Erzeugung von nativen Chromatin Immunopräzipitation Sequenzierung Bibliotheken für Nukleosom Dichteanalyse

Genetics
 

Summary

Wir präsentieren eine modifizierte native Chromatin Immunopräzipitation Sequenzierung (ChIP-Seq) Methodik für die Generation der Sequenz Datasets geeignet für ein Nukleosom Dichte ChIP-Seq analytischer Rahmen micrococcal Nuklease (MNase) Zugänglichkeit zu integrieren mit Histon Modifikation Messungen.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Wir präsentieren eine modifizierte native Chromatin Immunopräzipitation Sequenzierung (ChIP-Seq) experimentelles Protokoll kompatibel mit einer Gaußschen Mischung basierende Distribution Analysemethodik (Nukleosom Dichte ChIP-Seq; NdChIP-Seq), die es die Generierung von ermöglicht kombinierte Messungen der micrococcal Nuklease (MNase) Barrierefreiheit mit Histon-Modifikationen genomweite. Nukleosom Position und lokale Dichte und die posttranslationale Modifikation ihrer Histon-Untereinheiten handeln, lokale Transkription Staaten zu regulieren. Kombinatorische Messungen der Nukleosom Zugänglichkeit mit Histon Änderungen erzeugt durch NdChIP-Seq ermöglicht die gleichzeitige Befragung dieser Funktionen. Die NdChIP-Seq-Methodik ist anwendbar auf geringe Mengen von Primärzellen für Vernetzung nach ChIP-Seq-Protokolle nicht zugänglich. Zusammengenommen, ermöglicht NdChIP-Seq die Messung von Histon-Modifikation in Kombination mit lokalen Nukleosom Dichte, neue Einblicke in die gemeinsame Mechanismen zu erhalten, die RNA-Transkription in seltenen primären Zellpopulationen zu regulieren.

Introduction

Die eukaryotische Genom ist verpackt in Chromatin über Wiederholung Nukleosom-Strukturen, die aus zwei Kopien der vier Histonproteine (z.B.H2A, H2B, H3 und H4) umschrieben von 146 Basenpaare der DNA-1,2bestehen. Chromatin umgestaltet komplexe Nukleosom Position innerhalb gen Veranstalter Grenzen kontrollieren und Teilnahme an der Regulation der Genexpression durch Veränderung der Zugänglichkeit der DNA um Transkriptionsfaktoren und die RNA-Polymerase Maschinen3, 4.

Amino terminal Enden der Histone innerhalb der Nukleosom unterliegen verschiedenen kovalente Modifikationen, einschließlich der Acetylierung, Methylierung, Phosphorylierung, Ubiquitylation, Sumoylierung, Formylation und Hydroxylierung von bestimmten Aminosäuren5 , 6 , 7 , 8. Positionen und Grad dieser Modifikationen diktieren einen Chromatin-Staat, der Chromatin Struktur und Kontrolle Zugang der molekularen komplexe beeinflussen, die Aktivierung der Transkription7ermöglichen. Angesichts der Tatsache, dass beide Nukleosom-Dichte und Histon-Modifikationen spielen eine Rolle in der lokalen Kontrolle der Gentranskription, entwickelten wir einen nativen ChIP-Ansatz, der es die gleichzeitige Messung von Nukleosom Dichte und Histon Änderung9ermöglicht, 10.

Native ChIP-Seq nutzt die Endonuklease Micrococci Nuklease (MNase) intakt Chromatin in seiner nativen Zustand bis zum Kern11,12, eine Eigenschaft zu verdauen, die genutzt wurden, um Nukleosom Positionierung13 Karte , 14 , 15. Nukleosom Dichte ChIP-Seq (NdChIP-Seq) nutzt die Eigenschaft des präferenziellen Zugang von MNase öffnen Regionen des Chromatins Messungen zu generieren, die MNase Zugänglichkeit mit Histon Änderung10zu kombinieren. NdChIP-Seq eignet sich für die Profilierung der Histon-Modifikationen in seltene primäre Zellen, Geweben und kultivierten Zellen. Hier präsentieren wir Ihnen ein detailliertes Protokoll, das die Generation der Sequenz Datasets geeignet für eine zuvor beschriebenen analytischen Rahmen arbeiten10 , das Fragment Größe Post Immunopräzipitation ermöglicht, bestimmt durch gepaart-End Grenzen, um zu lesen integriert untersuchen Sie gleichzeitig MNase Zugänglichkeit mit Histon Modifikation Messungen. Früher Anwendung dieses Protokolls auf 10.000 primären menschlichen Nabelschnurblut abgeleitet CD34+ Zellen und menschliche embryonale Stammzellen offenbart einzigartige Beziehungen zwischen Chromatin Struktur und Histon Änderungen innerhalb dieser Zelltypen10 . Aufgrund ihrer Fähigkeit, simultane Messung von Nukleosom Zugänglichkeit und Histon-Modifikation, NdChIP-Seq ist in der Lage ist, enthüllt epigenomischen Funktionen in einer Zellpopulation auf einem einzigen Nukleosom-Niveau, und Lösung von heterogenen Signaturen in ihre Tatbestandsmerkmale. Ein Beispiel für die Erforschung der heterogenen zellularen Bevölkerungen durch NdChIP-Seq ist Untersuchung der bivalenten Promotoren, wo sind H3K4me3, eine aktive Mark, und H3K27me3, eine repressive Mark vorhanden10.

Protocol

Hinweis: Die minimalen Aufwand für dieses Protokoll ist 10.000 Zellen pro einzelne Immuno-Niederschlag (IP) Reaktion. Das mitgelieferte experimentelle Arbeitsblatt ausdrucken und als Richtlinie zu planen, das Experiment zu nutzen. Inkubationen bei Raumtemperatur werden als angenommen bei ~ 22 ° C. Alle Puffer Rezepte sind in Tabelle 1enthalten. Alle die Puffer sollten bei 4 ° C gelagert und hielt auf dem Eis während des Verfahrens, sofern nicht anders angegeben.

1. Zelle-Vorbereitung

  1. Kultivierten Zellen
    1. Waschen Sie die Zellen mit 1 mL der Phosphat-Puffer Kochsalzlösung (PBS) und bestimmen Sie die Zellkonzentration mit einer Hemocytometer genau zu. Wenn mehr als 1 Million Zellen vorhanden sind, erhöhen Sie die Lautstärke von PBS.
    2. Basierend auf die Zellzahl, aliquoten ein Äquivalent von 70.000-100.000 Zellen in einen sterilen 1,5 mL-Tube und Spin-down bei 500 X g für 6 min bei 4 ° C. Mit einer Pipette, langsam entfernen und entsorgen den überstand (ohne zu stören die Zelle Pellet) und erneut das Pellet in eiskalten Lyse Puffer + 1 x Proteaseinhibitor cocktail (Bild) zu einer Konzentration von 1.000 Zellen / µL. Mischen Sie gut durch pipettieren und ab 20-30 Zeiten. Es ist wichtig, dass die Zelle Klumpen gestört werden. Versuche nicht zu blasen.
    3. Gehen Sie direkt zu Tag1 (Abschnitt 2) von der NdChIP-Seq-Protokoll oder Blitz Einfrieren der Zelle Pellet in flüssigem Stickstoff und Store bei-80 ° C.
  2. Sortierten Zellen
    1. 70.000-100.000 sortiert16 Zellen in einem 1,5 mL-Tube mit 350 µL Hank es gepufferte Salzlösung (HBSS) oder PBS + 2 % fetalen bovine Serum (FBS) sammeln.
    2. Spin-down jede Zelle aliquoten 500 X g für 6 min bei 4 ° C. Mit einer Pipette, langsam entfernen den überstand (ohne zu stören die Zelle Pellet) und Aufschwemmen im eiskalten Lyse Puffer + 1 x Bild, um eine Endkonzentration von 1.000 Zellen / µL. Mix gut in Lyse Puffer von oben und unten Pipettieren 20 - 30 Mal. Stellen Sie sicher, dass die Zelle Klumpen gestört werden. Versuche nicht zu blasen.
    3. Gehen Sie direkt zu Tag1 (Abschnitt 2) von der NdChIP-Seq-Protokoll oder Blitz Einfrieren der Zelle Pellet in flüssigem Stickstoff und Store bei-80 ° C.

2. Tag 1: NdChIP-seq

  1. Vorbereitung des Antikörper-Bead-komplexes
    1. Bereiten Sie ein Wasserbad 37 ° C und einem Eiskübel. Arbeiten auf Eis, bereiten Sie 1 X IP Puffer/1 x PIC und 1 x Verdünnungspuffer Antikörper (Ab), und halten sie auf dem Eis. Rufen Sie Protein A (oder G) magnetische Beads (siehe Diskussion zu Auswahlkriterien ab) von 4 ° C Lagerung und Mischung sehr gut durch sanfte Puls-Bereich. Halten Sie es auf dem Eis.
      Hinweis: Puls-Bereich bedeutet, dass vortexen gestoppt wird, jedes Mal, wenn eine vollständige Wirbel in der Röhre entsteht.
    2. Übertragen Sie 24 µL Protein A (oder G) magnetische Beads pro IP-Reaktion in einer neuen 2-mL-Tube. Nehmen Sie das Volumen der Perlen auf und halten Sie das Rohr auf dem Eis. Zum Beispiel für 7 IPs verwenden 24 µL x 7 = 168 µL.
    3. Legen Sie das Rohr auf Rohr-Magnet und warten auf die Lösung klare Angabe Wulst Trennung zu werden. Ohne die Perlen sorgfältig den Überstand mit einer Pipette entfernen und entsorgen. Nehmen Sie das Rohr aus dem Rohr-Magnet und legen Sie es auf dem Eis.
    4. Fügen Sie ein gleiches Volumen (d.h. Ausgangsmenge von Perlen) der eiskalten IP-Puffer + 1 X PIC zu mischen. Mischen von Pipettieren rauf und runter. Tun Sie nicht Wirbel.
    5. Legen Sie die IP-Puffer + 1 x PIC + Perlen zurück auf die Rohr-Magnet und warten auf die Lösung klare Angabe Wulst Trennung zu werden. Ohne die Perlen sorgfältig den Überstand mit einer Pipette entfernen und entsorgen. Wiederholen Sie kalt IP-Puffer + 1 X PIC waschen zwei weitere Male für eine Gesamtmenge von 3 Wäschen.
    6. Nach der letzten Wäsche Aufschwemmen der Perlen in ein gleiches Volumen (d.h. Ausgangsmenge von Perlen) der eiskalten IP-Puffer + 1 X PIC zu mischen. Mischen von Pipettieren rauf und runter. Tun Sie nicht Wirbel. Halten Sie das Rohr auf dem Eis.
    7. Gießen Sie auf dem Eis 10 mL IP-Puffer + PIC in ein 25 mL v-förmige Reservoir. Mit einer Mehrkanal-Pipette hinzufügen 130 µL eiskalte IP-Puffer + 1 x Bilder Mix in einzelnen Vertiefungen der eine saubere V-Boden-96-Well Platte. Füllen Sie einen Brunnen pro IP. Beschriften Sie die Platte als "Ab-Bead-Komplex".
    8. 12 µL der gewaschenen Protein A (oder G) magnetische Beads in jeweils gut IP-Puffer + PIC einfügen und Mischen von Pipettieren rauf und runter. Halten Sie die restlichen gewaschenen Perlen auf dem Eis.
    9. Erhalten Sie validierte Antikörper aus ihre kühl- und Tauwetter auf Eis, falls erforderlich. Arbeiten auf Eis, verdünnen Sie die Antikörper mit 1 X Ab Verdünnungspuffer, die Konzentrationen, die in Tabelle 2dargestellt.
    10. Fügen Sie in jede Vertiefung der Ab-Bead komplexe Platte 1 µL der gegebenenfalls verdünnten Antikörper (Tabelle 1 hinzu). Notieren Sie den Brunnen auf den Antikörper-Schlüssel. Mit Mehrkanal-Pipette, jede Zeile durch Pipettieren nach oben und unten 20 Mal mischen. Tipps zwischen den Zeilen zu ändern. Dichtplatte der Ab-Bead Komplex sehr gut mit einer Aluminium-Platte-Cover und inkubieren Sie bei 4 ° C auf einer rotierenden Plattform für mindestens 2 h.
      Hinweis: Diese Inkubation kann fortfahren, bis bereit, Schritt 2.4 zu beginnen.
  2. Lyse und Chromatin Verdauung Zelle
    1. Arbeiten auf Eis, 1 x Lyse Puffer + 1 x PIC und 1 mL MNase vorbereiten ich Verdünnung Puffer (Tabelle 3) und halten sie auf dem Eis.
    2. Rufen Sie die Zelle Pellets aus deren-80 ° C-Lagerung (oder Eis, wenn frisch zubereitet). Tauen Sie jede Zelle Pellet im Wasserbad 37 ° C für eine 10 s, dann Transfer zum Eis auf.
    3. Jede Zelle Pellet sofort fügen Sie eiskalte 1 x Lyse Puffer + 1 X Bild, um eine Endkonzentration von 10.000 Zellen/20 µL und Mix 10 Mal durch Pipettieren hoch und runter, ohne Luftblasen zu erstellen hinzu. Zum Beispiel ist das Endvolumen für 70.000 Zellen 140 µL.
    4. Arbeiten auf Eis, aliquoten 20 µL/Well von der daraus resultierenden Lysates in eine 96-Well-Platte. Die Abdeckplatte mit einem Kunststoff-Dichtung und brüten auf Eis für 20 min. Label die Platte "MNase Verdauung" und Aufzeichnen der Brunnen, ein Vorlage-Schlüssel. Um ein exaktes Timing der Chromatin Verdauung Reaktion zu gewährleisten, fahren Sie nicht auf die Verdauung mit mehr als 2 Reihen von Proben gleichzeitig.
    5. Kurz bevor die 20 min-Lyse abgeschlossen ist, verdünnen Sie die MNase ich Enzym mit MNase ich Verdünnung zu puffern, um eine Endkonzentration von 20 U/µL, und bewahren Sie es auf dem Eis.
    6. Arbeiten auf Eis, bereiten die MNase ich Verdauung-Mix entsprechend Tabelle 4 und aliquoten 20 µL pro jede Zeile der Proben plus 5 µL Totvolumen-Mix in einer Zeile einer 96-Well-Reservoir-Platte zu meistern und lassen Sie ihn auf Eis. Für zwei Reihen, das Laufwerk sollte: (20 µL 2) + 5 µL = 45 µL.
    7. Nachdem die Lysates Inkubation zu beenden, entfernen Sie die MNase Verdauung aus Eis. Mit einer Mehrkanal-Pipette 20 µL MNase hinzufügen ich Verdauung Mischung in jeder Zeile der Proben zu meistern, und mischen Sie 10 Mal von oben und unten pipettieren. Tipps zwischen den Zeilen zu ändern. Bei genau 5 min bei Raumtemperatur inkubieren.
    8. Nach 5 min um die Reaktion zu stoppen, mit Hilfe einer Mehrkanal-Pipette hinzu 6 µL 250 µM Ethylenediaminetetraacetic Säure (EDTA) in jeder Zeile der Proben und Mischen von oben und unten ein paar Mal. Tipps zwischen den Zeilen zu ändern. Schalten Sie nach Zugabe von EDTA die Einstellung der Pipette 20 µL und Mischung 10 Mal durch Pipettieren rauf und runter um einen völligen Stillstand der Verdauung Reaktion zu gewährleisten. Tipps zwischen den Zeilen zu ändern.
    9. Mit einer Mehrkanal-Pipette, jede Zeile der MNase verdaut Proben fügen Sie 6 µL 10-fach Puffer lyse und Mix gut von oben und unten 10 Mal Pipettieren hinzu. Mit einer Kunststoffplombe decken Sie ab und inkubieren Sie für 15 min auf Eis.
  3. Eingabe Trennung und Pre-clearing
    1. Nach 15 min Inkubation, arbeiten auf Eis, Pool können alle Brunnen für die gleiche Pellet/Vorlage in eine sterile Zelle, auf Eis, 1,5 mL Tube (bereits mit der Vorlage ID beschriftet) und Mischung vorab gekühlt gründlich, aber langsam mit Hilfe einer Pipette Waschmittel Schäumen zu vermeiden.
    2. Übertragen Sie für jede Zelle Pellet/Vorlage 8 µL der verdauten Chromatin in eine neue sterile, 0,5 mL-Tube (bereits mit der Vorlage ID beschriftet) und Speicher bei 4 ° C über Nacht. Dies wird als das Eingabesteuerelement dienen.
    3. Verteilen Sie das restliche Volumen des verdauten Chromatin in 48 µL Aliquots in eine neue 96-Well-Platte. Pellet/Zellvorlage 1 geht in Vertiefungen A01-A06, Pellet/Zellvorlage 2 in Brunnen A07-A12 usw.geht. Notieren Sie die Brunnen zu einer Vorlage Schlüssel. Beschriften Sie die Platte "Pre-Clearing".
    4. Mit einer Mehrkanal-Pipette, fügen Sie 120 µL 1 x IP-Puffer + 1 x PIC und 12 µL gewaschenen Protein A (oder G) magnetische Beads in jede Vertiefung der Pre-Clearing-Platte aus Schritt 2.3.3. Mischen Sie jede Zeile, indem Sie nach oben und unten 10 Mal pipettieren. Tipps zwischen den Zeilen zu ändern. Die Dichtplatte sehr gut mit einer Aluminium-Platte-Cover und inkubieren Sie auf einer rotierenden Plattform bei 4 ° C für mindestens 2 h.
  4. Immunopräzipitation Reaktion
    1. Dieser Schritt vergewissern Sie sich vor, dass die Ab-Bead komplexe Platte (Schritt 2.1.10) und der Pre-Clearing-Platte (Schritt 2.3.4) inkubiert haben, für mindestens 2 h. Quick spin beide Platten durch Zentrifugieren für 10 s bei 200 X g.
    2. Die Ab-Bead komplexe Platte (aus Schritt 2.1.10) auf einem Teller Magnet und warten 15 s für die Lösung klar zu werden. Sorgfältig entfernen und entsorgen des Überstands mit einer Pipette ohne zu stören die Perlen. Entfernen Sie die Platte aus der Platte-Magnet und halten sie auf dem Eis.
    3. Die Pre-Clearing Reaktion Platte (aus Schritt 2.3.4) auf einem Teller Magnet und warten 15 s für die Perlen zu trennen und die Lösung klar zu werden. Übertragen Sie sorgfältig, ohne zu stören die Perlen, des Überstands mit einer Pipette in die entsprechenden Vertiefungen der komplexen Platte auf Eis und Mischung sanft 15 Mal gehalten, von oben und unten Pipettieren Ab-Sicke. Siegel die Platte gut mit Aluminium Platte Deckel und inkubieren Sie Übernachtung (12-18 h) bei 4 ° C auf einer rotierenden Plattform. Re-label die Platte "IP-Reaktion".

3. Tag 2: NdCHIP-seq

  1. Waschungen und elution
    1. Einstellen des Heizung Mischers bis 65 ° C. Bereiten Sie auf dem Eis eine salzarme Waschpuffer und hohem Salzgehalt Waschpuffer. Schnelles drehen die IP-Reaktion Platte aus Schritt 2.4.3 für 10 s bei 200 X g.
    2. Die IP-Reaktion Platte auf einem Teller Magnet und warten 15 s für die Lösung klar zu werden. Mit einer Mehrkanal-Pipette, ohne zu stören die Perlen, sorgfältig entfernen und entsorgen des Überstands. Nehmen Sie die Platte aus der Platte Magnet und platzieren Sie es auf dem Eis.
    3. Jede Zeile der Proben in der IP-Reaktion Platte fügen Sie 150 µL des eiskalten salzarme waschen Puffer und Mischung langsam 10 Mal rauf und runter, um die Perlen voll aufzuwirbeln hinzu.
    4. Legen Sie die IP-Reaktion Platte wieder auf die Platte-Magnet, warten Sie, bis die Perlen zu trennen und mit einer Mehrkanal-Pipette, ohne zu stören die Perlen entfernen und entsorgen den überstand. Die Platte wieder auf Eis und wiederholen Sie die Schritte 3.1.3 und 3.1.4 für insgesamt 2 Wäschen.
    5. Jede Zeile der Proben in der IP-Reaktion-Platte auf dem Eis fügen Sie 150 µL des hohen Salz waschen Puffer und Mischung langsam 10 Mal von oben und unten, um die Perlen voll Aufschwemmen Pipettieren hinzu.
    6. Legen Sie die IP-Reaktion Platte wieder auf die Platte-Magnet, warten Sie, bis die Perlen zu trennen und mit einer Mehrkanal-Pipette, ohne zu stören die Perlen entfernen und entsorgen den überstand. Die IP-Reaktion Platte auf dem Eis und chill bereits eine neue 96-Well-Platte daneben.
    7. Jede Zeile der Proben in der IP-Reaktion Platte fügen Sie 150 µL des hohen Salz waschen Puffer und Mischung langsam 10 Mal von oben und unten, um die Perlen voll Aufschwemmen Pipettieren hinzu. Übertragen Sie nach Wiederfreisetzung jede Zeile der Proben auf die entsprechende Zeile der neuen, vorgekühlt, 96-Well-Platte. Beschriften Sie die Platte "IP-Reaktion". Entsorgen Sie die alte Platte.
    8. Die neue IP-Reaktion Platte auf den Teller-Magneten und warten Sie, bis die Perlen zu trennen. Mit einer Mehrkanal-Pipette, ohne zu stören die Perlen, sorgfältig entfernen und entsorgen des Überstands. Die Platte bei Zimmertemperatur aufbewahren.
    9. An jede Zeile von Proben in der IP-Reaktion Platte 30 µL des Puffers ChIP Elution (EB) und mischen Sie langsam 10 Mal durch Pipettieren rauf und runter. Achten Sie darauf, um Blasenbildung zu vermeiden.
    10. Die Dichtplatte mit einer PCR-Abdeckung und in einem Mischer Heizung bei 65 ° C für 1,5 h mit einer Geschwindigkeit von 1.350 u/min inkubieren.
    11. Nach 1,5 h Inkubation spin-down der IP-Reaktion Platte 200 X g für 1 min bei 4 ° C. Ändern Sie die Einstellung des Mischers Heizung bis 50 ° C.
    12. Nach dem Dreh die IP-Reaktion Platte auf einem Teller Magnet und warten Sie, bis die Lösung klar. Mit einer Mehrkanal-Pipette, stören die Perlen sorgfältig übertragen Sie, ohne 30 µL des Überstands in eine neue 96-Well-Platte. Verwenden Sie frische Tipps für jede Zeile. Beschriften Sie die Platte "IP-Reaktion" und bei Zimmertemperatur aufbewahren.
  2. Proteinverdauung
    1. 30 % PEG/1 M NaCl magnetischer Wulst17 (Zusammensetzung Puffertisch) Lösung von 4 ° C Kühlschrank abrufen und halten Sie sie bei Raumtemperatur für mindestens 30 Minuten kritische: sicherzustellen, dass die Perle-Lösung vollständig Raumtemperatur bevor Sie fortfahren.
    2. Eingabesteuerelement Proben von 4 ° C Lagerung (Schritt 2.3.2) und schnelle Runde abzurufen. Messen Sie das Volumen mit einer Pipette und Reinstwasser jedes Eingabesteuerelement einem Endvolumen von 30 µL. Weitergabe Eingabesteuerelement Proben in die vorgewählten Eingabe Vertiefungen (leeren Brunnen) auf Hinzufügen der IP-Reaktion Platte (Schritt 3.1.12). Notieren Sie den Brunnen auf den Probe-Schlüssel.
    3. Auf dem Eis vorbereiten der Protein-Verdauung-Master-Mix wie in Tabelle 5 und aliquoten gleiches Volumen in einer Zeile einer 96-Well-Reservoir-Platte gezeigt.
    4. Mit einer Mehrkanal-Pipette, um jede Zeile der Proben in der IP-Reaktion Platte 40 µL der Protein-Verdauung-Master-Mix und mischen Sie langsam 10 Mal rauf und runter. Die Dichtplatte mit einer PCR-Abdeckung, spin-down bei 200 X g für 1 min und brüten in einem Mischer Heizung bei 50 ° C für 30 min. bei 650 u/min eingestellt. Während die Platte Inkubation ist, bereiten Sie frische 70 % igem Ethanol (EtOH) und bei Zimmertemperatur aufbewahren.
    5. Nach 30 min Inkubation abgeschlossen ist, drehen Sie die IP-Reaktion Platte 200 X g für 1 min, 4 ° C. Die Platte bei Zimmertemperatur aufbewahren.
      Hinweis: Das Gesamtvolumen sollte jetzt ~ 70 µL/Well.
  3. Perle-Bereinigung mit 30 % PEG/1 M NaCl magnetischer Wulst Lösung
    1. Aliquoten Raumtemperatur 30 % PEG/1 M NaCl magnetic bead Lösung in einer Zeile einer Behälter sauber 96-Well-Platte (75 µL pro Probe x Anzahl der Zeilen).
    2. Arbeiten bei Raumtemperatur mit einer Mehrkanal-Pipette, jede Zeile der Proben in der IP-Reaktion Platte 70 µL (Verhältnis 1:1) die 30 % PEG/1 M NaCl magnetischer Wulst Lösung hinzu und mischen Sie 10 Mal durch Pipettieren rauf und runter. Tipps zwischen den Zeilen zu ändern. Inkubieren Sie die Platte für 15 min bei Raumtemperatur.
    3. Legen Sie die Platte auf den Teller-Magneten und inkubieren Sie für 5 min um die Perlen zu trennen lassen.
    4. Mit einer Pipette, ohne zu stören die Perlen, sorgfältig entfernen und entsorgen des Überstands. Halten Sie die Perlen.
    5. Während die IP-Reaktion Platte immer noch auf der Platte-Magnet ist, mit einer Mehrkanal-Pipette, um jede Zeile der Proben, hinzufügen 150 µL Raumtemperatur 70 % EtOH und inkubieren Sie für 30 s. Nach 30 s, mit einer Mehrkanal-Pipette entfernen und entsorgen den überstand. Wiederholen Sie diesen Schritt noch einmal für eine Gesamtmenge von 2 Wäschen.
    6. Brüten Sie nach der zweiten Wäsche EtOH die "trockene" Platte auf den Teller-Magneten für 3 min. Sichtprüfung die Platte, um sicherzustellen, dass alle EtOH verdampft wird. Ist dies nicht der Fall, brüten die Platte für 1 min. über Trocknung der Perlen resultiert eine geringere Ausbeute.
    7. Fügen Sie die Platte aus der Platte-Magnet und mit einer Mehrkanal-Pipette nehmen 35 µL EB (Table of Materials). Mischen Sie gut durch Pipettieren 10 Mal rauf und runter. Tipps zwischen den Zeilen zu ändern. Inkubation bei Raumtemperatur 3 min zu eluieren.
    8. Nach der Inkubation die IP-Reaktion Platte wieder auf die Platte-Magnet und 2 min inkubieren. Die Perlen sollten trennen und die Lösung wird klar.
    9. Mit einer Mehrkanal-Pipette, stören die Perlen sorgfältig übertragen Sie, ohne Überstand in die entsprechenden Vertiefungen einer neuen 96-Well-Platte.
    10. Dichtplatte mit einer Aluminium-Platte-Cover, label "IPed + Eingabe DNA" und speichern bei 4 ° C über Nacht oder bei-20 ° C für längere Zeit (> 48 h) Speicher.

4. Tag 3: Bibliotheksbau

  1. Ende Reparatur- und Phosphorylierung
    1. Der Eingang für die Ende Reparatur/Phosphorylierung Reaktion ist das IPed + Eingang Platte aus Schritt 3.3.10. Nach dem Auftauen mit 200 X g für 1 min bei 4 ° C drehen Sie, die Platte nach unten und halten sie auf dem Eis.
    2. Abrufen von-20 ° C Gefrierschrank aller Reagenzien (mit Ausnahme von Enzymen) erforderlich für die Ende Reparatur/Phosphorylierung Reaktion (Tabelle 6) und bei Zimmertemperatur auftauen, dann sofort um zu Eis übertragen.
    3. Arbeiten auf Eis, folgen Sie Tabelle 6 Ende Reparatur/Phosphorylierung Master Mix in einem sterilen, 1,5 mL Microcentrifuge Schlauch einrichten. Mischen Sie nach der Zugabe von allen nicht-Enzym Bestandteile gut durch Puls-Bereich und setzen Sie den Schlauch wieder auf Eis.
    4. Die entsprechenden Enzyme aus ihrer kalten Lagerung und Transport auf der Bank in einem gekühlten Rohr cool Rack abrufen. Mischen Sie jedes Enzym durch Streichen der Tube, schnelle Runde, und legen Sie sie zurück in den gekühlten Rohr cool Rack. Wenn das Enzym pipettieren, aspirieren Sie langsam um eine genaue Volumen-Transfer zu gewährleisten. Waschen Sie nach der Zugabe die Spitze in den master-Mix durch Pipettieren rauf und runter.
    5. Sobald die Enzyme hinzugefügt werden, zurück sanft Puls-Vortex Master mix 5mal zu gewährleisten eine gleichmäßige Verteilung der Komponenten, dann die schnelle Runde und sofort den Schlauch auf dem Eis.
    6. Auf dem Eis, aliquoten einem entsprechenden Volumen des Ende Reparatur/Phosphorylierung Master-Mix in einer Zeile eine neue Reservoir 96-Well-Platte; Volume regelmÄÑig: (15 µL x Anzahl der Zeilen) + 5 µL Totvolumen. Eine Beispielrechnung für zwei Zeilen: (15 µL 2) + 5 µL = 35 µL/Well.
    7. Mit einer Mehrkanal-Pipette, jede Zeile der Proben 15 µL Ende Reparatur/Phosphorylierung Master Mix hinzu und mischen Sie 10 Mal durch Pipettieren rauf und runter. Tipps zwischen den Zeilen zu ändern. Die Dichtplatte mit einer Kunststoff-Abdeckung, spin-down bei 200 X g für 1 min bei 4 ° C und bei Raumtemperatur für 30 min inkubieren.
  2. Wulst Aufräumarbeiten nach Ende Reparatur- und Phosphorylierung
    1. Aus dem Kühlschrank 4 ° C die PEG/1 M NaCl magnetischer Wulst Lösung 20 % und 30 % PEG/1 M NaCl-Lösung abgerufen und bei Zimmertemperatur mindestens 30 min inkubieren.
      Hinweis: Die 30 % PEG/1 M NaCl-Lösung nicht enthalten magnetische Beads.
    2. Nachdem beide Lösungen Raumtemperatur erreicht haben, für jede Probe bereiten Sie 80 µL 1:2 Mischung aus 30 % PEG/1 M NaCl und 20 % PEG/1 M NaCl-magnetischer Wulst-Lösungen. Ein Beispiel für 24 Proben: 80 µL x 24 = 1.920 µL (640 µL 30 % PEG/1 M NaCl und 1.288 µL 20 % PEG/1 M NaCl-magnetischer Wulst-Lösungen).
    3. Aliquoten die Wulst Lösung mischen, gleiches Volumen in einer Zeile einer 96-Well-Reservoir-Platte und bei Zimmertemperatur aufbewahren. Aliquoten EB-Puffer (40 µL pro Probe x Anzahl der Zeilen) in einer Zeile einer Behälter sauber 96-Well-Platte. Ein Beispiel für zwei Reihen: 40 µL x 2 = 80 µL/Well.
    4. Fügen Sie mithilfe einer Mehrkanal-Pipette 75 µL der Perle Mischung vorbereitet jede Zeile der Proben aus Schritt 4.1.7 4.2.2 betreten und nach oben und unten 10 Mal mischen. Tipps zwischen den Zeilen zu ändern. Inkubation bei Raumtemperatur für 15 min. weiter mit dem Wulst-Bereinigung-Verfahren beschriebenen Schritte 3.3.3-3.3.10. Die Platte mit einer Kunststoffplombe, schnelle Runde abdecken und auf Eis legen. Fahren Sie mit Schritt 4.3.
  3. A-Tailing Reaktion
    1. Abrufen von-20 ° C Gefrierschrank alle Reagenzien (mit Ausnahme von Enzymen) für die A-Tailing Reaktion (Tabelle 7) erforderlich, bei Raumtemperatur auftauen dann sofort um zu Eis übertragen.
    2. Folgen Sie arbeiten auf Eis, Tabelle 7 , A-Tailing Master Mix in einem sterilen, 1,5 mL Microcentrifuge Schlauch einzurichten. Folgen Sie die allgemeine enzymatische Gebräu Installationsanweisungen beschriebenen Schritte 4.1.4-4.1.6.
    3. Mit einer Mehrkanal-Pipette, jede Zeile der Proben 15 µL des A-Tailing Master Mix hinzu und mischen Sie 10 Mal durch Pipettieren rauf und runter. Tipps zwischen den Zeilen zu ändern. Die Dichtplatte mit einer PCR-Abdeckung und spin-down bei 200 X g für 1 min bei 4 ° C in einem Thermocycler bei 37 ° C für 30 min inkubieren. Nach der Inkubation mit 200 X g für 1 min drehen Sie, die Platte nach unten und bei Zimmertemperatur aufbewahren.
  4. Wulst Aufräumarbeiten nach A-Tailing
    1. Führen Sie die Schritte in Schritt 4.2 beschrieben. Die Abdeckplatte mit Kunststoffdichtung, Label "A-Tail + BC", schnelle Runde, und legen Sie es auf dem Eis. Fahren Sie mit Schritt 4.5.
  5. Adapter-Ligatur
    1. Abrufen von-20 ° C Gefrierschrank alle Reagenzien (mit Ausnahme von Enzymen) für die Adapter-Ligatur-Reaktion (Tabelle 8) erforderlich, bei Raumtemperatur auftauen dann sofort um zu Eis übertragen.
    2. Abrufen von 10 µM PE-Adapter (Supplemental Tabelle1) Stammlösung und verdünnen auf 0,5 µM mit EB. Mischen Sie gut durch Puls aufschütteln. Die benötigte Menge ist 3 µL x Anzahl der Proben. Arbeiten auf Eis, aliquoten 0,5 µM PE-Adapter, gleiches Volumen in 12 Vertiefungen einer Behälter sauber 96-Well-Platte. Halten Sie es auf dem Eis.
    3. Folgen Sie arbeiten auf Eis, Tabelle 8 , um den Adapter Ligation Master-Mix in einem sterilen, 1,5 mL Microcentrifuge Schlauch einzurichten. Folgen Sie die allgemeine enzymatische Gebräu Installationsanweisungen beschriebenen Schritte 4.1.4-4.1.6. Stellen Sie sicher, dass die 5 X schnelle Ligation Puffer vollständig aufgetaut und vor Gebrauch gut gemischt ist.
    4. Auf dem Eis, aliquoten einem entsprechenden Volumen des Adapter-Ligation-Master-Mix in einer Zeile eine neue Reservoir 96-Well-Platte. Zum Beispiel Berechnung für zwei Zeilen: (23 µL 2) + 5 µL = 51 µL/Well. Halten Sie die Platte auf dem Eis.
    5. Mit einer Mehrkanal-Pipette, fügen Sie 2 µL 0,5 µM gepaart Ende (PE) Adapter in jede Zeile der Proben aus Schritt 4.4.1 und Mix. Tipps zwischen den Zeilen zu ändern.
    6. Mit einer Mehrkanal-Pipette, jede Zeile der Proben 23 µL Adapter Ligation Master Mix hinzu und mischen Sie 15 Mal durch Pipettieren rauf und runter. Tipps zwischen den Zeilen zu ändern. Die Dichtplatte mit einem Metalldeckel, Label "Ligatur" Spin-down bei 200 X g für 1 min bei 4 ° C und über Nacht bei Raumtemperatur inkubieren.
  6. 4. Tag: Bead Aufräumarbeiten #1 nach Adapter Ligatur
    1. Aus dem Kühlschrank 4 ° C 20 % PEG/1 M NaCl magnetischer Wulst Lösung abrufen und bei Zimmertemperatur mindestens 30 min inkubieren. Während die Lösung Äquilibrierung ist bereiten frisch 70 % EtOH.
    2. Aliquoten 20 % PEG/1 M NaCl magnetischer Wulst Lösung, 55 µL pro Probe in einer Zeile eines Reservoirs 96-Well Platte und bei Zimmertemperatur aufbewahren. Ein Beispiel für zwei Reihen: 55 µL x 2 = 110 µL/Well.
    3. Aliquoten EB Puffer, 50 µL pro Probe in eine Zeile einer Behälter sauber 96-Well-Platte. Ein Beispiel für zwei Reihen: 50 µL x 2 = 100 µL/Well.
    4. Mit einer Mehrkanal-Pipette, 48 µL 20 % PEG/1 M NaCl magnetischer Wulst Lösung in jeder Zeile der Proben in der Ligatur-Platte aus Schritt 4.5.6 und mischen nach oben und unten 10 Mal. Tipps zwischen den Zeilen zu ändern. Inkubation bei Raumtemperatur für 15 min. weiter mit dem Wulst-Bereinigung-Verfahren beschriebenen Schritte 3.3.3-3.3.7.
    5. Fügen Sie die Platte aus der Platte-Magnet und mit einer Mehrkanal-Pipette nehmen 45 µL EB (Table of Materials). Mischen Sie gut durch Pipettieren 10 Mal rauf und runter. Tipps zwischen den Zeilen zu ändern. Bei Raumtemperatur für 3 min zu eluieren inkubieren.
    6. Nach der Inkubation die IP-Reaktion Platte wieder auf die Platte-Magnet und inkubieren 2 min. mit einer Mehrkanal-Pipette, ohne zu stören die Perlen, überstand vorsichtig in die entsprechenden Vertiefungen einer neuen 96-Well-Platte zu übertragen. Beschriften Sie die Platte "Ligatur + 1 BC".
    7. Fügen Sie in jede Vertiefung 5 µL 10 X PCR High-Fidelity Puffer hinzu und mischen Sie gut durch Pipettieren rauf und runter. Tipps zwischen den Zeilen zu ändern. Die Abdeckplatte mit Kunststoffdichtung, schnelle Runde und bei Zimmertemperatur aufbewahren.
  7. Perle-Bereinigung #2 nach Adapter Ligatur
    1. Perle-Bereinigung durchführen, wie beschrieben in Abschnitt 4.6 mit folgenden Änderungen: 60 µL 20 % PEG/1 M NaCl magnetischer Wulst Lösung für jedes aktive gut in der Ligatur + 13:00-Platte (Schritt 4.6.7) hinzufügen und aus den Perlen mit 35 µL EB Puffer eluieren. Beschriften Sie die Platte "Ligatur + 2 BC" und halten sie auf dem Eis.
  8. PCR-Amplifikation
    1. Abrufen aus dem Tiefkühler-20 ° C alle Reagenzien (mit Ausnahme von Enzymen) für die PCR-Reaktion (Tabelle 9) erforderlich, bei Raumtemperatur auftauen dann sofort auf Eis legen.
    2. Arbeiten auf Eis, folgen Sie Tabelle 9 die PCR Master-Mix in einem sterilen, 1,5 mL Microcentrifuge Schlauch einrichten. Folgen Sie der allgemeinen Gebräu Aufstellanleitung beschriebenen Schritte 4.1.4-4.1.5. Auf dem Eis, aliquoten einem entsprechenden Volumen des PCR-Master-Mix in einer Zeile eine neue Reservoir 96-Well-Platte. Halten Sie es auf dem Eis. Siehe Schritt 4.5.4 für Beispielrechnungen.
    3. Arbeiten auf Eis, mit einer Mehrkanal-Pipette, 2 µL jeder einzigartige 12,5 µM PCR reverse Indexierung Grundierung (Supplemental Tabelle 2) in jedem Brunnen in der Ligatur + 2 v. Platte (Schritt 4.7.1) und mischen Sie langsam rauf und runter. Tipps zwischen den Zeilen zu ändern. Halten Sie die Platte auf dem Eis.
    4. Arbeiten auf Eis, mit einer Mehrkanal-Pipette hinzufügen 23 µL des PCR-master-Mix in jeder Zeile von Proben aus Schritt 4.8.3 und Mix 10 Mal durch Pipettieren rauf und runter. Dichtplatte mit einer PCR-Abdeckung, 200 X g für 1 min nach unten zu drehen und in einem Thermocycler inkubieren (siehe Tabelle 10 für PCR-Radsport-Zustände).
  9. Wulst Aufräumarbeiten nach PCR Verstärkung
    1. Drehen Sie nach der PCR-Amplifikation die Platte 200 X g für 1 min, 4 ° C. Die Perle Bereinigung durchführen, wie beschrieben in Abschnitt 4.6 mit folgenden Änderungen: jeder PCR-Reaktion 51 µL 20 % PEG/1 M NaCl-magnetischer Wulst-Lösung hinzu und eluieren von die Perlen mit 25 µL EB Puffer. Die Dichtplatte mit einem Aluminium-Deckel und spin-down bei 200 X g für 1 min. Store die Proben bei-20 ° C.
    2. Zur Überprüfung konstruierter Bibliotheken durchführen DNA Quantifizierung mit Hilfe einer Fluoreszenz basierende Assays, visualisieren das Endprodukt mit einem Chip-basierte Kapillarelektrophorese-Analysator (hohe Empfindlichkeit Assay) und Bereicherung führen quantitative PCR (qPCR) (siehe Vertreter Resultate, NdChIP-Seq Bibliothek Qualitätssicherung durch qPCR).

Representative Results

Chromatin Verdauung Profile
Optimierung der MNase Verdauung ist essentiell für den Erfolg dieses Protokolls. Entscheidend ist eine Verdauung Profil dominiert von einzelnen Nukleosom Fragment Größen erzeugen, zwar nicht übermäßig verdaut, zur Wiederherstellung der höheren Ordnung Nukleosom Fragmente ermöglichen. Eine ideale Verdauung-Profil besteht aus einen Großteil der einzelnen Nukleosom Fragmente mit einem kleinen Bruchteil, Fragmente kleiner und größer als einzelne Nukleosomen darstellt. Abbildung 1 zeigt Beispiele für eine ideale, übermäßig verdaut und unter verdaut Größe Verteilung Profile. Beachten Sie, dass suboptimale Verdauung des Chromatins auch in das Profil der Sequenzierung Bibliothek generiert aus dem IP-Material (Abbildung 2) sichtbar wird.

NdChIP-Seq Bibliothek Qualitätssicherung durch qPCR
qPCR ist eine etablierte Methode zur Beurteilung der Qualität von ChIP18,19,20. Wenn ausführen NdChIP-Seq auf 10.000 Zellen die Ausbeute der Nukleinsäure nach IP wird unter 1 ng. Daher unbedingt auszuführenden qPCR nach Bibliotheksbau, die relative Anreicherung von Zielregionen über Hintergrund zu beurteilen. Um eine Schätzung der Hintergrund zu bieten, werden Bibliotheken gebaut aus MNase verdaut Chromatin (Input) generiert. Für jede IP-Bibliothek sind zwei Sätze von Primern erforderlich (siehe SupplementalTabelle 3 eine Liste der Zündkapseln für häufig verwendete Histon Mark). Ein Primer Satz sollte spezifisch für eine genomische Region, die konsequent die Histon-Modifikation von Interesse (positive Ziel) zugeordnet ist, und eine andere Region, die nicht mit der Histon-Änderung von Interesse (negative Ziel) markiert ist. Die Qualität der ChIP-Seq-Bibliothek wird als Bereicherung in Bezug auf Eingabebibliothek Falten bewertet. Falte Bereicherung kann berechnet werden, unter Verwendung der folgenden Gleichung, die exponentielle Amplifikation der genomischen Zielregion annimmt: 2Ctinput-CtIP. Unsere Custom made Statistiksoftware R, qcQpcr_v1.2, ist geeignet für qPCR Anreicherung Analyse von niedrigen Eingang native ChIP-Seq Bibliotheken (Supplemental Codedateien). Abbildung 3 stellt ein qPCR-Ergebnis für erfolgreiche und erfolglose ChIP-Seq-Bibliotheken. Die minimale erwartete Falte Bereicherung Wert für gute Qualität NdChIP-Seq Bibliotheken sind 16 für schmale Mark, wie H3K4me3 und 7 für große Marken, z. B. H3K27me3.

Modellierung von MNase Zugänglichkeit
Computergestützte Analyse von ChIP-Seq ist komplex und einzigartig für jede experimentelle Einstellung. Eine Reihe von Leitlinien festgelegten internationalen menschlichen epigenomischen Consortium (IHEC) und The Encyclopedia of DNA-Elemente (ENCODE) kann verwendet werden, zur Bewertung der Qualität der ChIP-Seq Bibliotheken21. Es ist wichtig zu beachten, dass die Sequenzierung Tiefe der Bibliotheken wirkt sich auf die Erkennung und Behebung von angereicherte Regionen20. Die Anzahl der Spitzen erkannt erhöhen und nähert sich einem Plateau lesen Sie Tiefe steigt. Wir empfehlen NdChIP-Seq-Bibliotheken für schmale Mark (z.B.H3K4me3) entsprechend den Empfehlungen der IHEC von 50 Millionen gepaart liest (25 Millionen Fragmente) sequenziert werden und 100 Millionen gepaart-liest (50 Millionen Fragmente) für breite Markierungen ( z.B., H3K27me3) und geben Sie22. Diesen tiefen Sequenzierung bieten ausreichend Reihenfolge Ausrichtungen für die Erkennung der bedeutendste Gipfel weithin mit ChIP-Seq Peak Anrufer, wie MACS2 und HOMER, verwendet ohne Sättigung23,24zu erreichen. Eine qualitativ hochwertige Säugetier NdChIP-Seq-Bibliothek hat eine PCR doppelte < 10 % und Bezug Genom Ausrichtung Rate von > 90 % (inkl. duplizierten liest). Erfolgreiche NdChIP-Seq-Bibliotheken enthalten hochkorrelierten Wiederholungen mit einer erheblichen Portion ausgerichteten liest in MACS222 identifiziert bereichert Gipfel (> 40 %) und Inspektion der ausgerichteten Lesevorgänge auf einem Genom-Browser zeigen sollte, optisch nachweisbare Bereicherungen im Vergleich zu den Eingabebibliothek (Abbildung 4). Darüber hinaus kann NdChIP-Seq Nukleosom Dichte beurteilen durch die Verwendung eines Gaußschen Mischung Verteilung Algorithmus verwendet werden (w1 * n(x; Μ 1,σ1) + w2 * n(X; μ2σ2) = 1) bei MACS2 identifiziert angereicherte Regionen Modell Nukleosom Dichte durch MNase zugänglich Grenzen definiert. In diesem Modell w1 steht für Mono-Nukleosom Verteilung Gewicht und w2 steht für di-Nukleosom Verteilung Gewicht. Wo w1 w2größer ist, gibt es Dominanz der Mono-Nukleosom-Fragmente und umgekehrt. Diese Analyse erfordert, dass Bibliotheken in einer gepaart-End Mode sequenziert werden, so dass Fragment Größen definiert werden können. Um die Gaußsche Mischung Verteilung Algorithmus anzuwenden, sind statistisch signifikante angereicherte Regionen zunächst identifiziert. Wir empfehlen Peak telefonieren mit MACS2 mit Eingabe als Kontrolle und mit Standardeinstellungen für schmale Mark und ein Q-Wert-Cutoff von 0,01 für große Marken. Eine Reihe von statistischen Pakete mit einer Gaußschen Mischung Verteilung Algorithmus sind weit verbreitete statistische Software-Pakete ab. Unter Verwendung der durchschnittlichen Fragmentgröße bestimmt gepaart-End lesen Sie Grenzen der IPed Proben, Distributionen auf MACS2 identifiziert angereicherte Promotoren und ein Gaußsche Mischung Verteilung Algorithmus kann jeder Veranstalter mit dem R-statistische Paket angewendet werden Mclust Version 3.025 , eine gewichtete Verteilung zu berechnen. In dieser Anwendung wird empfohlen, Beseitigung von Promotoren, die weniger als 30 ausgerichteten Fragmente enthalten, denn unterhalb dieser Schwelle das resultierende Gewicht Schätzungen unzuverlässig. Eine gute Qualität-NdChIP-Seq-Bibliothek generiert eine "glockenförmig" Mischung-Verteilung, die bestehen aus zwei Hauptkomponenten mit Mittelwerten, Mono-, di-Nukleosom-Fragment-Längen entsprechen.

Figure 1
Abbildung 1 : Bewertung der MNase Verdauung vor der Bibliothek Generierung. Chip-basierte Kapillarelektrophorese Analyzer Profile für eine optimale MNase verdaut (A), unter-verdaut (B) und übermäßig verdaut (C) Chromatin. Biologische repliziert werden als blaue, rote und grüne Spuren angezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Bewertung der MNase Verdauung nach Bibliothek Generation. (A) Post Bibliothek Bauprofile optimal verdaut Input (biologischer Replikate; rot, grün, schwarz) und IP (biologischer Replikate; Cyan, lila, blau) und (B) sub-optimalen Input (biologischer Replikate; rot, grün, blau) und IP ( biologischer Replikate; Cyan, lila, orange) Bibliotheken. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Post Bibliotheksbau quantitative PCR kann zur Beurteilung der Qualität der NdChIP-Seq Bibliotheken. Falte Anreicherung von H3K4me3 IP-Bibliotheken in Bezug auf Eingabe Bibliotheken errechnet sich als 2(Ct des Eingangs - Ct IP) für positive und negative Ziele mit qcQpcr_v1.2. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 : Repräsentative NdChIP-Seq-Bibliothek aus 10.000 primäre CD34 gebaut+ Schnur Blutkörperchen. Pearson-Korrelation von H3K4me3 Signal (gelesen pro million zugeordneten liest) berechnet in den Promotoren (TSS + / 2Kb) zwischen 3 biologische repliziert, (A) replizieren 1 und 2, (B) replizieren 1 und 3, (C) replizieren 2 und 3. (D) UCSC Browser-Ansicht von der HOXA-gen-Cluster querverbundenen ChIP-Seq aus 1 Million Zellen pro IP, erfolgreiche NdChIP-Seq von 10.000 Zellen pro IP und erfolglosen NdChIP-Seq von 10.000 Zellen pro IP generiert. (rot: H3K27me3, grün: H3K4me3, und schwarz: Eingang). (E) Anteil der zugeordneten Lesevorgänge innerhalb MACS2 identifiziert angereicherte Regionen H3K4me3 (schwarz) und H3K27me3 (grau). Bitte klicken Sie hier für eine größere Version dieser Figur.

Puffer-Zusammensetzung
A. 1. Immunopräzipitation Puffer (IP)
20 mM Tris-HCl pH 7,5
2 mM EDTA
150 mM NaCl
0,1 % Triton x-100
0,1 % Deoxycholate
10 mM Natrium Butyrat
A. 2. Low Salz Waschpuffer
20 mM Tris-HCl pH 8.0
2 mM EDTA
150 mM NaCl
1 % Triton x-100
0,1 % SDS
A. 3. hohe Salz Waschpuffer
20 mM Tris-HCl pH 8.0
2 mM EDTA
500 mM NaCl
1 % Triton x-100
0,1 % SDS
A. 4. ChIP Elution buffer
100 mM Nahco33
1 % SDS
A. 5. 1 x Lysis Puffer-1 mL
0,1 % Triton
0,1 % Deoxycholate
10 mM Natrium Butyrat
A. 6. Ab Verdünnungspuffer
0,05 % (w/V) Natriumazid
0,05 % breites Spektrum antimikrobieller (z. B. ProClin-300)
mit PBS-Puffer
A. 7. 30 % PEG / 1M NaCl-Magnetic Bead Lösung (Referenz-16)
30 % PEG
1 M NaCl
10 mM Tris HCl pH 7,5
1 mM EDTA
1 mL der gewaschenen Super-paramagnetischen beads
A. 8. 20 % PEG / 1M NaCl-Magnetic Bead Lösung (Referenz-16)
30 % PEG
1 M NaCl
10 mM Tris HCl pH 7,5
1 mM EDTA
1 mL der gewaschenen Super-paramagnetischen beads

Tabelle 1: NdChIP-Seq Puffer Zusammensetzung.

Histon-Änderung Konzentration (µg/µL)
H3K4me3 0,125
H3K4me1 0,25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabelle 2: Antikörper Füllmenge für NdChIP-seq.

Reganet Volumen (µL)
Reinstwasser 478
1 M Tris-HCl pH 7,5 10
0,5 M EDTA 10
5 M NaCl 2
Glycerin 500
Gesamtvolumen 1.000

Tabelle 3: Rezept für MNase Verdünnungspuffer.

Reagenz Volumen (µL)
Reinstwasser 13
20 mM DVB-t 1
10 x MNase Puffer 4
20 U/µl Mnase 2
Gesamtvolumen 20

Tabelle 4: Rezept für MNase Master Mix.

Reagenz Volumen (µL)
Elution Buffer 30
Puffer-G2 8
Protease 2
Gesamtvolumen 40

Tabelle 5: Rezept für DNA Reinigung Master Mix.

Reagenz Volumen (µL)
Reinstwasser 3.3
10 x Einschränkung Endonuklease Puffer (z.B. NEBuffer) 5
25 mM ATP 2
10 mM dNTPs 2
T4-Polynukleotid-Kinase (10 U/µl) 1
T4-DNA-Polymerase (3 U/µl) 1.5
DNA-Polymerase I, Large (Klenow) Fragment (5 U/µl) 0,2
Gesamtvolumen 15

Tabelle 6: Rezept für Ende Reparatur Master Mix.

Reagenz Volumen (µL)
Reinstwasser 8
10 x Einschränkung Endonuklease Puffer (z.B. NEBuffer) 5
10 mM dATP 1
Klenow (3' - 5' Exo-) 1
Gesamtvolumen 15

Tabelle 7: Rezept für A-Tailing Master Mix.

Reagenz Volumen (µL)
Reinstwasser 4.3
5 x schnelle Ligation Puffer 12
T4 DNA-Ligase (2000 U/µl) 6.7
Gesamtvolumen 23

Tabelle 8: Rezept für Adapter Ligation Master Mix.

Reagenz Volumen (µL)
Reinstwasser 7
25 Umm PCR Primer 1.0 2
5 x HF Puffer 12
DMSO 1.5
DNA-Polymerase 0,5
Gesamtvolumen 23

Tabelle 9: Rezept für PCR-Master-Mix.

Temprature (° C) Dauer (s) Anzahl der Zyklen
98 60 1
98 30
65 15 10
72 15
72 300 1
4 halten halten

Tabelle 10: PCR Methode ausgeführt.

Oligo Sequenz Änderung
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG-3 " 5' Änderung: Phosphorylierung
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' Änderung: * T ist ein Phosphorothioat Band

Zusätzliche Tabelle 1: Oligo-Sequenzen zur Erzeugung von PE-Adapter.

Primer-Name Sequenz Index IndexRevC (bis zur Sequenzierung eingesetzt werden)
PCR-rückwärts-Indizierung Primer 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR-rückwärts-Indizierung Primer 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR rückwärts Indizierung-Primer 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR-rückwärts-Indizierung Primer 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR-rückwärts-Indizierung Primer 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR-rückwärts-Indizierung Primer 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR-rückwärts-Indizierung Primer 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR-rückwärts-Indizierung Primer 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR-rückwärts-Indizierung Primer 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR rückwärts Indizierung-Primer 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR-rückwärts-Indizierung Primer 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR-rückwärts-Indizierung Primer 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR-rückwärts-Indizierung Primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR-rückwärts-Indizierung Primer 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR-rückwärts-Indizierung Primer 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR-rückwärts-Indizierung Primer 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR-rückwärts-Indizierung Primer 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR-rückwärts-Indizierung Primer 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR-rückwärts-Indizierung Primer 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR-rückwärts-Indizierung Primer 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR rückwärts Indizierung-Primer 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR-rückwärts-Indizierung Primer 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR-rückwärts-Indizierung Primer 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR-rückwärts-Indizierung Primer 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Zusätzliche Tabelle 2: PCR reverse Indexierung Primer-Sequenzen.

Primer Sequenz
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3 "
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3 "
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3 "
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3 "
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3 "
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3 "
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3 "
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3 "
Histon-Änderung Positiven Ziel Negative Ziel
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Zusätzliche Tabelle 3: Eine Liste von Primern für häufig verwendete Histon-Mark (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 und H3K36me3).

Ergänzende Datei 1: Arbeitsblatt NdChIP-Seq. Bitte klicken Sie hier, um diese Datei herunterladen.

Zusätzliche Codedateien: qcQpcr_v1.2. R Statistiksoftware für qPCR Anreicherung Analyse der niedrigen Eingang native ChIP-Seq-Bibliotheken. Bitte klicken Sie hier, um diese Datei herunterladen.

Discussion

Angesichts der kombinatorischen der Chromatin-Modifikation und Nukleosom Positionierung in transcriptional Verordnung dürfte eine Methode, die ermöglicht die simultane Messungen dieser Funktionen bieten neue Einblicke in die epigenetischen Regulation. Hier vorgestellten NdChIP-Seq-Protokoll ist ein native ChIP-Seq-Protokoll so optimiert, dass um gleichzeitige Verhör Histon-Modifikationen und Nukleosom Dichte in seltenen Primärzellen9,10zu ermöglichen. NdChIP-Seq nutzt enzymatische Verdauung von Chromatin, wenn gepaart-End massiv parallelen Sequenzierung und ein "glockenförmig" Mischung Verteilungsmodell gekoppelt, ermöglicht die Untersuchung Histon Änderungen an einzelnen Nukleosom-Ebene und die Entfaltung der epigenomischen Profile getrieben von Heterogenität innerhalb einer Population. Unter Verwendung dieses Protokolls, haben wir bereits eine eindeutige Verteilung der Immuno-ausgefällt Fragment Größen, bestimmt durch gepaart-End lesen Grenzen, verbunden mit bestimmten Chromatin Zustände definiert durch ChromHMM10,24berichtet.

Die Qualität einer NdChIP-Seq-Bibliothek hängt von mehreren Faktoren ab, z. B. Antikörper Spezifität und Sensitivität, optimale MNase Verdauung Bedingungen und Qualität des Chromatins. Die Besonderheit der verwendeten Antikörper ist entscheidend in der Herstellung von erfolgreichen NdChIP-Seq-Bibliothek. Ein ideale Antikörper zeigt hohen Affinität gegen das Epitop des Interesses mit kleinen Kreuz Reaktivität mit anderen Epitope. Es ist ebenso wichtig, magnetische Beads mit der höchsten Affinität für den Antikörper Wahl zu wählen.

MNase Verdauung ist eine kritische und zeitkritische und Konzentration Reaktion in diesem Protokoll. Daher bei der Verarbeitung von mehreren Proben ist es wichtig, dass jede Reaktion für eine äquivalente Menge an Zeit ausgebrütet wird (siehe Punkt 2.2). Die Qualität des Chromatins ist ein weiterer Faktor, der wesentlich das Ergebnis der NdChIP-FF fragmentierte Chromatin führt zu einem suboptimalen MNase Verdauung Profil und Ergebnisse in Bibliotheken mit einem low-Signal Rauschabstand bewirkt. Einzelproben mit niedrigen Zelle Lebensfähigkeit oder Chromatin, abgebaut, wie z. B. Formalin fixierten Paraffin-eingebetteten (FFPE) Gewebe sind nicht zu empfehlen für dieses Protokoll.

Die Zugabe von ein Bild während der Chromatin-Extraktion reduziert unerwünschte (d.h., zufällige) Chromatin Fragmentierung und Konserven Integrität der Histone Tails. Als solche muss PIC Lyse Puffer und Immunopräzipitation Puffer kurz vor hinzugefügt werden. Während Auswahl Zellen über Durchflusszytometrie, wählen Sie für lebensfähige Zellen und sorgen sind Zellen mit einer low-Flow-Rate zu erhöhen die Genauigkeit der Zelle Nummer Schätzung und Lebensfähigkeit der Zellen sortiert. Sortieren von Zellen direkt in Lyse Puffer zu vermeiden. Der Mantel-Puffer wird die Lyse-Puffer verdünnen und verhindert effektiv Permeabilisierung der Zellmembran auf MNase. Je nach einer Art von Zellen oder Organismus eventuell die Titration von MNase optimale Verdauung zu erhalten.

NdChIP-Seq auf Säugetier-Zellen erfordert eine minimale Sequenzierung Tiefe von 50 Millionen gepaart liest (25 Millionen Fragmente) für schmale Mark und 100 Millionen gepaart-liest (50 Millionen Fragmente) für große Marken und Input. Die Gaußsche Mischung Verteilung Algorithmus führt nicht optimal auf Bibliotheken, die bis zu einer Tiefe deutlich unterhalb dieser Empfehlung sequenziert worden. NdChIP-Seq wird nicht Promotoren mit wenig Trennung zwischen der gewichtete Verteilungswert für Mono - und di-Nukleosom-Fragment-Längen in Mono oder di-Nukleosom dominiert Promotoren klassifizieren. Daher müssen diese Promotoren in der nachfolgenden Analyse entfernt werden. Biologischer Replikate können generiert werden, um Vertrauen in die prognostizierten Ausschüttungen und technische Variabilität im MNase Verdauung und Bibliothek zu identifizieren.

Im Gegensatz zu früheren Iterationen der native ChIP-Seq-Protokolle ermöglicht NdChIP-Seq, kombinatorische Wirkung der Chromatin Struktur und Histon-Modifikationen zu untersuchen, durch die Verwendung von Fragment Größe Post Immunopräzipitation Nukleosom Dichte zu integrieren, durch MNase Zugänglichkeit mit Histon-Änderung-Messungen bestimmt. Anwendung des NdChIP-Seq primäre Zellen und Gewebe werden neuartige Einblicke in die integrative Art der epigenetischen Regulation und Identifizierung der epigenetischen Signaturen aufgrund der Heterogenität innerhalb der Bevölkerung ermöglichen.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessenkonflikte.

Acknowledgements

A.L. wurde von einem kanadischen Graduate Stipendium Canadian Institutes of Health Research unterstützt. Diese Arbeit wurde durch Zuschüsse vom Genom British Columbia und die Canadian Institute of Health Research (CIHR-120589) als Teil der kanadischen Epigenetik, Umwelt und Gesundheit Forschungsinitiative Konsortium und der Terry Fox Research Institute Program unterstützt. Projekt Grant #TFF-122869, m.h. und ein Forschungsinstitut der Terry Fox New Investigator Award (Grant # 1039), m.h.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics