Поколения родной Chromatin иммунопреципитации секвенирования библиотек для анализа плотности нуклеосома

Genetics
 

Summary

Мы представляем модифицированных родной хроматина иммунопреципитации виртуализации (чип seq) методологии для генерации последовательности наборов данных для нуклеосома плотность чип seq аналитические рамки интеграции доступность Микрококковая Нуклеаза (MNase) с измерения изменения гистона.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Мы представляем модифицированных родной хроматина иммунопреципитации виртуализации (чип seq) экспериментальный протокол совместим с Гаусса смесь на основе анализа методологии распределения (плотность нуклеосома чип seq; ndChIP-seq) который позволяет поколение Комбинированные измерения доступности Микрококковая Нуклеаза (MNase) с гистонов модификации генома широкий. Нуклеосома позиции и локальной плотности и Посттрансляционная модификация их гистона субблоков, действовать согласованно для регулирования местных транскрипции государств. Комбинаторные измерения доступности нуклеосома с гистонов модификации, порожденных ndChIP-seq позволяет одновременное допрос этих функций. NdChIP-seq методология применима к небольшим количеством первичных элементов недоступны для сшивки на основе чипа seq протоколы. Взятые вместе, ndChIP-seq обеспечивает измерение изменения гистона в сочетании с местными нуклеосома плотность получить новое понимание общих механизмов, которые регулируют транскрипции РНК внутри популяций редких главной ячейки.

Introduction

Геном эукариот упаковывается в хроматина через повторение нуклеосома структур, которые состоят из двух копий четырех гистоновых белков (например, H2A, H2B, H3 и H4) ограничивается 146 пар оснований ДНК1,2. Chromatin remodeling комплексы управления нуклеосома позиция в пределах границ промоутера генов и участвуют в регуляции экспрессии генов, изменяя доступность ДНК факторов транскрипции и РНК-полимеразы машины3, 4.

Амино терминала хвосты гистонов в пределах нуклеосома подвергаются различные ковалентных изменений, в том числе ацетилирования, метилирование, фосфорилирование, ubiquitylation, sumoylation, formylation и гидроксилирования конкретных аминокислоты5 , 6 , 7 , 8. позиции и степени эти изменения определяют состояние хроматина, влияние хроматина структуры и контроля доступа молекулярных комплексов, которые позволяют активация транскрипции7. Учитывая, что оба изменения плотности и гистонов нуклеосома играют определенную роль в местные управления транскрипции гена, мы разработали собственный чип подход, который позволяет одновременное измерение плотности нуклеосомой и гистонов модификация9, 10.

Родной чип seq использует нуклеиназы микрококков эндонуклеазы (MNase) переваривать нетронутыми хроматина в его родной состоянии внутри ядра11,12, свойство, которое использовала для сопоставления нуклеосома позиционирования13 , 14 , 15. нуклеосома плотность чип seq (ndChIP-seq) использует свойство преференциального доступа MNase открыть регионов хроматина произвести измерения, которые сочетают доступность MNase с гистонов модификации10. ndChIP-seq подходит для профилирования изменения гистона в редких начальных клеток, тканей и культивируемых клеток. Здесь мы представляем подробный протокол, который позволяет создавать последовательности наборов данных для ранее описанных аналитические рамки работы10 , которая интегрирует фрагмент размер поста иммунопреципитация, определяется в паре конец читать границ, чтобы одновременно Исследуйте MNase доступность с гистонов изменения измерений. Ранее, применение настоящего протокола к 10000 первичной человеческой пуповинной крови производных CD34+ клеток и человеческих эмбриональных стволовых клеток показали уникальные отношения между изменения структуры и гистонов хроматина в рамках этих клеток типы10 . Учитывая его способность одновременно измерять нуклеосома доступность и изменения гистона, ndChIP-seq способен выявить особенности epigenomic в популяции клеток на уровне одного нуклеосома и урегулировании гетерогенных подписей в их составные элементы. Пример исследования гетерогенных клеточных популяций, ndChIP-seq являются расследование двухвалентные промоутеров, где H3K4me3, активный Марк и H3K27me3, репрессивные Марк, настоящий10.

Protocol

Примечание: Минимальный вклад для этого протокола составляет 10 000 ячеек на один иммуно осадков (IP) реакции. Распечатать предоставленного экспериментальной листа и использовать в качестве ориентира для планировать эксперимент. Предполагается, что инкубаций при комнатной температуре на ~ 22 ° C. Все рецепты буфера приведены в таблице 1. Все буферы следует хранить при 4 ° C и хранится на льду во время процедуры, если не указано иное.

1. Подготовка клетки

  1. Культивируемых клеток
    1. Вымыть клетки с 1 мл фосфатный буфер (PBS) и точно определить концентрацию клеток с помощью Горяева. Если существует более одного миллиона клеток, увеличьте объем PBS.
    2. На основе числа клеток, аликвота эквивалент 70 000-100 000 клеток в стерильных 1,5 мл и спин вниз на 500 g x 6 мин при 4 ° C. С помощью пипетки, медленно удалить и удалить супернатант (не нарушая Пелле клеток) и Ресуспензируйте Пелле в ледяной литического буфера + 1 x ингибитор протеазы коктейль (ПОС) к концентрации 1000 ячеек / мкл. Смешайте хорошо закупорить вверх и вниз по 20-30 раз. Важно, что кусты клетки разрушаются. Старайтесь не создавать пузыри.
    3. Перейти непосредственно к день 1 (раздел 2) ndChIP-seq протокола или вспышки заморозить Пелле клеток в жидком азоте и хранить при температуре-80 ° C.
  2. Сортировки клеток
    1. Соберите 70 000-100 000 отсортированных16 клеток в 1,5 мл трубку с 350 мкл Хэнка буфферезированный раствор соли (HBSS), или PBS + 2% плода бычьим сывороточным (ФБС).
    2. Спин вниз каждой ячейки аликвота на 500 g x 6 мин при 4 ° C. С помощью пипетки, медленно удалить супернатант (не нарушая Пелле клеток) и Ресуспензируйте в ледяной литического буфера + 1 x ПОС в конечной концентрации 1000 клеток / мкл. Смешайте хорошо в буфера lysis закупорить вверх и вниз 20 - 30 раз. Убедитесь, что кусты клетки разрушаются. Старайтесь не создавать пузыри.
    3. Перейти непосредственно к день 1 (раздел 2) ndChIP-seq протокола, или вспышки заморозить Пелле клеток в жидком азоте и хранить при температуре-80 ° C.

2. день 1: ndChIP-seq

  1. Подготовка антител шарик комплекса
    1. Подготовьте ванну воды 37 ° C и ведро льда. Работая на льду, подготовить 1 x IP буфер/1 x ПОС и 1 x буфером для разбавления проб антитела (Ab) и держать их на льду. Извлечь протеина A (или G) магнитные бусы (см. обсуждение критериев отбора) от 4 ° C для хранения и смесь очень хорошо, нежный пульс vortexing. Держите его на льду.
      Примечание: Пульс vortexing означает, что vortexing остановлена каждый раз, когда полный водоворот формируется в трубе.
    2. Перевод 24 мкл протеина A (или G) магнитные бусы на IP реакции на новый 2-мл пробирку. Запишите объем бусины и держать трубку на льду. Например, для 7 IPs, использовать мкл 24 x 7 = 168 мкл.
    3. Установите трубку на магните трубки и ждать решение стать четкое разделение указанием шарик. Не нарушая бисер, тщательно удалить супернатант с помощью пипетки и отбросить. Возьмите трубку от трубки магнит и разместить его на льду.
    4. Добавление равным объемом ледяной IP буфера (например, начальный объем бусины) + 1 x смешивать ПОС. Смешайте закупорить вверх и вниз. Сделать не вихря.
    5. Место IP буфера + 1 x PIC + бусы обратно на магнит трубки и ждать решение стать четкое разделение указанием шарик. Не нарушая бисер, тщательно удалить супернатант с помощью пипетки и отбросить. Повторите холодной буфера IP + 1 X ПОС мыть два раза для в общей сложности 3 моет.
    6. После окончательной стирки Ресуспензируйте бусины в равным объемом ледяной IP буфера (например, начальный объем бусины) + 1 x рис смешать. Смешайте закупорить вверх и вниз. Сделать не вихря. Держите трубку на льду.
    7. На льду залейте 10 мл буфера IP + пик в V-образный резервуар 25 мл. С помощью многоканальных дозаторов, добавьте 130 мкл буфера ледяной IP + 1 x ПОС микс в индивидуальные добра чистой V-дно 96-луночных пластины. Заполните один колодец на IP. Этикетке плиты как «Ab шарик комплекс».
    8. Добавить 12 мкл промывают протеина A (или G) магнитные шарики в каждый хорошо содержащие буфер IP + пик и смешивать, закупорить вверх и вниз. Держите оставшиеся промывают бусы на льду.
    9. Получения проверенных антитела от их холодного хранения и оттепели на льду, при необходимости. Работая на льду, разбавьте антитела с буфером для разбавления проб Ab 1 x концентрации, указанные в таблице 2.
    10. Для каждой скважины Ab шарик комплекс пластины 1 мкл целесообразно, разбавленные антитела (Таблица 1). Запись также на антитела ключ. С помощью многоканальных дозаторов, смешайте каждой строки, закупорить вверх и вниз в 20 раз. Изменить советы между строками. Уплотнение пластину сложной Ab шарик очень хорошо с алюминиевой пластине крышкой и инкубировать на 4 ° C на вращающейся платформе для минимум 2 ч.
      Примечание: Этот инкубации можно продолжить до готовности начать шаг 2.4.
  2. Пищеварение лизис и хроматин клеток
    1. Работая на льду, подготовить 1 x буфера lysis + 1 x ПОС и 1 мл MNase я разрежения буфер (Таблица 3) и держать их на льду.
    2. Извлечение клеток гранулы от их хранения-80 ° C (или от льда, если свежеприготовленные). Оттепель Пелле каждой ячейки в ванну воды 37 ° C для 10 s, а затем передать льда.
    3. Для каждой ячейки Пелле немедленно добавьте ледяной 1 x буфера lysis + 1 x пик конечная концентрация 10 000 клеток/20 мкл и микс 10 раз, закупорить вверх и вниз, не создавая пузырьки. Например для 70 000 клеток окончательный объем — 140 мкл.
    4. Работа на льду, аликвота 20 мкл/хорошо результате лизатов в 96-луночных плиту. Крышка с пластиковые пломбы и инкубировать на льду на 20 мин этикетке плиты «MNase пищеварения» и записывать скважин к ключу шаблон. Для того чтобы обеспечить точные сроки реакции пищеварение хроматина, не перейти к пищеварения с более чем 2 строк образцов одновременно.
    5. Просто до 20 мин lysis, разбавить MNase я ферментов с MNase я разрежения буфер, до конечной концентрации 20 U/мкл и держать его на льду.
    6. Работая на льду, подготовить MNase я переваривания мастер смесь согласно таблице 4 и аликвота 20 мкл смеси в каждой строке образцы плюс 5 мкл мертвого объема в одну строку 96-луночных водохранилище плиты и держать его на льду. Для двух строк, объем должен быть: (20 мкл x 2) + 5 мкл = 45 мкл.
    7. После лизатов инкубации, удалите пластину пищеварение MNase от льда. С помощью многоканальных дозаторов, 20 мкл MNase я пищеварение мастер смесь в каждой строке образцов и смешать 10 раз, закупорить вверх и вниз. Изменить советы между строками. Инкубируйте на комнатной температуре ровно 5 мин.
    8. После 5 минут чтобы остановить реакции, использовать многоканальные пипетки для мкл 6 250 мкм Этилендиаминтетрауксусная кислота (ЭДТА) в каждой строке образцов и смешать вверх и вниз несколько раз. Изменить советы между строками. После добавления ЭДТА переключитесь в параметр пипеткой 20 мкл и микс 10 раз, закупорить вверх и вниз для обеспечения полной остановки реакции пищеварение. Изменить советы между строками.
    9. С помощью многоканальных дозаторов, к каждой строке образцов MNase переваривается, мкл 6 10 x буфер lysis и перемешать хорошо, закупорить вверх и вниз по 10 раз. Обложка с пластиковые пломбы и инкубировать на льду за 15 мин.
  3. Ввода разделения и предварительная очистка
    1. После инкубации 15 мин, работающих на льду, бассейн, которую все скважины же ячейки Пелле/шаблон в одну стерильные, предварительно охлажденный на льду, 1,5 мл (предварительно помечены шаблон ID) и смесь тщательно, но медленно с помощью пипетки во избежание вспенивание моющих средств.
    2. Для каждой ячейки Пелле/шаблон Передача 8 мкл переваривается хроматина в новую стерильную, 0,5 мл (предварительно помечены шаблон ID) и хранить при 4 ° C на ночь. Это будет служить в качестве элемента управления вводом.
    3. Распространите оставшиеся объем переваривается хроматина в 48 мкл аликвоты, в новую плиту 96-луночных. Пелле/шаблон ячейки 1 идет в скважины А01-A06, Пелле/шаблон ячейки 2 в скважинах A07-A12 и т.д. Запись скважин к ключу шаблон. Этикетке плиты «Предварительной очистки».
    4. С помощью многоканальных дозаторов, добавьте 120 мкл 1 x буфер IP + 1 x ПОС и 12 мкл промывают протеина A (или G) магнитные бусы в каждой скважине предварительной очистки плиты из шага 2.3.3. Mix каждую строку закупорить вверх и вниз по 10 раз. Изменить советы между строками. Уплотнение пластины очень хорошо с алюминиевой пластине крышкой и инкубировать на вращающейся платформе в 4 ° C для минимум 2 часа.
  4. Реакция иммунопреципитации
    1. Перед началом этого шага убедитесь, что Ab шарик комплекс (шаг 2.1.10) и предварительной очистки крышку (шаг 2.3.4) инкубированы для по крайней мере 2 ч. быстро вращаться обе пластины центрифугированием 10 s на 200 x g.
    2. Установите пластину сложной Ab шарик (из шага 2.1.10) на кухонные плиты и подождать 15 s для решения стало ясно. Осторожно снимите и выбросьте супернатанта, с помощью пипетки не нарушая бисер. Снять пластину из Кухонные плиты и держать его на льду.
    3. Место пластину реакции предварительной очистки (из шага 2.3.4) на кухонные плиты и подождите 15 s для Бусины для разделения и для решения стало ясно. Не нарушая бисер, тщательно передачи супернатанта, с помощью пипетки для соответствующего скважин Ab шарик, комплекс пластины удерживаются на льду и смешайте нежно 15 раз закупорить вверх и вниз. Печать пластину с алюминиевой пластины крышкой и инкубировать ночь (12-18 ч) при температуре 4 ° C на вращающейся платформе. Повторно этикетке плиты «IP реакции».

3. день 2: ndCHIP-seq

  1. Моет и элюции
    1. Установить смеситель Отопление до 65 ° C. На льду Подготовьте буфер низким соли мыть и мыть высоким соли буфера. Быстрый спин IP реакции плиты из шага 2.4.3 для 10 s на 200 x g.
    2. Установите IP реакции плиты на кухонные плиты и подождите 15 s для решения стало ясно. С помощью многоканальных дозаторов, не нарушая бисер, осторожно снимите и выбросьте супернатант. Возьмите тарелку от Плиты кухонные и поместите его на льду.
    3. Для каждой строки образцов в IP реакции плиты добавьте 150 мкл ледяной низким соли мыть буфер и смесь медленно 10 раз вверх и вниз, чтобы полностью Ресуспензируйте бисер.
    4. Место пластину реакции IP обратно на кухонные плиты, ждать бус отделить и с помощью многоканальных дозаторов, не нарушая бисер снимите и выбросьте супернатант. Поместите пластины обратно на льду и повторите шаги 3.1.3 и 3.1.4 для в общей сложности 2 стирок.
    5. На льду к каждой строке образцов в IP реакции плиты, добавьте 150 мкл высокой соли промывочный буфер и смесь медленно 10 раз закупорить вверх и вниз, чтобы полностью Ресуспензируйте бисер.
    6. Место пластину реакции IP обратно на кухонные плиты, ждать бус отделить и с помощью многоканальных дозаторов, не нарушая бисер снимите и выбросьте супернатант. Место пластину реакции IP на льду и предварительно охладите новой пластинкой 96-а рядом с ним.
    7. К каждой строке образцов в IP реакции плиты добавьте 150 мкл высокой соли промывочный буфер и смесь медленно 10 раз закупорить вверх и вниз, чтобы полностью Ресуспензируйте бисер. После взмучивания передачи каждой строки образцов с соответствующей строкой новый, предварительно охлажденный, 96-луночных пластины. Этикетке плиты «IP реакции». Утилизируйте старые плиты.
    8. Поместите новый IP реакции пластину на кухонные плиты и ждать бус для разделения. С помощью многоканальных дозаторов, не нарушая бисер, осторожно снимите и выбросьте супернатант. Держите пластины при комнатной температуре.
    9. К каждой строке образцов в пластину реакции IP 30 мкл чип Элюирующий буфер (EB) и медленно перемешать в 10 раз, закупорить вверх и вниз. Убедитесь в том предотвратить образование пузыря.
    10. Печать пластину с ПЦР крышкой и инкубировать в смесителе Отопление при 65 ° C для 1,5 h с смешивания скорости 1350 об. / мин.
    11. После 1,5 ч инкубации спина вниз IP реакции плиты на 200 x г за 1 мин при 4 ° C. Измените настройку микшера Отопление на 50 ° C.
    12. После отжима место пластину реакции IP на кухонные плиты и ждать решения для очистки. С помощью многоканальных дозаторов, не нарушая бисер, тщательно передачи 30 мкл супернатант в новую плиту 96-луночных. Используйте свежие советы для каждой строки. Этикетке плиты «IP реакции» и держать его при комнатной температуре.
  2. Переваривание белков
    1. Получить 30% PEG/1 M NaCl магнитный шарик17 (буфер состав таблица) решение от 4 ° C холодильник и держать его при комнатной температуре по крайней мере 30 минут критической: Убедитесь, что шарик решение полностью достигнет комнатной температуры перед продолжением.
    2. Извлечения образцов управления вводом от 4 ° C для хранения (шаг 2.3.2) и быстрый спин. Измерить громкость с помощью пипетки и добавьте ультрачистая вода в каждый элемент управления вводом для окончательный объем 30 мкл. передачи управления вводом образцы предварительно выбранных входных скважин (пустой скважины) в IP реакции плиты (шаг 3.1.12). Запись также на примере ключ.
    3. На льду Подготовьте Master переваривания белка Mix, как показано в таблице 5 и аликвота равным объемом в одну строку 96-луночных водохранилище плиты.
    4. С помощью многоканальных дозаторов, к каждой строке образцов в пластину реакции IP 40 мкл Master переваривания белка Mix и смесь медленно 10 раз вверх и вниз. Уплотнение тарелка с крышкой ПЦР, спина вниз на 200 x г за 1 мин и инкубировать в смесителе Отопление при 50 ° C за 30 минут на 650 об/мин. Во время инкубации плита, готовить свежие 70% этанола (EtOH) и держать его при комнатной температуре.
    5. После завершения 30 минут инкубации спина IP реакции плиты на 200 x g за 1 мин., 4 ° C. Держите пластины при комнатной температуре.
      Примечание: Общий объем должен быть сейчас ~ 70 мкл/хорошо.
  3. Шарик очистки с помощью 30% раствора ПЭГ/1 M NaCl магнитный шарик
    1. Аликвота комнатной температуре 30% PEG/1 M NaCl магнитный шарик решения в одну строку резервуар чистой 96-луночных плиты (75 мкл на сэмпл x # строк).
    2. Работа при комнатной температуре, с помощью многоканальных дозаторов, мкл 70 (соотношение 1:1) 30% раствора ПЭГ/1 M NaCl магнитный шарик к каждой строке образцов в пластину реакции IP и смешать 10 раз, закупорить вверх и вниз. Изменить советы между строками. Инкубируйте пластину для 15 мин при комнатной температуре.
    3. Установите пластину на кухонные плиты и инкубировать и 5 минут позволить бусы для разделения.
    4. С помощью пипетки, не нарушая бисер, осторожно снимите и выбросьте супернатант. Храните бусы.
    5. Хотя IP реакции плиты все еще находится на кухонные плиты, используя многоканальные пипетки, к каждой строке образцов, добавить 150 мкл комнатной температуре 70% EtOH и Инкубируйте 30 s. После 30 сек, используя многоканальные пипетки, снимите и выбросьте супернатант. Повторите этот шаг еще раз для в общей сложности 2 стирок.
    6. После второй мыть EtOH Инкубируйте «сухой» пластины на пластину магнит за 3 мин осмотрите пластину, чтобы убедиться, что все EtOH испаряется. Если нет, то инкубации пластину за 1 мин, чрезмерно сушка бусины к снижению урожайности.
    7. Возьмите Плиты кухонные плиты и с помощью многоканальных дозаторов, мкл 35 EB (Таблица материалов). Смешайте хорошо закупорить 10 раз вверх и вниз. Изменить советы между строками. Инкубации при комнатной температуре 3 мин до элюировать.
    8. После инкубации место пластину реакции IP обратно на кухонные плиты и инкубировать в течение 2 мин. Следует отделить бисер и решение станет ясно.
    9. С помощью многоканальных дозаторов, не нарушая бисер, тщательно передачи супернатант в соответствующий скважины новой пластинкой 96-луночных.
    10. Печать пластины с алюминиевой пластине крышкой, ярлык «IPed + ввод ДНК» и хранить при 4 ° C на ночь, или при-20 ° C для долгосрочных (> 48 ч) хранения.

4. день 3: Библиотека строительство

  1. Конец и фосфорилирование
    1. Вход для окончания ремонта/фосфорилирование реакции является IPed + входной плиты из шага 3.3.10. После оттаивания, спина пластину вниз на 200 x г за 1 мин при температуре 4 ° C и держать его на льду.
    2. Получить от-20 ° C морозильник реагентов (за исключением ферментов) необходимых для окончания ремонта/фосфорилирование реакции (Таблица 6) и их разморозить при комнатной температуре, затем немедленно перевести в лед.
    3. Работая на льду, следуйте в таблице 6 , чтобы настроить мастер ремонт/фосфорилирование конце микс в стерильные, пробки microcentrifuge 1,5 мл. После добавления всех компонентов-фермента смесь хорошо, пульс vortexing и поместить трубку обратно на льду.
    4. Получить соответствующие ферменты из их холодного хранения и транспорта на скамейке в прохладном стойку охлажденные трубы. Смешать каждый энзим, стряхивая трубки, быстрое спин и поместить его обратно в прохладном стойку охлажденные трубы. Когда дозирование ферментов, аспирационная медленно, чтобы обеспечить точный объем передачи. После того вымойте кончик в главный микс, закупорить вверх и вниз.
    5. После добавления ферментов, аккуратно пульс вихревой мастер смешать 5 раз заверить равномерное распределение всех компонентов, а затем быстрый спин и немедленно поместить трубку обратно на льду.
    6. На льду, Алиготе соответствующий объем смеси конце мастер ремонт/фосфорилирования в одну строку новой пластинкой 96-луночных водохранилище; объем быть aliquoted: (15 мкл x # строк) + 5 мкл мертвого объема. Пример расчета для двух строк: (15 мкл x 2) + 5 мкл = 35 мкл/хорошо.
    7. С помощью многоканальных дозаторов, 15 мкл конце ремонта/фосфорилирование Мастер микс к каждой строке образцов и смешать 10 раз, закупорить вверх и вниз. Изменить советы между строками. Уплотнение пластину с пластиковой крышкой, спина вниз на 200 x г за 1 мин при температуре 4 ° C и инкубации при комнатной температуре за 30 мин.
  2. Шарик очистки после окончания ремонта и фосфорилирование
    1. От 4 ° C холодильник получать 20% раствора ПЭГ/1 M NaCl магнитный шарик и 30% раствора ПЭГ/1 M NaCl и инкубации при комнатной температуре по крайней мере 30 минут.
      Примечание: 30% раствора ПЭГ/1 M NaCl не содержат магнитные бусы.
    2. После того, как оба решения достичь комнатной температуры, для каждого образца подготовка 80 мкл смесь 1:2 30% PEG/1 M NaCl и 20% PEG/1 M NaCl магнитный шарик решений. Пример для 24 пробы: 80 мкл x 24 = 1920 мкл (640 мкл 30% PEG/1 M NaCl и 1288 мкл 20% PEG/1 M NaCl магнитный шарик решений).
    3. Аликвота шарик решение смешать, равный объем, в одну строку 96-луночных водохранилище плиты и держать его при комнатной температуре. Аликвота EB буфера (40 мкл на сэмпл x # строк) в одну строку резервуар чистой 96-луночных плиты. Пример для двух строк: 40 мкл x 2 = 80 мкл/хорошо.
    4. С помощью многоканальных дозаторов, добавьте 75 мкл шарик смеси подготовлен в шаг 4.2.2 в каждой строке образцов из шага 4.1.7 и смешать вверх и вниз по 10 раз. Изменить советы между строками. Инкубации при комнатной температуре 15 мин продолжить процедуру очистки шарик, изложенные в 3.3.3-3.3.10 шаги. Крышка с пластиковых печать, быстрое спин и поместите его на льду. Перейдите к шагу 4.3.
  3. A-хвостохранилища реакция
    1. Извлечение из морозильной камеры-20 ° C, все реагентов (за исключением ферментов) необходимые для A-хвостохранилища реакции (Таблица 7), их разморозить при комнатной температуре, а затем немедленно перевести в лед.
    2. Работая на льду, следуйте в таблице 7 , чтобы настроить Мастер микс A-хвостохранилища в стерильные, пробки microcentrifuge 1,5 мл. Следуйте инструкциям установки общей ферментативной варить, как указано в 4.1.4-4.1.6 шаги.
    3. С помощью многоканальных дозаторов, 15 мкл Mix Master A-хвостохранилищ для каждой строки образцов и смешать 10 раз, закупорить вверх и вниз. Изменить советы между строками. Уплотнение тарелка с крышкой ПЦР, спина вниз на 200 x г за 1 мин при температуре 4 ° C и инкубировать в Термоциклер при 37 ° C за 30 мин. После инкубации спина пластину вниз на 200 x г за 1 мин и держать его при комнатной температуре.
  4. Шарик очистки после A-хвостохранилища
    1. Выполните шаги, описанные в шаге 4.2. Крышка с пластиковые пломбы, лейбл «A-хвост + БК», быстрое спин и поместите его на льду. Перейдите к шагу 4.5.
  5. Перешнуровка переходник
    1. Извлечение из морозильной камеры-20 ° C, все реагентов (за исключением ферментов) необходимые для реакции перешнуровки адаптер (Таблица 8), их разморозить при комнатной температуре, а затем немедленно перевести в лед.
    2. Получить 10 мкм PE адаптер (Справочная таблица 1) Стоковый раствор и разбавляют до 0,5 мкм, с помощью EB. Смешайте хорошо пульс vortexing. Объем необходимых-3 мкл x # образцов. Работа на льду, аликвота 0,5 мкм PE адаптер, равный объем, в 12 скважин резервуар чистой 96-луночных плиты. Держите его на льду.
    3. Работая на льду, следуйте в таблице 8 для настройки адаптера лигирование Мастер микс в стерильные, пробки microcentrifuge 1,5 мл. Следуйте инструкциям установки общей ферментативной варить, как указано в 4.1.4-4.1.6 шаги. Убедитесь, что 5 X Быстрая перешнуровка буфер полностью талой и очень хорошо смешанных перед использованием.
    4. На льду, Алиготе соответствующий объем адаптер лигирование Мастер микс в одну строку новой пластинкой 96-луночных водохранилище. Например, расчет для двух строк: (23 мкл x 2) + 5 мкл = 51 мкл/хорошо. Держите пластины на льду.
    5. С помощью многоканальных дозаторов, 2 мкл 0,5 мкм адаптер паре конец (PE) в каждой строке образцов из шага 4.4.1 и перемешать. Изменить советы между строками.
    6. С помощью многоканальных дозаторов, 23 мкл адаптер лигирование Мастер микс к каждой строке образцов и смешать 15 раз, закупорить вверх и вниз. Изменить советы между строками. Печать пластины с металлической крышкой, ярлык «Лигирование», спин вниз на 200 x г за 1 мин при температуре 4 ° C и инкубировать на ночь при комнатной температуре.
  6. День 4: Шарик очистки #1 после перевязки адаптер
    1. От 4 ° C холодильник получать 20% раствора ПЭГ/1 M NaCl магнитный шарик и инкубации при комнатной температуре по крайней мере 30 минут. В то время как equilibrating решение готовить свежие 70% EtOH.
    2. Алиготе 20% раствора ПЭГ/1 M NaCl магнитный шарик, 55 мкл на сэмпл, в одну строку 96-луночных водохранилища пластины и держать его при комнатной температуре. Пример для двух строк: 55 мкл x 2 = 110 мкл/хорошо.
    3. Аликвота EB буфер, 50 мкл на сэмпл, в одну строку резервуар чистой 96-луночных плиты. Пример для двух строк: 50 мкл x 2 = 100 мкл/хорошо.
    4. С помощью многоканальных дозаторов, мкл 48 20% раствора ПЭГ/1 M NaCl магнитный шарик в каждой строке образцов в пластину перевязка из шага 4.5.6 и смешать вверх и вниз по 10 раз. Изменить советы между строками. Инкубации при комнатной температуре 15 мин продолжить процедуру очистки шарик, изложенные в 3.3.3-3.3.7 шаги.
    5. Возьмите Плиты кухонные плиты и с помощью многоканальных дозаторов, мкл 45 EB (Таблица материалов). Смешайте хорошо закупорить 10 раз вверх и вниз. Изменить советы между строками. Инкубируйте при комнатной температуре 3 мин до элюировать.
    6. После инкубации место пластину реакции IP обратно на кухонные плиты и проинкубируйте 2 мин, с использованием многоканальные пипетки, не нарушая бусы, тщательно передачи супернатант в соответствующий скважины новой 96-луночных пластины. Этикетке плиты «Лигирование + 1 BC».
    7. В каждой скважине 5 мкл 10 x PCR высокой верности буфера и смешайте хорошо закупорить вверх и вниз. Изменить советы между строками. Крышка с пластиковых печать, быстрое спин и держать его при комнатной температуре.
  7. Шарик очистки #2 после перевязки адаптер
    1. Выполните очистку шарик, как описано в разделе 4.6 со следующими изменениями: 60 мкл раствора 20% PEG/1 M NaCl магнитный шарик для каждой активной скважины лигирование + 1 до н.э. плита (шаг 4.6.7) и элюировать из бисера с использованием 35 мкл буфера EB. Ярлык пластину «Лигирование + 2 БК» и держать его на льду.
  8. Амплификации PCR
    1. Извлечение из морозильной камеры-20 ° C все реагенты (за исключением ферментов), необходимых для реакции PCR (Таблица 9), их разморозить при комнатной температуре, а затем немедленно поместить их на льду.
    2. Работая на льду, следуют таблицы 9 , чтобы настроить мастер ПЦР микс в стерильные, пробки microcentrifuge 1,5 мл. Следуйте инструкциям настройки общих варево, изложенные в 4.1.4-4.1.5 шаги. На льду, Алиготе соответствующий объем смеси ПЦР мастер в одну строку новой пластинкой 96-луночных водохранилище. Держите его на льду. Смотрите Шаг 4.5.4 для выборки расчетов.
    3. Работа на льду, с помощью многоканальных дозаторов, 2 мкл каждого уникального 12,5 мкм ПЦР обратный индексации грунтовка (Справочная таблица 2) в каждую лунку в перевязки + 2 до н.э. плита (шаг 4.7.1) и смесь медленно вверх и вниз. Изменить советы между строками. Держите пластины на льду.
    4. Рабочие на льду, с помощью многоканальных дозаторов, мкл 23 мастер смесь ПЦР в каждой строке образцов из шага 4.8.3 и микс 10 раз, закупорить вверх и вниз. Уплотнение тарелка с крышкой ПЦР, спина его вниз на 200 x г за 1 мин и инкубировать в Термоциклер (см. таблицу 10 для велосипедного условия PCR).
  9. Шарик очистки после амплификации PCR
    1. После амплификации PCR спина пластину на 200 x g за 1 мин., 4 ° C. Выполните очистку шарик, как описано в разделе 4.6 со следующими изменениями: 51 мкл раствора ПЭГ/1 M NaCl магнитный шарик 20% для каждой реакции PCR и элюировать из бисера с использованием 25 мкл буфера EB. Уплотнение пластины с алюминиевой крышкой и спина вниз на 200 x g 1 мин хранилища образцов при-20 ° C.
    2. Для проверки построены библиотек, выполняют количественного определения ДНК с помощью анализа на основе флуоресценции, визуализировать конечный продукт, с помощью анализатора чиповых капиллярного электрофореза (высокая чувствительность анализа) и запустить обогащения количественного PCR (ПЦР) (см. Представитель результаты, проверка качества библиотека ndChIP-seq, ПЦР).

Representative Results

Хроматин пищеварение профили
Оптимизация MNase пищеварения имеет важное значение для успеха этого протокола. Важно создать профиль пищеварение, доминирует один нуклеосома фрагмент размеров, в то время как не чрезмерно переваривается, для восстановления высшего порядка нуклеосома фрагментов. Идеальное пищеварение профиль состоит из большинства одного нуклеосома фрагментов с небольшой долей представляющих фрагменты меньше и больше чем одного нуклеосом. Рисунок 1 показывает примеры профилей распределения идеально, чрезмерно перевариваются и усваиваются под размер. Обратите внимание, что оптимальными пищеварение хроматина также будет очевидным в профиль последовательности библиотеки, созданные из IP материала (рис. 2).

Проверка качества библиотека ndChIP-seq, ПЦР
ПЦР является устоявшейся метод для оценки качества чип18,19,20. При выполнении ndChIP-seq на 10 000 клеток доходность нуклеиновой кислоты после IP будет ниже 1 нг. Таким образом важно выполнять ПЦР после строительства библиотеки для оценки относительной обогащения целевых регионов на фоне. Дать оценку фон, создаются библиотеки построены из MNase переваривается хроматина (вход). Для каждой библиотеки, IP два комплекта грунтовки необходимо (см.Таблица 3 дополнительныйсписок праймеров для часто используемых гистона знаков). Один набор грунт следует конкретно для геномной региона, который неизменно связан с изменения гистона интереса (положительные цели) и другой регион, который не помечен с гистонов модификации интереса (отрицательные цель). Качество чип seq библиотеки будет оцениваться как складывать обогащения относительно входной библиотеки. Сгиб обогащения могут быть рассчитаны с помощью следующего уравнения, что предполагает экспоненциальное амплификацию геномных целевого региона: 2Ctввода-CtIP. Наш обычай сделал R статистического программного пакета, qcQpcr_v1.2, подходит для анализа ПЦР обогащения низкого входного родной чип seq библиотек (Дополнительные файлы кода). Рисунок 3 представляет результат ПЦР для успешных и неуспешных чип seq библиотек. Значение обогащения минимальные ожидаемые раз для хорошего качества ndChIP-seq библиотек являются 16 для узких знаков, таких как H3K4me3 и 7 для широкого знаков, например H3K27me3.

Моделирование MNase доступность
Вычислительный анализ чип seq является сложным и уникальным для каждой экспериментальной установки. Набор руководящих принципов, установленных международным консорциумом человеческого Epigenomic (IHEC) и Энциклопедия элементов ДНК (кодирования) может использоваться для оценки качества чип seq библиотек21. Важно отметить, что глубина последовательности библиотек влияет на обнаружение и разрешение обогащенного регионах20. Количество вершин обнаружено увеличение и подходы плато как прочитано глубина увеличивается. Мы рекомендуем ndChIP-seq библиотек для виртуализации в соответствии с рекомендациями IHEC 50 миллионов в паре-гласит (25 миллионов фрагменты) для узких знаков (например, H3K4me3) и 100 миллионов в паре читает (50 миллионов фрагменты) для широкие знаки ( например, H3K27me3) и22. Эти последовательности глубины обеспечивают достаточную выравниваний последовательности для обнаружения самых значительных вершин, используя широко используется чип seq пик абонентов, таких как MACS2 и Гомер, не доходя до насыщения23,24. Высокое качество млекопитающих ndChIP-seq библиотека имеет повторяющиеся скорость ПЦР < справочник и 10% генома выравнивание скорость > 90% (в том числе дублируется прочтений). Успешной ndChIP-seq библиотек будет содержать высокой корреляцией реплицирует с значительная часть (> 40%) соответствие читает внутри MACS222 определены обогащенный пиков и инспекции унифицированных читает генома браузер должен выявить визуально Обнаруживаемая сосредоточения, по сравнению с входной библиотеки (рис. 4). Кроме того, ndChIP-seq может использоваться для оценки плотности нуклеосома, используя алгоритм распределения Гаусса смесь (w1 * n(x; Μ 1,1σ) + w2 * n(x; μ2, σ2) = 1) на MACS2 отнесены обогащенного регионов модель нуклеосома плотности доступны границами MNase. В этой модели w1 представляет моно нуклеосома распределение веса и w2 представляет ди нуклеосома распределения веса. Где w1 больше, чем w2, есть преобладание моно нуклеосома фрагментов и наоборот. Такой анализ требует, что библиотеки виртуализации в паре конец моды так, что могут быть определены размеры фрагмента. Чтобы применить алгоритм распределения Гаусса смесь, впервые выявлены статистически значимые обогащенного районы. Мы предлагаем пик призвание с MACS2 с помощью ввода как элемент управления и с параметрами по умолчанию для узких знаков и q значение отсечки 0.01 для широкого знаков. Количество статистических пакетов, используя алгоритм распределения Гаусса смеси доступны из широко используемых статистических пакетов. Используя фрагмент средний размер, чтения границами в паре конец IPed образцов, дистрибутивы на MACS2 определены обогащенного промоутеров, и алгоритм распределения Гаусса смесь может быть применен к каждой промоутер с использованием R-Статистический пакет Mclust версии 3.025 для вычисления взвешенного распределения. В этом приложении мы рекомендуем, устраняя промоутеров, содержащих менее 30 унифицированных фрагменты, потому что ниже этого порога итоговый вес оценки становятся ненадежными. Библиотека ndChIP-seq хорошего качества создает распределение Гаусса смесь, состоят из двух основных компонентов с средние значения, соответствующие моно-, ди нуклеосома фрагмент длины.

Figure 1
Рисунок 1 : Оценка MNase пищеварения до библиотеки поколения. Чип основе капиллярного электрофореза анализатор профилей оптимального MNase переваривается (A), под переваривается (B) и чрезмерно переваривается (C) хроматина. Биологическая реплицирует показываются как синий, красный и зеленый следы. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Оценка MNase пищеварения после библиотека поколения. (A) должность библиотека строительные профили оптимально усваивается ввода (биологических реплицирует; красный, зеленый, черный) и IP (биологических реплицирует; голубой, фиолетовый, синий) и (B) субоптимальных ввода (биологические реплицирует; красный, зеленый, синий) и IP ( Биологическая реплицирует; голубой, фиолетовый, оранжевый) библиотеки. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Пост библиотеки строительных количественного PCR может использоваться для оценки качества ndChIP-seq библиотек. Фолд обогащения H3K4me3 IP библиотек в отношении ввода библиотеки рассчитывается как 2(Ct ввода - Ct IP) для положительных и отрицательных показателей, с помощью qcQpcr_v1.2. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 : Библиотека представитель ndChIP-seq, построенных из 10,000 первичных CD34+ пуповинной крови клеток. Корреляции Пирсона H3K4me3 сигнала (читает за миллион сопоставленных прочтений) рассчитывается в промоутеров (TSS + / 2 КБ) между 3 биологических реплицирует, репликацию (A) 1 и 2, (B) реплицировать 1 и 3, (C) повторяют 2 и 3. (D) UCSC представление браузера HOXA гена блока сшитого чип seq генерируется из 1 миллион клеток в IP, успешно ndChIP-seq от 10 000 ячеек на IP и неудачной ndChIP-seq от 10 000 ячеек на IP. (красный: H3K27me3, зеленый: H3K4me3 и черный: ввод). (E) часть сопоставленных читает внутри MACS2 определили обогащенного регионы H3K4me3 (черный) и H3K27me3 (серый). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Состав буфера
A.1. буфера иммунопреципитации (IP)
20 мм трис-HCl рН 7,5
2 мм ЭДТА
150 мм NaCl
0,1% тритон X-100
0,1% Дезоксихолат
10 мм натрия бутират
A.2. низкая соль мыть буфера
20 мм трис-HCl рН 8,0
2 мм ЭДТА
150 мм NaCl
1% X-100 Тритон
0,1% SDS
A.3. Высокая соли мыть буфера
20 мм трис-HCl рН 8,0
2 мм ЭДТА
500 мм NaCl
1% X-100 Тритон
0,1% SDS
A.4. чип Элюирующий буфер
100 мм NaHCO3
1% SDS
A.5. 1 x буфера Lysis-1 мл
0,1% тритон
0,1% Дезоксихолат
10 мм натрия бутират
A.6. буфером для разбавления проб Ab
0,05% (w/v) азид
0,05% широкий спектр антимикробной (например Clin 300)
в PBS
A.7. 30% раствор магнитный шарик PEG / 1M NaCl (ссылка16)
30% КОЛЫШЕК
1 M NaCl
10 мм Tris-HCl рН 7,5
1 мм ЭДТА
1 мл раствора промывают супер-парамагнитный бусины
A.8. 20% раствор магнитный шарик PEG / 1M NaCl (ссылка16)
30% КОЛЫШЕК
1 M NaCl
10 мм Tris-HCl рН 7,5
1 мм ЭДТА
1 мл раствора промывают супер-парамагнитный бусины

Таблица 1: ndChIP-seq буфера композиция.

Изменения гистона Концентрация (мкг/мкл)
H3K4me3 0.125
H3K4me1 0.25
H3K27me3 0.125
H3K9me3 0.125
H3K36me3 0.125
H3K27ac 0.125

Таблица 2: Антитела сумма, необходимая для ndChIP-seq.

Reganet Объем (мкл)
Ультра чистая вода 478
1 М трис-HCl рН 7,5 10
0.5 М ЭДТА 10
5 М NaCl 2
Глицерин 500
Общий объем 1,000

Таблица 3: Рецепт для MNase буфером для разбавления проб.

Реагент Объем (мкл)
Ультра чистая вода 13
20 мм DTT 1
10 x буфер MNase 4
20 Mnase U/мкл 2
Общий объем 20

Таблица 4: Рецепт для MNase Мастер микс.

Реагент Объем (мкл)
Элюирующий буфер 30
Буфер G2 8
Протеазы 2
Общий объем 40

Таблица 5: Рецепт для мастер очистки ДНК микс.

Реагент Объем (мкл)
Ультра чистая вода 3.3
10 x буфер эндонуклеазы ограничения (например NEBuffer) 5
25 мм СПС 2
дНТФ 10 мм 2
T4 Polynucleotide киназы (10 U/мкл) 1
T4 ДНК-полимеразы (3 U/мкл) 1.5
ДНК-полимераза I, большой (фрагменты) фрагмент (5 U/мкл) 0.2
Общий объем 15

Таблица 6: Рецепт для окончания ремонта Мастер микс.

Реагент Объем (мкл)
Ультра чистая вода 8
10 x буфер эндонуклеазы ограничения (например NEBuffer) 5
10 мм dATP 1
Фрагменты (3' - 5' exo-) 1
Общий объем 15

Таблица 7: Рецепт для A-хвостохранилища Мастер микс.

Реагент Объем (мкл)
Ультра чистая вода 4.3
5 x Быстрая перешнуровка буфера 12
T4 ДНК лигаза (2000 U/мкл) 6.7
Общий объем 23

Таблица 8: Рецепт для адаптера лигирование Мастер микс.

Реагент Объем (мкл)
Ультра чистая вода 7
25 мкм PCR праймер 1.0 2
5 x ВЧ буфера 12
ДМСО 1.5
ДНК-полимераза 0.5
Общий объем 23

Таблица 9: Рецепт для ПЦР Мастер микс.

Temprature (° C) Продолжительность (s) Количество циклов
98 60 1
98 30
65 15 10
72 15
72 300 1
4 удерживайте удерживайте

Таблица 10: PCR выполнен метод.

Oligo Последовательность Модификация
PE_adapter 1 5'-/ 5Phos/GAT КЭУ AAG СМЖЛ GGT TCA ГЦА GGA ГПТ CCG АГ -3 ' 5' модификации: фосфорилирование
PE_adapter 2 5' - ACA КТК TTT КХЦ TAC ACG ACG КТК TTC CGA ТК * T - 3' 3' модификации: * T представляет собой связь фосфоротиоат

Справочная таблица 1: Oligo последовательности для генерации PE адаптера.

Грунтовка имя Последовательность Индекс IndexRevC (которые будут использоваться для секвенирования)
Обратный индексации праймера PCR 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
Обратный индексации праймера PCR 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
Обратный индексации праймера PCR 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
Обратный индексации праймера PCR 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
Обратный индексации праймера PCR 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
Обратный индексации праймера PCR 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
Обратный индексации праймера PCR 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
Обратный индексации праймера PCR 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
Обратный индексации праймера PCR 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
Обратный индексации праймера PCR 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
Обратный индексации праймера PCR 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
Обратный индексации праймера PCR 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
Обратный индексации праймера PCR 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
Обратный индексации праймера PCR 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
Обратный индексации праймера PCR 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
Обратный индексации праймера PCR 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
Обратный индексации праймера PCR 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
Обратный индексации праймера PCR 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
Обратный индексации праймера PCR 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
Обратный индексации праймера PCR 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
Обратный индексации праймера PCR 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
Обратный индексации праймера PCR 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
Обратное PCR индексации грунт 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
Обратный индексации праймера PCR 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Справочная таблица 2: ПЦР обратный индексации последовательностей праймера.

Праймеры Последовательность
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Изменения гистона Позитивные цели Отрицательный целевой
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Справочная таблица 3: Список Праймеры для часто используемых гистона знаки (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 и H3K36me3).

Дополнительные 1 файл: ndChIP-seq листа. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Дополнительные файлы кода: qcQpcr_v1.2. R статистических программный пакет для анализа ПЦР обогащения низкого входного родной чип seq библиотек. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Discussion

Учитывая комбинаторной природы chromatin изменения и нуклеосома позиционирования в регуляцию, метод, который позволяет одновременное измерение этих функций может обеспечить новое понимание эпигеномные регулирования. NdChIP-seq представленные здесь — это родной чип seq протокол оптимизирован для включения одновременного допроса изменения гистона и нуклеосома плотности в редких Главные ячейки9,10. ndChIP-seq использует ферментативного пищеварения хроматина, соединяно к паре конец массивно параллельной последовательности и модель распределения Гаусса смесь, позволяет для изменения гистона расследования на уровне одного нуклеосомой и Деконволюция epigenomic профилей, движимый неоднородности населения. Используя этот протокол, мы уже ранее сообщали уникальный распределения размеров иммуно осаждают фрагмент, определяется в паре конец читать границ, связанные с конкретными хроматина государств определяется ChromHMM10,24.

Качество ndChIP-seq библиотеки зависит от нескольких факторов, таких как специфичность антитела и чувствительность, оптимальные условия MNase пищеварение и качество хроматина. Специфичность Антитела, которые используются имеет решающее значение в производстве успешной ndChIP-seq библиотеки. Антитело идеально показывает высокое сродство против epitope интерес с мало перекрестной реактивности с другие epitopes. Не менее важно выбрать магнитные бусы с высоким сродством для антитела выбора.

MNase пищеварение является критической и чувствительных к времени и концентрации реакции в этом протоколе. Таким образом, при обработке нескольких образцов, важно, что каждый реакции инкубированы для эквивалентное количество времени (см. шаг 2.2). Качество хроматина является еще одним фактором, который существенно влияние итоги ndChIP след разобщенном хроматина приводит к югу оптимальный профиль MNase пищеварение и результаты в библиотеках с низким соотношение сигнал-шум. Первичные пробы с низкой жизнеспособности клеток или деградации хроматина, такие как формалин Исправлена парафин врезанных тканей (FFPE) не рекомендуются для этого протокола.

Добавление ПОС во время извлечения хроматина уменьшает нежелательные (то есть, случайные) хроматина фрагментации и сохраняет целостность гистона хвосты. Таким образом пик необходимо добавить буфера lysis и буфера иммунопреципитации просто предварительного использования. В то время как при выборе клетки через проточной цитометрии, выберите для жизнеспособных клеток и обеспечить клетки сортируются на низкий расход потока для повышения точности оценки номер ячейки и жизнеспособность клеток. Избегайте сортировки непосредственно в буфер lysis клетки. Буфер оболочка будет разбавить литического буфера и препятствует эффективной permeabilization клеточной мембраны к MNase. В зависимости от типа клетки или организма титрование MNase может потребоваться для получения оптимального пищеварения.

ndChIP-seq на клетки млекопитающих требует минимального последовательности глубины 50 миллионов в паре читает (25 миллионов фрагменты) для узких знаки и 100 миллионов в паре читает (50 миллионов фрагменты) для широкие знаки и ввод. Алгоритм распределения Гаусса смесь не будет оптимально выполнять библиотек, которые были упорядочены на глубину значительно ниже этой рекомендации. ndChIP-seq не будет классифицировать промоутеров с мало разделения между значение взвешенного распределения для моно - и ди нуклеосома фрагмент длиной в моно - или ди нуклеосома доминировали промоутеров. Таким образом эти промоутеров должны быть удалены в ходе последующего анализа. Биологическая реплицирует могут быть сгенерированы для увеличить уверенность в предсказал дистрибутивов и выявления технических изменчивость в MNase конструкции пищеварение и библиотека.

В отличие от предыдущих итерациях родной чип seq протоколов ndChIP-seq обеспечивает средства для расследования комбинаторные эффект изменения структуры и гистонов хроматина, используя фрагмент размер поста иммунопреципитации интегрировать нуклеосома плотности, определяется MNase доступность, с гистонов изменения измерений. Применение ndChIP-seq первичной клетки и ткани будет роман уяснения интегративный характер эпигеномные регулирования и идентификации эпигеномные подписей из-за неоднородности населения.

Disclosures

Авторы заявляют, что они не имеют никаких финансовых интересов.

Acknowledgements

А.л. была поддержана канадских выпускников стипендию от канадской институтов медицинских исследований. Эта работа была поддержана грантов из генома Британской Колумбии и Канады институтов медицинских исследований (КНИИЗ-120589) в рамках канадской эпигенетики, окружающей среды и здравоохранения исследовательский консорциум инициативы и программы Института исследований Терри Фокс Проект Грант #TFF-122869 м.х. и Терри Фокс научно-исследовательский институт новый следователь Award (Грант № 1039) для м.х.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics