MRNA Interactome Capture aus Pflanzenprotoplasten

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier präsentieren wir ein Interaktom-Capture-Protokoll, das auf Arabidopsis thaliana Blatt-Mesophyll-Protoplasten angewendet wird. Diese Methode beruht kritisch auf in vivo UV-Vernetzung und ermöglicht die Isolierung und Identifizierung von p-mRNA-bindenden Proteinen aus einer physiologischen Umgebung.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA-bindende Proteine ​​(RBPs) bestimmen die Schicksale von RNAs. Sie beteiligen sich an allen RNA-Biogenese-Pfaden und tragen insbesondere zur posttranskriptionellen Genregulation (PTGR) von Messenger-RNAs (mRNAs) bei. In den vergangenen Jahren wurde eine Reihe von mRNA-gebundenen Proteomen aus Hefe- und Säugetierzelllinien erfolgreich durch die Verwendung einer neuartigen Methode namens "mRNA interactome capture" isoliert, die die Identifizierung von mRNA-bindenden Proteinen (mRBPs) ermöglicht, Direkt aus einer physiologischen Umgebung. Das Verfahren besteht aus in vivo- Ultraviolett- (UV-) Vernetzung, Pull-Down und Reinigung von Messenger-Ribonukleoproteinkomplexen (mRNPs) durch Oligo (dT) -Kügelchen und die anschließende Identifizierung der vernetzten Proteine ​​durch Massenspektrometrie (MS). In jüngster Zeit wurden durch die Anwendung der gleichen Methode mehrere pflanzen-mRNA-gebundene Proteome gleichzeitig aus verschiedenen Arabidopsis- Gewebequellen berichtet: etiolierte Sämlinge, Blattgewebe,Blatt-Mesophyll-Protoplasten und kultivierten Wurzelzellen. Hier präsentieren wir die optimierte mRNA-Interaktom-Capture-Methode für Arabidopsis Thaliana- Blatt-Mesophyll-Protoplasten, ein Zelltyp, der als vielseitiges Werkzeug für Experimente dient, die verschiedene zelluläre Assays einschließen. Die Bedingungen für eine optimale Proteinausbeute umfassen die Menge an Ausgangsgewebe und die Dauer der UV-Bestrahlung. In der mRNA-gebundenen Proteom von einem mittelgroßen Experiment erhalten (10 7 Zellen), RBPs merkt RNA-Bindungskapazität zu haben , wurde gefunden , dass überrepräsentiert werden, und viele neue RBPs wurden identifiziert. Das Experiment kann skaliert werden (10 9 Zellen), und das optimierte Verfahren kann auf andere Pflanzenzelltypen und -arten angewendet werden, um mRNA-gebundene Proteome in Pflanzen weitgehend zu isolieren, zu katalogisieren und zu vergleichen.

Introduction

Eukaryonten verwenden mehrere RNA-Biogenese-regulatorischen Wege, um zelluläre biologische Prozesse aufrechtzuerhalten. Unter den bekannten Arten von RNA ist mRNA sehr vielfältig und trägt die Codierungskapazität von Proteinen und deren Isoformen 1. Der PTGR-Weg leitet das Schicksal der prä-mRNAs 2 , 3 . RBPs von verschiedenen Genfamilien kontrollieren die Regulation von RNA und in PTGR führen spezifische mRBPs mRNAs durch direkte physikalische Wechselwirkungen, die funktionelle mRNPs bilden. Daher ist die Identifizierung und Charakterisierung von mRBPs und deren mRNPs entscheidend für das Verständnis der Regulation des zellulären mRNA-Metabolismus 2. In den vergangenen drei Jahrzehnten wurden verschiedene in vitro- Methoden - einschließlich RNA-Elektrophorese-Mobilitätsverschiebungen (REMSA) -Anays, systematische Evolution von Liganden durch exponentielle Anreicherungsassays durchgeführt (SELEX) auf Basis von bibliotheksbezogenen Konstrukten, RNA Bind-n-Seq (RBNS), radioaktiv markiert oder quantitativFluoreszenz-RNA-Bindungsassays, Röntgenkristallographie und NMR-Spektroskopie 4 , 5 , 6 , 7 , 8 , 9 - wurden weitgehend auf Studien von RBPs, hauptsächlich aus Säugetierzellen, angewendet. Die Ergebnisse dieser Studien von Säugetier RBPs kann über das RNA-bindende Protein DataBase (RBPDB) gesucht werden, die die veröffentlichten Beobachtungen 10 sammelt.

Obwohl diese in vitro- Ansätze mächtige Werkzeuge sind, bestimmen sie die gebundenen RNA-Motive aus einem gegebenen RNA-Pool von Sequenzen und sind daher in ihrer Fähigkeit, neue Ziel-RNAs zu entdecken, begrenzt. Dasselbe gilt für die Rechenstrategien genomweite RBPs vorherzusagen, die zur Erhaltung der Proteinsequenz basieren und 15 strukturieren. Um dies zu überwinden, ist eine neue experimentelle Methode haS etabliert, die die Identifizierung der RNA-Motive ermöglicht, mit denen ein RBP von Interesse interagiert, sowie für die Bestimmung der genauen Lage der Bindung. Diese Methode, genannt "Vernetzung und Immunopräzipitation" (CLIP), besteht aus in vivo UV-Vernetzung, gefolgt von Immunopräzipitation 11 . Frühere Studien haben gezeigt, dass die Photoaktivierung von DNA- und RNA-Nukleotiden bei Anregungs-UV-Wellenlängen größer als 245 nm auftreten kann. Die Reaktion durch Thymidin scheint begünstigt zu sein (Rang in der Reihenfolge der verminderten Photoreaktivität: dT ≥ dC> rU> rC, dA, dG) 12 . Unter Verwendung von UV-Licht mit einer Wellenlänge von 254 nm (UV-C) wurde beobachtet, dass kovalente Bindungen zwischen RNA-Nukleotiden und Proteinresten entstehen, wenn sie im Bereich von nur wenigen Angström (Å) liegen. Das Phänomen wird daher als "Null-Länge" Vernetzung von RNA und RBP bezeichnet. Darauf folgt eine strenge Aufreinigung Dure mit wenig Hintergrund 13 , 14 .

Eine für CLIP komplementäre Strategie besteht darin, in vivo UV-Vernetzung mit Proteinidentifikation zu kombinieren, um die Landschaft von RBPs zu beschreiben. Eine Reihe solcher genomweite mRNA-gebundenen Proteome wurden aus Hefezellen, embryonale Stammzellen ( ES- Zellen) und menschlichen Zelllinien (dh, HEK293 und HeLa) unter Verwendung dieses neuen experimentellen Ansatz, genannt „mRNA Interaktom capture“ 18, isoliert 19 , 20 , 21 . Das Verfahren besteht aus in vivo UV-Vernetzung, gefolgt von mRNP-Reinigung und MS-basierter Proteomik. Durch die Anwendung dieser Strategie wurden viele neuartige "Mondlicht" -RBPs, die nicht-kanonische RBDs enthalten, entdeckt worden, und es ist klar geworden, dass mehr Proteine ​​RNA-bindende Kapazitäten haben, als zuvor angenommen"> 15 , 16 , 17. Die Verwendung dieser Methode ermöglicht neue Anwendungen und die Möglichkeit, bei der Untersuchung von RBPs neue biologische Fragen zu beantworten. So hat beispielsweise eine aktuelle Studie die Konservierung des mRNA-gebundenen Proteoms (der Kern-RBP) untersucht Proteom) zwischen Hefe und menschlichen Zellen 22 .

Pflanze RBPs haben sich bereits in Wachstum und Entwicklung ( z . B. in der posttranskriptionalen Regulation der Blütezeit, der zirkadianen Uhr und der Genexpression in Mitochondrien und Chloroplasten) 24 , 25 , 26 , 27 , 28 , 29 beteiligt . Darüber hinaus wird angenommen, dass sie Funktionen in den zellularen Prozessen ausführen, die auf abiotische Belastungen reagieren ( zB Kälte, Dürre, SaLinität und Abszisäure (ABA)) 31 , 32 , 33 , 34 . Es gibt mehr als 200 vorhergesagte RBP-Gene im Arabidopsis-Thaliana- Genom, basierend auf RNA-Erkennungsmotiv (RRM) und K-Homologie (KH) Domänensequenzmotiven; In Reis wurden etwa 250 bekannt, 35 , 36 . Es ist bemerkenswert, dass viele vorhergesagte RBPs für Pflanzen einzigartig zu sein scheinen ( z. B. keine Metazoan-Orthologe zu etwa 50% der vorhergesagten Arabidopsis- RBPs, die eine RRM-Domäne enthalten) 35 , was darauf hindeutet, dass viele neue Funktionen erfüllen können. Die Funktionen der meisten vorhergesagten RBPs bleiben uncharakterisiert 23 .

Die Isolierung von mRNA-gebundenen Proteomen aus Arabidopsis etiolierten Sämlinge, Blattgewebe, kultivierte Wurzelzellen und Blatt-Mesophyll-Protoplasten durch den Einsatz vonMRNA-Interaktom-Capture wurde vor kurzem berichtet 38 , 39 . Diese Studien zeigen das starke Potenzial der systematischen Katalogisierung von funktionalen RBPs in Anlagen in naher Zukunft. Hier stellen wir ein Protokoll für die mRNA-Interaktom-Erfassung von Pflanzenprotoplasten ( dh Zellen ohne Zellwände) vor. Arabidopsis Thaliana Blatt Mesophyll Protoplasten sind die wichtigsten Arten von Blatt Zelle. Die isolierten Protoplasten ermöglichen einen optimalen Zugang von UV-Licht zu den Zellen. Dieser Zelltyp kann in Assays verwendet werden, die vorübergehend Proteine ​​für die funktionelle Charakterisierung 40 , 41 exprimieren. Weiterhin wurde das Protoplasten auf mehrere andere Pflanzenzelltypen und Arten 42 , 43 , 44 angewendet ( z. B. Petersson et al ., 2009, Bargmann und Birnbaum, 2010 und Hong et al ., 2012).

<P class = "jove_content"> Die Methode umfasst insgesamt 11 Schritte ( Abbildung 1A ). Arabidopsis- Blatt-Mesophyll-Protoplasten werden zuerst isoliert (Schritt 1) ​​und werden anschließend UV-bestrahlt, um vernetzte mRNPs zu bilden (Schritt 2). Wenn die Protoplasten unter denaturierenden Bedingungen lysiert werden (Schritt 3), werden die vernetzten mRNPs in Lyse / Bindungspuffer freigesetzt und durch Oligo-d (T) 25- Kügelchen (Schritt 4) heruntergezogen. Nach mehreren Runden von stringenten Waschungen werden die mRNPs gereinigt und weiter analysiert. Die denaturierten Peptide von mRBPs werden durch Proteinase K verdaut, bevor die vernetzten mRNAs gereinigt werden und die RNA-Qualität durch qRT-PCR (Schritte 5 und 6) verifiziert wird. Nach der RNase-Behandlung und der Proteinkonzentration (Schritt 7) wird die Proteinqualität durch SDS-Polyacrylamidgelelektrophorese (SDS-PAGE) und Silberfärbung gesteuert (Schritt 8). Der Unterschied in Proteinbandmustern kann leicht zwischen einer vernetzten Probe (CL) und einer nicht vernetzten Probe (nicht-CL;Die Negativkontrollprobe aus Protoplasten, die keiner UV-Bestrahlung ausgesetzt ist). Die Identifizierung von Proteinen wird durch MS-basierte Proteomik erreicht. Die Proteine ​​aus der CL-Probe werden durch eine eindimensionale Polyacrylamid-Gelelektrophorese (1D-PAGE) getrennt, um mögliche Hintergrundverunreinigungen zu entfernen, werden unter Verwendung von Trypsin "in-Gel-verdaut" in kurze Peptide und werden gereinigt (Schritt 9). Nano-Reverse-Phase-Flüssigkeitschromatographie, gekoppelt an Massenspektrometrie (Nano-LC-MS) ermöglicht die Bestimmung der Menge an definitiven Proteinen im mRNA-gebundenen Proteom (Schritt 10). Schließlich werden die identifizierten mRBPs unter Verwendung einer bioinformatischen Analyse charakterisiert und katalogisiert (Schritt 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Blatt Mesophyll Protoplast Isolierung

ANMERKUNG: Arabidopsis- Blatt-Mesophyll-Protoplasten werden im Wesentlichen isoliert, wie von Yoo et al ., 2007, mit mehreren Modifikationen 40 beschrieben .

  1. Wachstum der Pflanzen
    1. Etwa 200 Arabidopsis thaliana Col-0 Ökotyp Samen in sterilisiertem Wasser für 2 Tage bei 4 ° C in Dunkelheit für die Schichtung einweichen.
      HINWEIS: Diese Anzahl von Samen reicht für eine Nicht-CL-Probe und eine CL-Probe (siehe Schritt 1.3).
    2. Bereiten Sie Töpfe mit einer 50% ( v / v ) Mischung von Boden und Vermiculit und tränken Sie die Töpfe mit destilliertem Wasser in einem Tablett, um den Boden zu nass.
    3. Aussaat und verteilen die geschichteten Samen auf nassen Boden. Bedecken Sie die Samen nicht mit zusätzlichem Boden, da Arabidopsis Samen Licht für die Keimung benötigen.
      ANMERKUNG: Die Pflanzenwachstumsbedingungen sind ein 12-h-Licht / 12-h-Dunkelzyklus bei 23 ° C,Mit einer Lichtintensität von 100 μmol m -2 s -1 , in einem Wachstumsraum für 5 Wochen vor der Blüte. 4-wöchige Pflanzen können auch genutzt werden 40 .
      HINWEIS: Alle beschriebenen Materialien und Reagenzien aus Schritt 1.2.1 bis Schritt 3.2.3 sind für zwei Proben ( dh eine Nicht-CL-Probe (die Kontrollprobe, die keiner UV-C-Bestrahlung ausgesetzt ist) und einer CL-Probe (die Forschung Probe, die einer UV-C-Bestrahlung ausgesetzt ist)).
  2. Herstellung der isotonischen Enzymlösung
    1. Mischen Sie 80 ml primäre isotonische Enzymlösung (400 mM Mannit, 20 mM KCl und 20 mM MES-Puffer (pH 5,7)) und erhitzen Sie die Lösung sofort in einem 60 ° C-Inkubator für 10 min.
    2. Füge 1,2 g Cellulase R10 ( w / v 1,5%) und 0,32 g Macerozyme R10 ( w / v 0,4%) Pulver zu der warmen primären isotonischen Enzymlösung hinzu.
    3. Das Enzympulver vorsichtig mit leichtem Rühren in Lösung bringen. RapDie Lösung in einem 60 ° C-Inkubator für 10 min hitzeweise erhitzen, bis die Enzymlösung klar hellbraun ist.
    4. Die Lösung auf Eis für 3 min kühlen und 800 μl 1 M CaCl 2 und 800 μl 10% ( w / v ) BSA zu der Lösung hinzufügen.
    5. Homogenisieren der Lösung durch Pipettieren und Filtrieren durch ein 0,22 μm Filter. Aliquot diese endgültige isotonische Enzymlösung in zwei große Petrischalen (150 mm x 20 mm).
  3. Vorbereitung der Arabidopsis Rosettenblattstreifen
    HINWEIS: 150 Blätter für jede Petrischale werden für eine Nicht-CL-Probe oder eine CL-Probe empfohlen.
    1. Wählen und schneiden insgesamt 300 2 nd vollständig expandiert - oder 3 rd -Pair echte Blätter (Durchschnitt: 3 - 4 pro Rosette) in 0,5- bis 1-mm Blattstreifen , eine neue und scharfe Rasierklinge verwendet.
    2. Übertragen und die Streifen sofort in die isotonische Enzymlösung eintauchen.
      HINWEIS: Um jeglichen Kontakt mit Licht zu vermeiden,Er Petrischalen mit Aluminiumfolie. Zerschmettere die Blätter nicht. Vergewissern Sie sich, dass alle Streifen in die Lösung getaucht sind und nicht auf der Oberfläche schwimmen.
  4. Isolierung von Arabidopsis- Blatt-Mesophyll-Protoplasten
    1. Legen Sie die mit Aluminiumfolie überzogenen Petrischalen in Vakuum-Exsikkatoren und infiltrieren Sie die Blattstreifen unter Vakuum für 30 min. Anschließend die Petrischalen in Dunkelheit ohne Schütteln bei Raumtemperatur für 2,5 h inkubieren.
    2. Schütteln Sie die Speisen vorsichtig und schütteln Sie sie von Hand, und versuchen Sie, die Protoplasten vollständig in die Enzymlösung zu bringen.
  5. Ernten und Zählen der Protoplasten
    1. Filtriere die Protoplastsuspension durch ein Nylongewebe von 35 bis 75 μm. Aliquot das Filtrat jeder Probe in zwei 50 ml Rundbodenrohre (ca. 20 ml Filtrat in jedem Röhrchen).
    2. Spülen Sie jede Petrischale mit 10 ml W5-Puffer (154 mM NaCl, 125 mM CaCl
    3. Drehen Sie alle vier Röhrchen für 5 min bei 100 xg, um die Protoplasten zu pelletieren. Den Überstand verwerfen und die Protoplastenpellets in jedem Röhrchen mit 10 ml W5-Puffer vorsichtig resuspendieren.
      HINWEIS: Wenn Sie die Protoplastenpellets resuspendieren, schieben Sie das Röhrchen vorsichtig um und bewegen Sie das Röhrchen vorsichtig mit der Hand, bis die Pellets verschwunden sind. Das Pellet nicht direkt pipettieren, um die Zellen nicht zu beschädigen.
    4. Wiederholen Sie Schritt 1.5.3 einmal und kombinieren Sie die Protoplasten-Suspension aus zwei Röhrchen jeder Probe in ein 50-ml-Rundbodenrohr. Halten Sie die Röhrchen auf Eis.
    5. Zähle die Protoplasten mit einem Hämocytometer.
      HINWEIS: Jede 20 Zellen innerhalb von 25 Würfeln entspricht 2 x 10 5 Protoplasten / ml. 150 Blätter sollten etwa 1 x 10 7 Zellen ergeben.Modulieren, um eine gleiche Gesamtzahl der Protoplasten in den Nicht-CL- und CL-Samples zu haben.
    6. Halten Sie die Protoplasten auf Eis für 30 min. Danach die Röhrchen für 5 min bei 100 x g drehen. Verwerfen Sie den Überstand und resuspendieren Sie die Protoplasten in jedem Röhrchen mit 20 ml MMg-Lösung (400 mM Mannitol, 15 mM MgCl 2 und 4 mM MES-Puffer (pH 5,7)).

2. In vivo mRNA-Protein Vernetzung durch UV-Bestrahlung

HINWEIS: Halten Sie das Nicht-CL-Probenröhrchen auf Eis. Die CL-Probe muss sofort UV bestrahlt werden.

  1. Übertragen Sie die Protoplasten-Suspension mit 1 x 10 7 Zellen aus dem CL-Probenröhrchen in eine neue groß angelegte Petrischale (150 mm x 20 mm) und fügen Sie 30 ml eiskalte MMg-Lösung zur Deckung der Plattenoberfläche hinzu. Verbreiten Sie die Zellen im ganzen MMG-Puffer durch sanftes Pipettieren. Sofort die Petrischale ohne Deckel in eine UV-Vernetzungsvorrichtung stellen.
    HINWEIS: Die Höhe zwischen der UV-LampeUnd die Petrischale ist 8 cm.
  2. Bestrahlen Sie die Probe mit 254 nm Wellenlängen-UV-Licht und 0,00875 W / cm 2 UV-Intensität für 1 min, 3 min oder 5 min. Nach der Bestrahlung die Protoplasten-Suspension schnell in zwei neue 50-ml-Rundbodenrohre verteilen. Waschen Sie den Boden der Schale mit einer zusätzlichen 5 ml eiskalten MMg-Lösung, um den Rest der Protoplasten zu sammeln und fügen Sie diese Zellsuspension zu diesen beiden Röhrchen hinzu.
    HINWEIS: 1 min wurde als optimaler Zustand gewählt. Die Erläuterung finden Sie in den repräsentativen Ergebnissen .

3. Protoplast-Lyse unter den Denaturierungsbedingungen

  1. Vorbereitung von Protoplastenpellets zur Lyse
    1. Das Nicht-CL-Probenröhrchen zusammen mit den beiden CL-Probenröhrchen aus Schritt 2 bei 100 xg für 5 min drehen und den Überstand verwerfen. Legen Sie die Röhre des Nicht-CL-Proben-Protoplast-Pellets wieder auf Eis.
    2. Füge 10 ml eiskalte MMg-Lösung zu jedem CL-Probenröhrchen hinzuDie Pellets resuspendieren und sie zu einem 50 mL Rundbodenrohr zusammenführen. Das Röhrchen bei 100 xg für 5 min drehen. Nach dem Entfernen des Überstandes das CL-Probenröhrchen-Protoplast-Pellet auf Eis aufbewahren.
  2. Protoplast-Lyse und homogenisierende Protoplasten-Lysat
    1. Füge 9 ml eiskaltes Lyse / Bindungspuffer (500 mM LiCl, 0,5% ( w / v ) Lithiumdodecylsulfat (LiDS), 5 mM Dithiothreitol (DTT), 20 mM Tris-HCl (pH 7,5) und 1 mM hinzu EDTA (pH 8,0)) zum Zellpellet jeder Probe. Die Protoplasten durch das Pipettieren etwa 20-malig auf- und abziehen, bis die Suspension homogen hellgrün ist.
    2. Führen Sie das Protoplasten-Lysat zweimal durch eine 50-ml-Glasspritze mit einer schmalen Nadel (0,9 x 25 mm 2 ) zur Homogenisierung. Inkubieren Sie das Lysat auf Eis für 10 min. Die Lysate in flüssigem Stickstoff einfrieren und bei -80 ° C bis zu 3 Wochen aufbewahren.

4. mRNP Pull-down und ReinigungVon Oligo-d (T) 25 Perlen

HINWEIS: Alle nachfolgend beschriebenen Materialien und Reagenzien von Schritt 4.1 bis Schritt 4.4 sind nur für eine Probe ( dh eine Nicht-CL-Probe oder eine CL-Probe). Das Protoplasten-Lysat muss sofort den Röhrchen zugesetzt werden, die Perlen enthalten, nachdem der Wulstüberstand-Lyse / Bindungspuffer verworfen wurde.

  1. Vorbereitung von Oligo-d (T) 25 magnetischen Perlen für Oligo (dT) -Erfassung
    1. Das gefrorene Protoplasten-Lysat bei Raumtemperatur auftauen. Wenn das Lysat vollständig aufgetaut ist, halte das Lysat auf Eis.
    2. Aliquot 1,8 ml Oligo-d (T) 25 magnetische Kügelchen (5 mg / ml) in 6 neue 2-ml-Rundboden-Mikrozentrifugenröhrchen auf Eis geben. In jedem Röhrchen die Wulst Suspension homogen mit 600 μl Lyse / Bindungspuffer durch kurzes Pipettieren auf und ab waschen und sanft bei 4 ° C für 2 min drehen. Halten Sie die Perlen auf Eis.
  2. Bindung
    1. OrtAlle 6 Röhrchen, die die Perlen in eine magnetische Zahnstange bei 4 ° C für 3 min enthalten, was zur magnetischen Erfassung der Kügelchen und zum Ausräumen der Suspension führen wird.
      HINWEIS: Wenn die Röhrchen in das Magnetgestell gestellt werden, warten Sie, bis die Perlen vollständig eingefangen sind, mindestens 3 min.
    2. Den Überstand verwerfen und sofort 9 ml Protoplasten-Lysat in diese 6 Röhrchen aliquotieren. Mischen Sie gut durch Pipettieren, bis eine homogene braune Suspension auftritt und die Perlen in Protoplastenlysat bei 4 ° C für 1 h unter Anwendung einer sanften Rotation inkubieren.
      HINWEIS: Eine Inkubationszeit von 30 min bis 1 h wird empfohlen.
  3. Waschen
    1. Legen Sie die Röhrchen 3 Minuten lang bei 4 ° C in die Magnetstange. Wenn alle Perlen auf der Seite der Röhrchen eingefangen werden, sammeln Sie das Protoplasten-Lysat in 6 neue 2-ml-Rundfuß-Mikrozentrifugenröhrchen und lagern sie vorübergehend bei 4 ° C. NICHT das Protoplasten-Lysat sofort verwerfen; Halte das lysatBei 4 ° C.
    2. Füge 1,5 ml eiskaltes Waschpuffer 1 (500 mM LiCl, 0,1% ( w / v ) LiDS, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) und 1 mM EDTA (pH 8,0)) zu den Perlen hinzu In jedem Rohr Resspendieren Sie die Perlen und wenden Sie sanfte Rotation für 1 min an. Legen Sie die Röhrchen 3 Minuten lang bei 4 ° C in die Magnetstange und entsorgen Sie den Überstand. Wiederholen Sie diesen Waschschritt mit Waschpuffer einmal.
    3. Wiederholen Sie den gleichen Vorgang dieses Waschschrittes zweimal mit 1,5 ml eiskaltem Waschpuffer 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) und 1 mM EDTA (pH 8,0)) und einmal unter Verwendung von 1,5 ml eiskaltes Salz mit niedrigem Salzgehalt (200 mM LiCl, 20 mM Tris-HCl (pH 7,5) und 1 mM EDTA (pH 8,0)).
      HINWEIS: Wenn die mRNPs effizient aus dem Protoplasten-Lysat isoliert worden sind, sollte während des Waschschrittes mit Waschpuffer 2 ein "Halo" um das Perlenpellet in der CL-Probe sichtbar sein ( Abbildung 1B ).
  4. Elution
    1. 500 μl zugebenDes Elutionspuffers (20 mM Tris-HCl (pH 7,5) und 1 mM EDTA (pH 8,0)) zu den Perlen in jedem Röhrchen. Die Perlen vorsichtig resuspendieren und bei 50 ° C für 3 min inkubieren, um die Poly (A) -Tailten-RNAs freizusetzen. Die Perlen vorsichtig durch Pipettieren resuspendieren. Legen Sie die Röhrchen bei 4 ° C für 5 min in die Magnetstange zurück.
    2. Übertragen und kombinieren Sie alle Eluenten (ca. 3 mL insgesamt) zu einem sauberen, sterilen RNase-freien, 15-ml-konischen Bodenrohr auf Eis.
      HINWEIS: Die Qualität und Menge der RNA kann sofort mit einem Spektrophotometergerät bestimmt werden.
      HINWEIS: Die RNA-Konzentration jeder Probe beträgt etwa 10 ng / μl mit einem A 260 / A 280- Verhältnis von 1,9. Das A 260 / A 280- Verhältnis sollte zwischen 1,6 und 2,0 liegen, da die isolierten Poly (A) -Tailten-RNAs üblicherweise größer als 70% rein sind. Wenn die RNA-Konzentration zu niedrig ist, erhöhen Sie die Anzahl der Startprotoplasten auf maximal 10 9 . ProbenKann in flüssigem Stickstoff eingefroren werden und bei 80 ° C für Langzeitlagerung gehalten werden.
    3. Wiederholen Sie Schritt 4.2 bis Schritt 4.4 für weitere zwei Runden und verwenden Sie die Oligo-d (T) 25 Perlen, um die Poly (A) -Tailte RNAs aus dem Protoplasten-Lysat abzutragen.
      ANMERKUNG: Nach drei Runden des Pull-Down-Verfahrens sollten für jede Nicht-CL- oder CL-Probe insgesamt 9 ml Elutionsmittel vorhanden sein. Führen Sie alle Arbeiten bei 4 ° C aus, um den Abbau von RNA zu vermeiden. Folgen Sie Schritt 4.5 oder Schritt 4.6, um die Perlen wieder zu verwenden oder zu regenerieren.
  5. Vorbereitung der wiederverwendeten Oligo-d (T) 25 Perlen
    1. Waschen Sie die Perlen zweimal mit 1 ml eiskaltem Elutionspuffer und einmal mit 1 ml eiskaltem Lyse / Bindungspuffer, um die Salz-LiCl-Konzentration auf 500 mM einzustellen.
    2. Folgen Sie Schritt 4.1, verwerfen Sie den Überstand, übertragen Sie das gespeicherte Protoplasten-Lysat in jedem Röhrchen und wiederholen Sie die gesamte Prozedur von Schritt 4.2 bis Schritt 4.4 für weitere zwei Runden.
  6. 25 Perlen
    HINWEIS: Perlen können gespeichert und für ein anderes Experiment verwendet werden (maximale Wiederverwendung ist dreimal).
    1. Folgen Sie Schritt 4.4, fügen Sie 1 ml 0,1 M NaOH zu den Perlen hinzu und inkubieren durch Rotation bei Raumtemperatur für 5 min. Für jedes Röhrchen zweimal mit 1 ml Waschpuffer 1 und dreimal mit 1x PBS (pH 7,4) mit 0,1% Tween-20 zur Äquilibrierung waschen. Halten Sie die Perlen aus jedem Röhrchen in 300 μl sterilem RNase-freie 1x PBS (pH 7,4) mit 0,1% Tween-20 bei 4 ° C für Langzeitlagerung.
      HINWEIS: Perlen, die für Arabidopsis CL-Proben in diesem Experiment verwendet werden, können nur für die gleichen Pflanzenproben verwendet werden.

5. Proteinase K Behandlung und mRNA Reinigung

  1. Proteinase K Behandlung
    1. Füge 8 μl Proteinase K-Lösung (2 μg / μL) zu 1 ml des Elutionsmittels aus jeder Probe hinzu, um die UV-vernetzten Proteine ​​zu verdauen. BrHauptsächlich vortexen
  2. MRNA-Reinigung
    1. Das Elutionsmittel bei 37 ° C für 1 h inkubieren. Reinigen Sie die RNA mit dem RNA-Reinigungskit, um restliche Verunreinigungen zu entfernen.
      ANMERKUNG: Nach der Reinigung sind die RNAs für den RNA-Qualitäts-Test mit dem qRT-PCR-Test bereit.
      HINWEIS: Andere Kits, wie RNA Mini Kit und TRIzol Reagenz, können auch verwendet werden 14 .

6. qRT-PCR-Assay

  1. Reverse Transkription
    1. Erzielung einer effizienten Synthese von First-Strang-cDNA unter Verwendung des Reverse-Transkriptionssystems mit 1 & mgr; g RNA als Matrize. Die Probe auf 5 ng / μl mit nukleasefreiem Wasser verdünnen.
  2. CDNA-Quantifizierung mit qRT-PCR
    1. Amplifizierung und Quantifizierung der cDNA unter Verwendung der qPCR-Mastermischung und des Echtzeit-PCR-Cyclers mit 10 ng cDNA als Matrize. Verwenden Sie das folgende PCR-Programm: 95 ° C für 10 min(Stufe 1, ein Zyklus) und 95 ° C für 15 s und 60 ° C für 1 min (Stufe 2, 40 Zyklen).
      HINWEIS: Das hier verwendete Referenzgen war ein endogenes internes Kontrollgen, UBQ10 (AT4G05320). QRT-PCR-Primer für UBQ10 und 18S-rRNA wurden in Li et al ., 2014 und Durut et al ., 2014 bzw. 45 , 46 beschrieben . Primer-Sequenzen sind in der Materialtabelle aufgelistet.

7. RNase-Behandlung und mRBP-Konzentration

  1. RNase Behandlung
    1. Füge etwa 100 U RNase-Cocktail mit RNase A und RNase T1 in 8 ml Elutionsmittel hinzu. Füge eine Negativkontrollprobe mit RNase-Cocktail ein, in der das Elutionsmittel durch nukleasefreies Wasser ersetzt wird. Kurz vorwirbeln und bei 37 ° C für 1 h inkubieren.
  2. MRBP-Konzentration
    1. Nach der RNase-Verdauung konzentriere ich das ElutionsmittelG Zentrifugalfiltereinheiten. Das Endvolumen beträgt 75 & mgr; l, mit einer Gesamtproteinausbeute von etwa 2 & mgr; g jeder Probe nach der Konzentration. Legen Sie die Proben auf -80 ° C für die Langzeitlagerung.

8. SDS-SEITE und Silberfärbung

  1. SDS-SEITE
    1. Mischen Sie 25 μl des konzentrierten Elutionsmittels (CL-Probe) oder der Kontrollprobe (Nicht-CL-Probe) mit 15 μl 2x Beladungsfarbstoff. Die Probe bei 95 ° C für 5 min erhitzen und auf ein SDS-PAGE-Gel mit 5% Stapelgel und 12% Auflösungsgel, einschließlich eines Proteinmarkers, aufladen.
    2. Kondensieren Sie die Proteine ​​bei 60 V für 40 min und trennen Sie bei 160 V für ca. 1 h, bis der Beladungsfarbstoff das Ende des Auflösungsgels erreicht
  2. Silberfärbungstest
    1. Waschen Sie das SDS-PAGE-Gel zweimal mit Reinstwasser für jeweils 5 min. Führen Sie die Silber-Färbung der Proteine ​​mit einem kommerziellen Silber Fleck-Kit.
      HINWEIS: Die Proteinbänder müssen innerhalb von 5 min angezeigt werden. Wenn die Bänder über 5 min mit sehr heller Farbe sichtbar sind, wird vorgeschlagen, die Anzahl der Startprotoplasten bis maximal 10 9 zu erhöhen.

9. Trypsin-Digest von Protein-Banden und Peptid-Reinigung

  1. Trypsin verdauen
    HINWEIS: Führen Sie ein zweites 1D-PAGE-Gel aus, indem Sie weitere 25 μl konzentrierte mRBP-Lösung aus jeder Probe für die mRBP-Identifizierung einnehmen. Silber-gefärbte Gele können nicht verwendet werden, da sie nicht mit MS-Analyse kompatibel sind.
    1. Nach dem Führen des 1D-PAGE-Gels das Gel in Fixierlösung (50% ( v / v ) Methanol und 10% ( v / v ) Essigsäure) für 1 h fixieren. Färben Sie das Gel in Flecklösung (0,1% ( w / v ) Coomassie Brilliant Blue R-250, 50% ( v / v ) Methanol und 10% ( v / v ) Essigsäure) für 20 min unter leichtem Schütteln. Destinieren Sie das Gel in destain-Lösung (40% ( v / v ) Methanol und 10% ( v/ V) Essigsäure) für 1 h. Nach dem Entfärben das Gel in 5% ( v / v ) Essigsäure aufbewahren.
      HINWEIS: Während der Entfärbung kann die neue Entfaltungslösung ersetzt werden, bis der Hintergrund vollständig entfärbt ist.
    2. Schneide die Bands von Interesse aus dem Gel. Schneiden Sie die Bänder weiter in Stücke von ca. 1 mm 3 für die anschließende optimale Trypsinverdauung und Extraktion von Peptiden. Hydratisieren Sie die Gelstücke mit 50 μl 100 mM Ammoniumbicarbonat (NH 4 HCO 3 ) für 10 min. Die Gelstücke vollständig abdecken.
      1. Entfernen Sie die hydratisierende Lösung sorgfältig und dehydrieren Sie die Gelstücke mit Acetonitril (CH 3 CN) für 10 min. Entfernen Sie vorsichtig die Acetonitrillösung.
      2. Wiederholen Sie den Vorgang von der Hydratation zur Dehydration zweimal. Schließlich entfernen Sie die Acetonitrillösung.
        HINWEIS: Die Gellaufzeit hängt vom Zweck des Experiments ab. Eine lange Laufzeit erlaubt eine gute Trennung von Proteinen, so dass die gefärbten spezifischen Gel-VerbotDs können für weitere Analysen ausgeschnitten werden. Wenn es darum geht, die Proteine ​​zu halten und Verunreinigungen zu entfernen, genügt eine kurze Laufzeit.
    3. Füge 500 μl 6,6 mM DTT-Lösung hinzu und inkubiere die Gelstücke für 10 min. Entfernen Sie die DTT-Lösung und waschen Sie die Gelstücke zweimal mit 500 μl 95% ( v / v ) Acetonitrillösung.
      1. Nach dem Waschen die Acetonitrillösung entfernen und die Gelstücke mit 500 μl 55 mM Iodessigsäure (IAA) -Lösung für 10 min in der Dunkelheit inkubieren.
      2. Nach der Inkubation die Lösung entfernen und die Gelstücke wieder mit 500 μl 95% ( v / v ) Acetonitrillösung waschen. Die Gelstücke trocknen.
    4. Die Gelstücke vollständig mit 25 μl Verdauungspuffer (50 mM NH 4 HCO 3 , 5 mM CaCl 2 und 6 ng / μl Trypsin) einbetten und 45 min auf Eis aufbewahren, damit das Trypsin in das Gel eindringen kann. Inkubieren Sie die Gelstücke über Nacht bei 37 ° C für en Zymatische Verdauung.
  2. Peptidreinigung
    1. Füge 80 μl 50 mM NH 4 HCO 3 zu den Gelstücken im Verdauungspuffer hinzu und verwirre mich wiederholt, um die tryptischen Peptide zu extrahieren. Sammle den Auszug. Wiederholen Sie diesen Extraktionsschritt zweimal mit 80 μl 50% ( v / v ) CH 3 CN und 5% ( v / v ) Ameisensäure (FA).
      HINWEIS: Der gesamte endgültige Extrakt sollte ca. 240 μl betragen.
    2. Pool und konzentrieren die Extrakte in etwa 10 μl durch Vakuumkonzentration oder Lyophilisierung und fügen 25 μl 0,1% ( v / v ) wässrige Trifluoressigsäure (TFA) -Lösung hinzu. Die Proben mit μ-C18-Säulen nach dem Protokoll des Herstellers abtrocknen.
    3. Eluieren Sie die Peptide mit 4 - 10 μl 60% ( w / v ) CH 3 CN und 0,1% ( v / v ) FA. Lyophilisieren (Gefriertrocknung) der Peptide und lagern sie bei -20 ° C bis zur Analyse.
Titel "> 10. Nano-LC-MS

  1. Nano-Umkehrphasen-Flüssigkeitschromatographie
    HINWEIS: Führen Sie die LC-MS-Analyse mit einem Massenspektrometer durch, das online mit einem Flüssigchromatographie-Instrument gekoppelt ist. Dieses Instrument sollte mit einer C18-Säule (2 μm Partikel, 100 Å Porengröße und 50 μm x 15 cm in der Dimension) ausgestattet sein.
    1. Die lyophilisierten Peptide in 16 μl Lösung (2% ( v / v ) CH 3 CN und 0,1% ( v / v ) FA) resuspendieren. 5 & ​​mgr; l Peptidlösung mit einer Flussrate von 5 & mgr; l / min auf einer C18-Vorsäule (3 & mgr; m Teilchengröße, 100 Å Porengrße, Nanoviper und 75 & mgr; m × 2 cm in der Dimension) beladen und belasten.
    2. 10.1.2. Trennen Sie die Peptide mit einem 95-minütigen Gradienten mit einer Durchflussrate von 300 nL / min. Während dieses Trenngradienten erhöhen Sie die mobile Phase B von 4% auf 10%, 10% bis 25% und 25% bis 45% in 5 min, 50 min bzw. 18 min. Schließlich steigern Sie die mobile Phase B steil auf 95% in 1 min. NachJeder 95-minütige Trenngradient, einen inhärenten Spülschritt mit einem 10-minütigen Gradienten von 4% bis 95% in 5 min anwenden.
      HINWEIS: Die mobile Phase A beträgt 99,9% H 2 O und 0,1% ( v / v ) FA und die mobile Phase B beträgt 19,92% H 2 O, 80% ( w / v ) CH 3 CN und 0,08% ( v / v ) FA.
  2. Massenspektrometrie-Assay
    1. Betreiben Sie das Massenspektrometer im datenabhängigen Modus mit einem Massenbereich von 400 bis 1.600 m / z.
    2. Wählen Sie bis zu zehn der intensivsten Ionen in MS1, um die Fragmentierungsspektren zu erzeugen. Setzen Sie die Auflösung auf 70.000 volle Breite bei halbem Maximum (FWHM) für MS1 und 17.000 für MS2 mit einem automatischen Gain Control (AGC) Ziel von 3.000.000 und 1.000.000 Ionen und einer maximalen Ioneninjektionszeit (IT) von 256 und 64 ms für MS1 Und MS2.
    3. Setzen Sie den dynamischen Ausschluss auf 10 s, um eine wiederholte Fragmentierung der häufigsten Ionen zu vermeiden.
      HINWEIS: Hier sind Ionen mit einer oder mehr als sechs Ladungen eFür MS2 ausgeschlossen.
  3. Qualitative Proteomik: Peptid- und Proteinidentifikation
    1. Analysieren Sie Fragmentierungsspektren mit Software wie Peaks Studio Software 47 , 48 , 49 .
      HINWEIS: Andere Softwarepakete stehen auch für die Peptididentifizierung zur Verfügung, wie zum Beispiel NovoHMM 30 und PepNovo 37 für de novo Sequenzierung und SEQUEST 54 und Mascot 55 für die Datenbanksuche.
    2. Kombinieren Sie Spektren mit der gleichen Masse (<2 ppm Differenz) und Retentionszeiten (<2 min) und behalten Sie nur Spektren mit einer Qualitätsschwelle von mehr als 0,65, um die Swiss-Prot Datenbank (Version: Dezember 2013) für die zu modellierende Taxonomie zu durchsuchen Pflanze Arabidopsis thaliana . Verwenden Sie die folgenden Suchparameter: eine Vorläufermasse Toleranz von 10 ppm durch die Verwendung der monOisotopische Masse; Eine Fragmentmassentoleranz von 20 mmu; Trypsin als Verdauungsenzym, mit maximal 2 verpassten Spaltungen; Cystein-Carbamidomethylierung als feste Modifikation; Methionin-Oxidation als die variable Modifikation; Und maximal 3 variable posttranslationale Modifikationen pro Peptid. Nach der Identifizierung manuell die Score-Schwellenwerte für eine zuverlässige Peptid- und Proteinidentifikation festlegen, so dass eine falsche Entdeckungsrate (FDR) <5% erworben wird.
  4. Quantitative Proteomik: statistische Analyse von Massenspektrometrie-Daten
    1. Verwenden Sie LC-MS ( zB Progenese) für die etikettfreie Quantifizierung von Proteomikdaten.
      ANMERKUNG: MS1-Peptid-Peak-Bereiche (oder Intensität) sind mit den Peptiden verknüpft, die von der Studio-Software nach ihrer Masse identifiziert wurden, mit dem tolerierten Fehler bei maximal 10 ppm.
      HINWEIS: Diese Software berechnet die Fülle eines Peptids durch die Integration der Peak-Bereiche aller Ladezustände zwischen 2 <Sup> + und 8 + . Die quantitativen Daten sind mit der PEAKS-Peptididentifikation durch ein Inhouse-Skript verknüpft (Massenanpassung mit dem tolerierten Fehler bei maximal 10 ppm).
    2. Berechnen Sie die durchschnittlichen log2-fach Änderungen (CL / non-CL) für jedes Peptid. Gruppe die Falten-Änderungen der einzigartigen Peptide durch Protein.
      ANMERKUNG: In jeder Gruppe entspricht die endgültige Faltungsänderung eines Proteins den durchschnittlichen Faltungsveränderungen seiner Peptide.
    3. Berechnen Sie den p-Wert mit dem t- test der Schüler für jede Gruppe, um die statistische Signifikanz zu bewerten. Wenden Sie das R-Softwarepaket (Version 3.3.0) an, um die p-Werte für den FDR aller Gruppen mit der Benjamini-Hochberg (BH) -Methode zu korrigieren.
    4. Zeichnen Sie das Vulkan-Plot mit dem mit dem R-Softwarepaket (Version 3.3.0) kompatiblen "Kalibrierungs" -Funktionspaket (Version 1.7.2).
      HINWEIS: Hier sind die -log10-angepassten p-Werte (-log10 (adj. P-Wert)) eine Funktion der log2-fach Änderungen aller identifizierten Proteine. Proteine ​​sindAls positive Treffer im mRNA-gebundenen Proteom behandelt, wenn ihre log2-fach-Änderungen größer als 2 sind, mit oder ohne Bedeutung.

11. Katalog des identifizierten mRNA-gebundenen Proteoms

  1. Klassifizierung der identifizierten Proteine ​​aus Schritt 10 in drei Kategorien basierend auf den Elementen der "molekularen Funktionen und biologischen Prozess" über die Gene Ontology (GO) Datenbank und "Familie und Domain" über die InterPro Datenbank.
  2. Da die Kategorie I oder "Ribosomale Proteine" alle detektierten ribosomalen Proteine ​​enthalten, definieren sie Proteine ​​aus der Kategorie II oder "Main RBPs", die annotierte Proteindomänen enthalten, die mit RNAs interagieren oder mit RNA-Bindung mit bekannten oder unbekannten Funktionen in der RNA-Biologie verknüpfen .
  3. Als Proteine ​​mit bekannten oder unbekannten Funktionen in der RNA-Biologie ohne annotierte RNA-bindende Domänen werden in die Kategorie III oder "Candidate RBPs" gesetzt, definieren Enzyme aus der Kategorie III auf der Grundlage von Annotationen aus dem INtEnz-Datenbank

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Wir beobachteten einen charakteristischen Halogen, der das Perlenpellet in der CL-Probe umgibt, im Waschschritt 4.3 mit Waschpuffer 2 ( Fig. 1B ). Obwohl es nicht untersucht worden ist, kann dieses Phänomen wahrscheinlich durch die Interferenz von vernetzten mRNP-Komplexen mit der Wulstaggregation während der magnetischen Erfassung erklärt werden, wodurch ein diffuseres Aggregat gebildet wird. Es zeigt an, dass die Oligo-d (T) 25- Wulst-Erfassung wirksam war 14 .

Die signifikant höheren UBQ10- Referenz-mRNA-Spiegel als 18S-rRNA in sowohl Nicht-CL-Kontroll- als auch CL-Proben sind in 1C gezeigt . Dies deutet darauf hin, dass mRNAs aufgrund des Captures durch Oligo-d (T) 25- Kügelchen angereichert sind, die nur an Poly (A) -tailing-mRNAs binden können. Die Effizienz des Oligo-d (T) 25- Wulstfangs wurde weiter gegeben(SDR) und Silberfärbung (Schritt 8), wie in 1D nach RNase-Behandlung und mRBP-Konzentration gezeigt (Schritt 7). Ein Unterschied im Proteinbandmuster zwischen Nicht-CL-Kontrolle und CL-Probenspuren kann deutlich beobachtet werden, und die Proteinbanden, die in der Nicht-CL-Kontrollprobenspur vorhanden sind, können durch die Gegenwart von RNase erklärt werden. Dies verdeutlicht die starke Anreicherung von mRBPs in der CL-Probe.

Die Effizienz der Vernetzung kann durch Variieren der Zeitdauer der UV-Bestrahlung gesteuert werden. Ausreichende Vernetzung, aber die Vermeidung von Protoplastenschäden und RNA-Abbau ist optimal. In 1D wurden spezifische Proteinbandmuster in allen CL-Proben erhalten, wenn verschiedene UV-Bestrahlungszeiten (1, 3 und 5 min) verglichen wurden. Unter der gleichen UV-Intensität (0,00875 W / cm 2 ) wurden die optimalen Bedingungen als 1 oder 3 min aufgrund der Ununterscheidbaren gefundenProteinbandintensitäten. Schwächere Bandintensitäten wurden mit der längeren Vernetzungszeit (5 min) beobachtet. Wir betrachteten 1 min als die optimale Bedingung, weil eine kürzere Dauer der Vernetzung den zusätzlichen Vorteil der leichteren Übertragung und Sammlung von Protoplasten aus der Petrischale hat. Protoplasten können während der UV-Bestrahlung schnell auf den Boden der Petrischale gefällt werden, weil sie am Schalenboden haften. Dies macht es schwieriger, sie nach längerer UV-Bestrahlungsdauer zu sammeln und zu den Röhren zu übertragen.

Basierend auf den optimierten Bedingungen wurde die Identifizierung von Proteinen aus drei biologischen Replikaten anschließend durch qualitative und quantitative Proteomik erreicht, die in den Schritten 9 und 10 beschrieben wurde. Bei der Analyse durch qualitative Proteomik ( Abbildung 1E , rechts) wurden insgesamt 341 Proteine Wurden in CL-Proben identifiziert, von denen 36 sowohl in der Nicht-CL-Kontrolle an gefunden wurdenD CL-Proben und nur 8 Proteine ​​wurden in der Nicht-CL-Kontrollprobe nachgewiesen. Dieser enorme Unterschied in den identifizierten Proteinzahlen zwischen beiden Proben stimmt mit den verschiedenen Proteinbandmustern überein ( Abbildung 1D ) und unterstützt die Idee, dass der SDS-PAGE- und Silberfärbungstest gute Werkzeuge zur Validierung der Effizienz von Oligo-d (T) 25 Perlenfänger Bei der Analyse durch quantitative Proteomik ( Abbildung 1E , links) zeigten insgesamt 325 Proteine ​​(blau- und grünfarben) eine log2-fache Veränderung größer als 2. Unter diesen Proteinen hatten 100 Proteine ​​(blau gefärbt) eine kleine p -Werte über dem Signifikanzniveau. Deshalb wurden sie auch als positive Treffer definiert. Es ist bemerkenswert, dass die p-Werte von anderen 225 Proteinen (grün gefärbt) größer als 0,05 waren, unterhalb des Signifikanzniveaus aufgrund der Daten-Spärheit. Mit anderen Worten, es gab wenig reichlich vorhandene Peptide für jedes Protein mit hoher Variabilität der PeptidintensitätEs Da aber alle von ihnen nur in CL-Samples qualitativ erkannt wurden, wurden sie als positiv betrachtet.

Basierend auf den GO- und InterPro-Datenbanken 50 (Schritt 11) wurden diese 325 Proteine ​​weiter in die Kategorie I (ribosomale Proteine), Kategorie II (Haupt-RBPs) und Kategorie III (Kandidaten-RBPs) eingestuft ( Abbildung 1F ). Es gab 123 ribosomale Proteine ​​in der Kategorie I, während in der Kategorie II 70 kommentierte klassische RBPs beobachtet wurden. Diese beiden Kategorien, die die meisten annotierten Proteine ​​enthalten, die mit der molekularen RNA-Bindung und der RNA-Biologie verknüpfen ( Abbildung 1F , rechts) und die etwa 38% bzw. 22% des gesamten mRNA-gebundenen Proteoms einnehmen, zeigen die hohe Effizienz des optimierten mRNA-Interaktoms an Erfassung. Die letzten 40% (132 Kandidaten-RBPs) wurden aufgrund der fehlenden konventionellen RBDs in die Kategorie III eingestuft. Darüber hinaus die meisten von thEir Rollen in RNA-Bindung und RNA biologische Prozesse wurden nicht validiert ( Abbildung 1F , links). Wir nehmen an, dass Proteine ​​aus dieser Kategorie neue Funktionen in RNA-Vorschriften aufdecken könnten.

Abbildung 1
Abbildung 1: Flussdiagramm und Ergebnisse der optimierten Methode zur Entdeckung des mRNA-gebundenen Proteoms aus Arabidopsis- Blatt-Mesophyll-Protoplasten. ( A ) Die wichtigsten Schritte der gesamten Methode sind von 1 bis 11 aufgeführt. Putative zelluläre und molekulare Prozesse werden durch das Foto und die Cartoons veranschaulicht. Einzelheiten für jeden Schritt wurden im Protokoll intensiv beschrieben. ( B ) Es wurde ein Halo beobachtet, der das Perlenpellet in der CL-Probe umgibt, jedoch nicht in der Nicht-CL-Kontrollprobe während des Waschschrittes 4.3. ( C ) Vergleich der relativen UBQ10 mRNA und 18S rRNA leveLs in Nicht-CL-Steuerung und CL-Samples durch qRT-PCR (Werte sind Mittelwert ± SD (n = 3); * und **: signifikante Unterschiede mit p <0,05 und <0,01). ( D ) Konzentriertes Protein-Elutionsmittel der Nicht-CL-Kontrollprobe im Vergleich zu CL-Proben, bestrahlt durch eine kontinuierliche UV-Quelle für 1, 3 und 5 min mit der UV-Intensität bei 0,00875 W / cm 2 . ( E ) Identifizierung von mRNA-gebundenem Proteom durch Proteomik In der quantitativen Proteomik, die durch das Progenesis-Softwarepaket (links) durchgeführt wird, zeigt das Vulkan-Diagramm die durchschnittlichen log2-fach-Änderungen (CL / non-CL) und die zugehörigen angepassten p-Werte (-log10 (adj. P-Werte)) von Alle Proteine. In der qualitativen Proteomik des Peaks-Softwarepakets (rechts) werden die Proteine ​​in den Proben in Venn-Diagrammen dargestellt. Die Menge der Proteine ​​ist in Zahlen aufgeführt. Der FDR bei den Peptid- und Proteinebenen liegt unter 5%. Die Anzahl der Proteine ​​in den hellbraunen Rahmen gilt als positive Treffer. ( et al ., 2016 modifiziert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Wir haben mRNA-Interaktom-Capture, die für Hefe und menschliche Zellen entwickelt wurden, erfolgreich angewendet, um Blatt-Mesophyll-Protoplasten zu pflanzen. Blatt-Mesophyll-Zellen sind die Hauptart des Grundgewebes in Pflanzenblättern. Der Hauptvorteil dieser Methode ist, dass sie in vivo Vernetzung verwendet, um die Proteine ​​aus einer physiologischen Umgebung zu entdecken.

In diesem Protokoll stellen wir vor allem eine Reihe von optimierten experimentellen Bedingungen vor ( zB die Anzahl der Protoplasten als Ausgangsmaterial und die Dauer der UV-Bestrahlung) 50 . Die eingefangenen Proteine ​​in den CL-Proben können nur durch SDS-PAGE und Silberfärbung nachgewiesen werden, wenn mindestens 10 7 Protoplasten (Mittelmaß) verwendet werden (Schritt 1.5.5). Niedrigere Konzentrationen ergeben kein beobachtbares mRBP-Muster auf SDS-PAGE und sollten wahrscheinlich nicht für die weitere Analyse durch Proteomik verwendet werden. In der Tat, mit mehr als 10 7 Zellen ( zB 10 9 inEin umfangreiches Experiment) ist auch möglich 20 . Die Ergebnisse von Silber-Färbe-Assays deuten darauf hin, dass die UV-Bestrahlung für 1 min mit 0,00875 W / cm 2 Intensität, die durch eine kontinuierliche UV-Quelle erzeugt wird, optimal ist ( 1D ). Der hohe Wirkungsgrad bei der kritischen Stufe ( dh mRNP-Pull-Down und -Reinigung durch Oligo-d (T) 25 Perlen, Schritt 4) wird durch die Ergebnisse der RT-qPCR-, Silber-Färbe- und MS-Assays unterstützt ( Abbildung 1C ; 1D und 1E , rechts). Die Kombination von qualitativer und quantitativer Proteomik kann dazu beitragen, die positiven RBPs im Überlappungsbereich zwischen Nicht-CL-Kontrolle und CL-Proben zu identifizieren ( Abbildung 1E ). Die Mehrheit der identifizierten Proteine ​​waren RBPs, die zuvor nicht in Datensätzen kommentiert wurden ( Abbildung 1F ). Wir haben diese bisher unbekannten RNA-bindenden Proteine ​​in der Kategorie III als Kandidaten-RBPs <vorgestelltSup class = "xref"> 50 ( Abbildung 1F ). Die Erforschung der Bindungsspezifitäten dieser Kandidaten-RBPs muss mit anderen Methoden, wie den zuvor erwähnten CLIP-Methoden 23, durchgeführt werden . Ein Beispiel, das die Bindungsspezifität eines RBP untersucht, um sein Ziel-mRNA-Transkript in Arabidopsis durch die Verwendung von CLIP 51 zu regulieren, findet sich in Zhang et al ., 2015. Darüber hinaus ist eine alternative modifizierte Methode von PAR-CLIP, genannt photoaktivierbar- Ribonukleosid-verstärkte Vernetzung (PAR-CL, 365-nm UV-A) wurde bisher auch für die Untersuchung von mRNA-gebundenen Proteomen aus Hefe und menschlichen Zellen 14 , 23 empfohlen. PAR-CL erfordert 4Su, das von Zellen aufgenommen und in naszierende RNAs während des RNA-Metabolismus eingebaut wird und hochreaktiv sein kann und kovalente Bindungen mit Aminosäuren 52 unter UV-A (365 nm) irradi bildetAtion Derzeit gibt es keine Studien, die sich auf die Toxizität von 4sU an die Pflanzenzellen und die effiziente Aufnahme von exogenen 4sU in Mesophyll-Protoplasten konzentrieren 53 . Wir glauben jedoch, dass es möglich ist, sowohl konventionelle CL (254-nm UV-C) als auch PAR-CL (365 nm UV-A) an Pflanzen zu verwenden, die zur Entdeckung und Validierung verschiedener RBPs aus der physiologischen beitragen werden Umwelt in der Zukunft.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgements

Wir bestätigen das Labor von Prof. Joris Winderickx, der die UV-Vernetzungsapparatur mit der konventionellen UV-Lampe ausgestattet hat. KG wird vom KU Leuven Research Fund unterstützt und erkennt die Unterstützung von FWO Grant G065713N an.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics