assorbimento di esogene 4sU nei protoplasti mesofil 53 . Tuttavia, riteniamo che sia possibile utilizzare sia le piante convenzionali CL (254-nm UV-C) che PAR-CL (365 nm UV-A), che contribuiranno alla scoperta e alla convalida di RBP diversi dal fisiologico Ambiente in futuro.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgements

Riconosciamo il laboratorio del Prof. Joris Winderickx, che ha fornito l'apparecchio di reticolazione UV equipaggiato con la lampada UV convenzionale. KG è supportato dal fondo di ricerca KU Leuven e riconosce il sostegno della sovvenzione FWO G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics