Generación de inmunoprecipitación de la cromatina nativa secuenciación bibliotecas para el análisis de densidad de nucleosoma

Genetics
 

Summary

Presentamos una inmunoprecipitación de cromatina nativa modificada secuencia (ChIP-seq) metodología para la generación de la secuencia de bases de datos adecuadas para un marco analítico de nucleosoma densidad ChIP-seq, integración de la accesibilidad de la nucleasa micrococcal (MNase) con medidas de modificación de las histonas.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Presentamos una inmunoprecipitación de cromatina nativa modificado protocolo experimental (ChIP-seq) compatible con una mezcla Gaussian distribución basada metodología de análisis (densidad de nucleosoma ChIP-seq; ndChIP-seq) que permite la generación de la secuencia Mediciones combinadas de accesibilidad nucleasa micrococcal (MNase) con la modificación de las histonas genoma. Posición de nucleosoma y densidad local y la modificación postraduccional de sus subunidades de las histonas, actúan en concierto para regular Estados de transcripción local. Medidas combinatorias de accesibilidad del nucleosoma con la modificación de las histonas generada por seq ndChIP permite la interrogación simultánea de estas características. La metodología ndChIP-seq es aplicable a una pequeña cantidad de células primarias inaccesibles para cross-linking basada en protocolos de ChIP-seq. Tomados en conjunto, ndChIP-seq permite la medida de modificación de las histonas en combinación con densidad de nucleosoma local para obtener nuevos conocimientos sobre los mecanismos comunes que regulan la transcripción del RNA dentro de poblaciones celulares primaria rara.

Introduction

El genoma eucariota se empaqueta en cromatina mediante repetición de las estructuras del nucleosoma que consiste de dos copias de cuatro proteínas de histonas (p. ej., H2A, H2B, H3 y H4) circunscritos por 146 pares de bases de ADN1,2. Complejos de remodelación de cromatina controlan nucleosoma posición dentro de los límites de promotor del gen y participan en la regulación de la expresión génica mediante la alteración de accesibilidad de la DNA para factores de transcripción y la ARN polimerasa maquinaria3, 4.

Colas aminos terminal de las histonas en el nucleosoma son sometidas a diversas modificaciones covalentes, incluyendo acetilación, metilación, fosforilación, ubiquitylation, la sumoilación, formylation y la hidroxilación de los aminoácidos específicos5 , 6 , 7 , 8. posiciones y grados de estas modificaciones determinan un estado de cromatina que influyen en la cromatina estructura y control de acceso de los complejos moleculares que permiten la activación de la transcripción7. Dado que ambos modificación de densidad y las histonas del nucleosoma desempeñan un papel en el control local de la transcripción genética, hemos desarrollado un enfoque nativo de viruta que permite la medida simultánea de la densidad del nucleosoma y la histona modificación9, 10.

ChIP-seq nativo toma ventaja de la nucleasa de micrococo endonucleasa (MNase) para digerir la cromatina intacta en su estado nativo dentro del núcleo11,12, una propiedad que ha sido aprovechada para asignar nucleosoma posicionamiento13 , 14 , 15. densidad de nucleosoma ChIP-seq (ndChIP-seq) aprovecha la propiedad de acceso preferencial de MNase abrir regiones de la cromatina para generar medidas que combinan la accesibilidad MNase con histona modificación10. ndChIP-seq es adecuado para la elaboración de perfiles de modificaciones de las histonas en las células primarias raras, tejidos y células cultivadas. Aquí, presentamos un protocolo detallado que permite la generación de conjuntos de datos de secuencia adecuado para un marco analítico descrito anteriormente trabajo10 que integra el fragmento tamaño post inmunoprecipitación, determinada por extremo apareado leer límites, a al mismo tiempo investigar accesibilidad MNase con medidas de modificación de las histonas. Anteriormente, la aplicación del presente Protocolo a 10.000 sangre del cordón umbilical humano primario derivado CD34+ células y células madre embrionarias humanas revelaron relaciones únicas entre modificaciones de la estructura e histonas de la cromatina dentro de estos tipos10 de la célula . Dada su capacidad para medir simultáneamente el nucleosoma accesibilidad y modificación de las histonas, ndChIP-seq es capaz de revelar epigenómica características en una población de células en un nivel único de nucleosoma y resolver las firmas heterogéneas en su elementos constitutivos. Un ejemplo de la exploración de poblaciones celulares heterogéneas por ndChIP seq es investigación de promotores bivalentes, donde H3K4me3, una marca activa y H3K27me3, una marca represiva, están presentes10.

Protocol

Nota: La entrada mínima de este protocolo es 10.000 células por reacción de la única inmuno-precipitación (IP). Imprimir la hoja de cálculo experimental suministrada y utilizar como una guía para planificar el experimento. Las incubaciones a temperatura ambiente se supone que a ~ 22 ° C. Todas las recetas del almacenador intermediario se proporcionan en la tabla 1. Todos los buffers deben ser almacenados a 4 ° C y mantener en hielo durante el procedimiento, a menos que se indique lo contrario.

1. preparación de la célula

  1. Células cultivadas
    1. Lavar las células con 1 mL de solución salina buffer fosfato (PBS) y determinar con precisión la concentración de células usando un hemocitómetro. Si hay más de 1 millón de células, aumentar el volumen de PBS.
    2. Basado en el conteo de células, alícuota equivalente a 70.000-100.000 células en un tubo de 1,5 mL estéril y giro a 500 x g durante 6 min a 4 ° C. Usando una pipeta, lentamente Quite y descarte el sobrenadante (sin perturbar el pellet de células) y resuspender el precipitado en tampón de lisis helada + 1 x inhibidor de la proteasa cóctel (PIC) a una concentración de 1.000 células / μl. Mezclar por pipeteo arriba y abajo 20-30 tiempos. Es esencial que grupos de células se interrumpen. Trate de no crear burbujas.
    3. Proceder directamente a día 1 (sección 2) del Protocolo de ndChIP-seq o flash congelar el precipitado de células en nitrógeno líquido y conservar a-80 ° C.
  2. Células clasificadas
    1. Recoger 70.000-100.000 clasificado16 células en un tubo de 1,5 mL con 350 μl de solución salina tamponada de Hank (HBSS), o PBS + 2% de suero bovino fetal (FBS).
    2. Desactivación de cada célula de la alícuota a 500 x g durante 6 min a 4 ° C. Lentamente con una pipeta, retirar el sobrenadante (sin perturbar el pellet de células) y resuspender en tampón de lisis helada + 1 x PIC a una concentración final de 1.000 células / μl. mezcla bien en tampón de lisis mediante pipeteo arriba y abajo 20 - 30 veces. Asegúrese de que los grupos de células se interrumpen. Trate de no crear burbujas.
    3. Proceder directamente a día 1 (sección 2) del Protocolo de ndChIP-seq, o flash congelar el precipitado de células en nitrógeno líquido y conservar a-80 ° C.

2. día 1: ndChIP-seq

  1. Preparación del complejo anticuerpo-grano
    1. Preparar un baño de agua de 37 ° C y un cubo de hielo. Trabajando en hielo, preparar buffer de x IP 1/1 x PIC y 1 x de tampón de dilución de anticuerpo (Ab) y mantener en hielo. Recuperar bolas magnéticas A proteína (o G) (véase la discusión de criterios de selección) de los 4 ° C almacenamiento y mezcla muy bien suave pulso-Vortex. Mantener en hielo.
      Nota: Pulso-Vortex significa Vortex se detiene cada vez que se forma un vórtice completo en el tubo.
    2. Transferencia de granos magnéticos de 24 μl de proteína A (o G) por reacción de IP en un nuevo tubo de 2 mL. Registrar el volumen de los granos y mantenga el tubo en hielo. Ejemplo, 7 IPs, uso 24 μl x 7 = 168 μl.
    3. Coloque el tubo en el imán del tubo y esperar a que la solución a ser claro que indica separación de grano. Sin molestar a los granos, retirar el sobrenadante con una pipeta cuidadosamente y deseche. Tome el tubo fuera el imán del tubo y coloque en hielo.
    4. Añadir un volumen igual (es decir, volumen inicial de los granos) de búfer helada de IP + 1 x PIC mix. Mezclar mediante pipeteo arriba y abajo. No no agitar con vortex.
    5. Coloque la IP buffer + 1 x PIC + granos en el imán del tubo y esperar a que la solución a ser claro que indica separación de grano. Sin molestar a los granos, retirar el sobrenadante con una pipeta cuidadosamente y deseche. Repita el tampón frío de IP + 1 X lavado PIC dos veces más para un total de 3 lavados.
    6. Después del último lavado, resuspender los granos en un volumen igual (es decir, volumen inicial de los granos) de búfer helada de IP + 1 x PIC mix. Mezclar mediante pipeteo arriba y abajo. No no agitar con vortex. Mantenga el tubo en hielo.
    7. En el hielo, vierta 10 mL de buffer IP + PIC en un depósito en forma de V de 25 mL. Utilizando una pipeta multicanal, añadir 130 μl de tampón de IP helado + 1 x mezcla PIC en pocillos individuales de 96 V-fondo-bien limpiado la placa. Llenar un pozo por IP. Etiqueta de la placa como "complejo Ab-grano".
    8. Añadir granos magnéticos de 12 μl de Protein A lavado (o G) en cada bien que contiene tampón IP + PIC y mezclar mediante pipeteo arriba y abajo. Mantener los granos lavados restantes en hielo.
    9. Obtener anticuerpos validados de su almacenamiento en frío y de deshielo en hielo, si es necesario. Trabajando en el hielo, diluir los anticuerpos con tampón de dilución de Ab 1 x a las concentraciones que se muestra en la tabla 2.
    10. Añadir a cada pocillo de la placa del complejo Ab-grano, 1 μl del anticuerpo apropiado, diluido (tabla 1). Registro del pozo a la clave del anticuerpo. Con pipeta multicanal, mezclar cada fila mediante pipeteo arriba y abajo 20 veces. Cambio de puntas entre las filas. Sellar la placa complejo Ab-grano muy bien con una cubierta de placa de aluminio e incubar a 4 ° C sobre una plataforma giratoria para al menos 2 h.
      Nota: Esta incubación puede continuar hasta que esté listo para iniciar el paso 2.4.
  2. Digestión lisis y la cromatina de la célula
    1. Trabajando en el hielo, preparar 1 x de tampón de lisis 1 x PIC y 1 mL de MNase I disolución tampón (tabla 3) y mantener en hielo.
    2. Recuperar los pellets de células de su almacenaje de-80 ° C (o de hielo, si recién preparada). Descongelar cada precipitado de células en un baño de agua de 37 ° C por una s 10 y luego transferencia de hielo.
    3. Añadir a cada pellet celular inmediatamente helada 1 x buffer de lisis 1 x PIC a una concentración final de 10.000 células/20 μl y mezclar 10 veces mediante pipeteo arriba y abajo, sin crear burbujas. Por ejemplo, para las 70.000 células el volumen final es 140 μl.
    4. Trabajo en el hielo, alícuota 20 μL/pocillo de los lisados resultantes en una placa de 96 pocillos. Cubra la placa con un sello plástico e incubar en hielo durante 20 min etiqueta de la placa "MNase digestión" y registran los pozos a una tecla de plantilla. Con el fin de asegurar una sincronización exacta de la reacción de digestión de la cromatina, no se debe proceder a la digestión con más de 2 filas de muestras a la vez.
    5. Justo antes de la lisis de 20 min es completa, diluir la MNase I enzima con MNase I dilución tampón, para una concentración final de 20 U/μl y mantenerlo en hielo.
    6. Trabajando en el hielo, preparar la MNase I digestión master mix según tabla 4 y alícuotas de 20 μl de la mezcla por cada fila de las muestras más volumen muerto de 5 μL en una fila de una placa de 96 pocillos embalse y mantener en hielo. Para las dos filas, el volumen debe ser: (x 2 de 20 μl) + 5 μl = 45 μl.
    7. Después de los lysates de la incubación, saque la placa de digestión MNase de hielo. Utilizando una pipeta multicanal, añadir 20 μl de MNase I digestión master mix en cada fila de las muestras y mezclar 10 veces mediante pipeteo arriba y abajo. Cambio de puntas entre las filas. Incubar a temperatura ambiente durante 5 minutos exactamente.
    8. Después de 5 minutos, para detener la reacción, utilizar una pipeta multicanal para añadir 6 μl de 250 μm dihidratada del ácido (EDTA) en cada fila de las muestras y mezclar hacia arriba y hacia abajo varias veces. Cambio de puntas entre las filas. Después de la adición de EDTA, cambiar el ajuste de la pipeta de 20 μl y mezcla 10 veces mediante pipeteo arriba y abajo para asegurar una completa parada de la reacción de digestión. Cambio de puntas entre las filas.
    9. Usando una pipeta multicanal, a cada fila de las muestras MNase digerido, añadir 6 μl de 10 x tampón de lisis y mezclar bien mediante pipeteo arriba y abajo 10 veces. Cubra con un sello plástico e incubar en hielo por 15 min.
  3. Claro previa y separación de entrada
    1. Después de la incubación de 15 minutos, trabajando sobre hielo, piscina todos los pozos de la misma célula plantilla de pellet en una estéril, previamente enfriados en hielo, tubo de 1,5 mL (previamente etiquetado con el identificador de la plantilla) y mezcla bien pero lentamente con una pipeta para evitar la espuma detergente.
    2. Para cada célula de la pelotilla/plantilla, transferencia 8 μl del digerido la cromatina en un nuevo estéril, tubo de 0,5 mL (previamente etiquetado con el identificador de la plantilla) y almacenar a 4 ° C durante la noche. Esto servirá como el control de entrada.
    3. Distribuir el volumen restante de la cromatina digerido en 48 partes alícuotas μl, en una nueva placa de 96 pocillos. Pellets/plantilla de celda 1 entra pozos A01-A06, celular de la pelotilla/plantilla 2 entra pozos A07-A12, etcetera. Grabar los pozos a una tecla de plantilla. Etiqueta de la placa de "Limpieza previa".
    4. Usando una pipeta multicanal, añadir 120 μl de 1 x Buffer de IP + 1 x PIC y 12 μl de lavado bolas magnéticas A proteína (o G) en cada pocillo de la placa de compensación antes del paso 2.3.3. Mezclar cada fila mediante pipeteo arriba y abajo 10 veces. Cambio de puntas entre las filas. Sellar muy bien la placa con una cubierta de placa de aluminio e incubar en una plataforma giratoria a 4 ° C durante un mínimo de 2 h.
  4. Reacción de inmunoprecipitación
    1. Antes de comenzar este paso, asegúrese de que la placa complejo Ab-grano (paso 2.1.10) y la placa de compensación previa (paso 2.3.4) han incubado para por lo menos 2 h. rápido girar ambas placas por centrifugación durante 10 s a 200 x g.
    2. Coloque la placa complejo Ab-grano (del paso 2.1.10) en un imán de la placa y esperar 15 s la solución evidente. Cuidadosamente retire y descarte el sobrenadante con una pipeta sin molestar a los granos. Retire la placa del imán de la placa y mantener en hielo.
    3. Coloque la placa de reacción de claro antes (de paso 2.3.4) en un imán de la placa y esperar 15 s para los granos a separar y la solución evidente. Sin molestar a los granos, transferir cuidadosamente el sobrenadante con una pipeta en los pocillos correspondientes del Ab-grano placa complejo mantenerse en hielo y mezcla suavemente 15 veces transfiriendo hacia arriba y hacia abajo. Sello de la placa con una de aluminio cubierta de la placa e incubar toda la noche (12-18 h) a 4 ° C sobre una plataforma giratoria. Vuelva a etiquetar la placa "Reacción de IP".

3. día 2: ndCHIP-seq

  1. Lavado y elución
    1. Configurar el mezclador de calentamiento a 65 ° C. En el hielo, preparar un tampón de lavado de bajos en sal y tampón de lavado de sal. Rápido girar la placa de reacción de IP de paso 2.4.3 durante 10 s a 200 x g.
    2. Coloque la placa de reacción de IP en un imán de la placa y esperar 15 s la solución evidente. Cuidadosamente con una pipeta multicanal, sin molestar a los granos, retire y descarte el sobrenadante. Tomar la placa fuera el imán de la placa y coloque en hielo.
    3. A cada fila de las muestras en la placa de reacción de IP, añadir 150 μL de sal helada lavado tampón y mezclar lentamente 10 veces hacia arriba y hacia abajo para resuspender completamente los granos.
    4. Coloque la placa de reacción de IP en el imán de la placa, esperar a que los granos a separar y usando una pipeta multicanal, sin molestar a los granos Quite y descarte el sobrenadante. Coloque la placa en hielo y repita los pasos 3.1.3 y 3.1.4 para un total de 2 lavados.
    5. En el hielo, a cada fila de las muestras en la placa de reacción de IP, añadir 150 μL de la sal alta lavado tampón y mezclar lentamente 10 veces mediante pipeteo arriba y abajo para resuspender completamente los granos.
    6. Coloque la placa de reacción de IP en el imán de la placa, esperar a que los granos a separar y usando una pipeta multicanal, sin molestar a los granos Quite y descarte el sobrenadante. Coloque la placa de reacción de IP en hielo y enfriado previamente una placa de 96 pozos nuevos al lado de él.
    7. A cada fila de las muestras en la placa de reacción de IP, añadir 150 μL de la sal alta lavado tampón y mezclar lentamente 10 veces mediante pipeteo arriba y abajo para resuspender completamente los granos. Después resuspension, transferir cada fila de las muestras a la fila correspondiente de la placa nueva, previamente enfriada, 96-well. Etiqueta de la placa de "Reacción de IP". Deseche la placa vieja.
    8. Coloque la nueva placa de reacción de IP en el imán de la placa y esperar a que los granos a separar. Cuidadosamente con una pipeta multicanal, sin molestar a los granos, retire y descarte el sobrenadante. Mantenga la placa a temperatura ambiente.
    9. A cada fila de las muestras en la placa de reacción de IP, Añadir 30 μL del buffer de elución de ChIP (EB) y mezclar lentamente 10 veces mediante pipeteo arriba y abajo. Asegúrese de evitar formación de burbujas.
    10. Sellar la placa con una cubierta PCR e incubar en un mezclador de calentamiento a 65 ° C durante 1,5 h con una velocidad de mezcla de 1.350 rpm.
    11. Después de 1,5 h de incubación, girar por la placa de reacción de IP a 200 x g durante 1 min a 4 ° C. Cambiar la configuración del mezclador de calentamiento a 50 ° C.
    12. Después de la vuelta, coloque la placa de reacción de IP en un imán de la placa y esperar la solución limpiar. Usando una pipeta multicanal, sin molestar a los granos, cuidadosamente transferir 30 μL del sobrenadante en una nueva placa de 96 pocillos. Utilizar puntas nuevas para cada fila. Etiqueta de la placa de "Reacción de IP" y mantener a temperatura ambiente.
  2. Digestión de proteínas
    1. Recuperar17 (tabla de composición de búfer) solución al 30% PEG/1 M NaCl grano magnético del refrigerador de 4 ° C y mantenerlo a temperatura ambiente durante al menos 30 minutos críticos: asegurar que la solución grano llegue completamente a temperatura ambiente antes de proceder.
    2. Recuperar muestras de control de entrada de almacenamiento de 4 º C (paso 2.3.2) y vuelta rápida. Medir el volumen con una pipeta y añadir agua ultrapura a cada control de entrada para un volumen final de 30 μl. transferir las muestras de control de entrada a los pozos de entrada seleccionados previamente (pocillos vacíos) en la placa de reacción de IP (paso 3.1.12). Registro del pozo a la clave de la muestra.
    3. En el hielo, preparar la mezcla maestra de digestión de proteína como se muestra en la tabla 5 y volumen alícuota igual en una fila de una placa de 96 pozos de depósito.
    4. Usando una pipeta multicanal, a cada fila de las muestras en la placa de reacción de IP, agregar 40 μl de la mezcla maestra de digestión de proteína y mezclar lentamente 10 veces hacia arriba y hacia abajo. Sellar la placa con una cubierta PCR, desactivación a 200 x g durante 1 min e incubar en un mezclador de calentamiento a 50 ° C por 30 min a 650 rpm. Mientras que la placa se incuba, preparar fresca 70% de etanol (EtOH) y mantenerlo a temperatura ambiente.
    5. Una vez finalizada la incubación de 30 min, hacer girar la placa de reacción de IP a 200 x g durante 1 min, 4 ° C. Mantenga la placa a temperatura ambiente.
      Nota: El volumen total debe ser ahora ~ 70 μL/pocillo.
  3. Grano de limpiar con solución grano magnético PEG/1 M de NaCl al 30%
    1. Alícuota el temperatura ambiente 30% de PEG/1 M NaCl magnética grano solución en una fila de una placa de 96 pocillos limpia depósito (75 μl por muestra x # de filas).
    2. Trabajando a temperatura ambiente, utilizando una pipeta multicanal, añadir 70 μl (proporción 1:1) de la solución grano magnético PEG/1 M de NaCl al 30% a cada fila de las muestras en la placa de reacción de IP y mezclar 10 veces mediante pipeteo arriba y abajo. Cambio de puntas entre las filas. Incubar la placa por 15 min a temperatura ambiente.
    3. Coloque la placa en el imán de la placa e incubar durante 5 minutos permitir que los granos a separar.
    4. Cuidadosamente con una pipeta, sin molestar a los granos, retire y descarte el sobrenadante. Mantener los granos.
    5. Mientras que la placa de reacción de IP está todavía en el imán de la placa, utilizando una pipeta multicanal, a cada fila de las muestras, agregar 150 μL de temperatura 70% EtOH e incube durante 30 s. Después de 30 s, usando una pipeta multicanal, retire y descarte el sobrenadante. Repita este paso una vez más para un total de 2 lavados.
    6. Después del segundo lavado de EtOH, Incube la placa 'seca' en el imán de la placa para 3 minutos Inspeccione visualmente la placa para asegurarse de que el EtOH se evapora. Si no, Incube la placa durante 1 minuto de secado demasiado los resultados de los granos en un menor rendimiento.
    7. Tomar la placa del imán de la placa y con una pipeta multicanal, añadir 35 μl EB (Tabla de materiales). Mezclar por pipeteo 10 veces hacia arriba y hacia abajo. Cambio de puntas entre las filas. Incubar a temperatura ambiente durante 3 min eluir.
    8. Después de la incubación, coloque la placa de reacción de IP en el imán de la placa e incubar durante 2 minutos. Deben separar los granos y la solución será evidente.
    9. Usando una pipeta multicanal, sin molestar a los granos, cuidadosamente transferir el sobrenadante en los pocillos correspondientes de una nueva placa de 96 pocillos.
    10. Sellar la placa con una cubierta de placa de aluminio, etiqueta "IPed + entrada de ADN" y almacenar a 4 ° C durante la noche, o a-20 ° C para el largo plazo (> 48 h) almacenamiento.

4. día 3: Construcción de biblioteca

  1. Fosforilación y reparación final
    1. La entrada para la reacción final reparación/fosforilación es el IPed + entrada de placa de paso 3.3.10. Después de descongelar, la placa de la vuelta abajo a 200 x g durante 1 min a 4 ° C y mantenerlo en hielo.
    2. Recuperar de congelador de-20 ° C todos los reactivos (excepto enzimas) necesarios para la reacción de reparación/fosforilación final (tabla 6) y descongelación a temperatura ambiente, luego transfieren inmediatamente hielo.
    3. Trabajando en el hielo, sigue tabla 6 para configurar el extremo reparación/fosforilación Master Mix en un tubo de microcentrífuga de 1,5 mL estéril. Después de la adición de todos los componentes de la enzima no, mezclar bien por pulso-vórtex y coloque el tubo en hielo.
    4. Recuperar las enzimas correspondientes de su transporte y almacenamiento en frío en el Banco en un portatubos fresco refrigerado. Mezcle cada enzima sacudiendo el tubo, vuelta rápida y colóquelo en el portatubos fresco refrigerado. Cuando la enzima el pipeteo, aspirar lentamente para asegurar a una transferencia de volumen exacto. Después de la adición, lavar la punta en la mezcla principal transfiriendo hacia arriba y hacia abajo.
    5. Una vez que las enzimas se agregan, suavemente pulso-vortex el master mix 5 veces para asegurar una distribución uniforme de todos los componentes, luego vuelta rápida y colocar inmediatamente el tubo de nuevo en el hielo.
    6. En el hielo, alícuota un volumen adecuado final reparación/fosforilación Master Mix en una fila de una nueva placa de 96 pocillos embalse; alícuotas de volumen: (15 μl x # de filas) + 5 μl de volumen muerto. Un ejemplo de cálculo para dos filas: (15 μl x 2) + 5 μl = 35 μL/pocillo.
    7. Usando una pipeta multicanal, añadir 15 μl de la mezcla final reparación/fosforilación maestra a cada fila de las muestras y mezclar 10 veces mediante pipeteo arriba y abajo. Cambio de puntas entre las filas. Sellar la placa con una cubierta de plástico, desactivación a 200 x g durante 1 min a 4 ° C e incubar a temperatura ambiente durante 30 minutos.
  2. Limpiar el grano después de la reparación final y fosforilación
    1. Desde la nevera de 4 ° C, recuperar la solución grano magnético PEG/1 M de NaCl al 20% y 30% PEG/1 M NaCl solución e incubar a temperatura ambiente durante al menos 30 minutos.
      Nota: La solución PEG/1 M de NaCl al 30% no contienen granos magnéticos.
    2. Después de que ambas soluciones alcancen la temperatura ambiente, para cada muestra preparar 80 μl de mezcla de 1:2 de 30% PEG/1 M de NaCl y 20% PEG/1 M NaCl grano magnético soluciones. Un ejemplo para 24 muestras: 80 μl x 24 = 1.920 μl (μL 640 30% PEG/1 M NaCl y 1.288 μl de soluciones de grano magnético de PEG/1 M NaCl 20%).
    3. Alícuota la solución grano mezcla, igual volumen, en una fila de una placa de 96 pocillos embalse y mantener a temperatura ambiente. Alícuota buffer EB (40 μl por muestra x # de filas) en una fila de una placa de 96 pocillos limpia depósito. Un ejemplo de dos filas: 40 μl x 2 = 80 μL/pocillo.
    4. Usando una pipeta multicanal, añadir 75 μl de la mezcla de grano preparada en paso 4.2.2 en cada fila de las muestras del paso 4.1.7 y mezclar por 10 veces. Cambio de puntas entre las filas. Incubar a temperatura ambiente durante 15 min continuar con el procedimiento de limpieza de grano, como se indica en pasos 3.3.3-3.3.10. Cubra la placa con un sello plástico, vuelta rápida y coloque en hielo. Proceda al paso 4.3.
  3. Reacción A tizón
    1. Recuperar en el congelador de-20 ° C todos los reactivos (excepto enzimas) necesarios para la reacción A tizón (Tabla 7), descongelar a temperatura ambiente y transferir inmediatamente hielo.
    2. Trabajando en el hielo, sigue Tabla 7 para configurar el relave A Master Mix en un tubo de microcentrífuga de 1,5 mL estéril. Siga las instrucciones de configuración general preparación enzimática como se indica en pasos 4.1.4-4.1.6.
    3. Usando una pipeta multicanal, añadir 15 μl A tizón Master Mix a cada fila de las muestras y mezclar 10 veces mediante pipeteo arriba y abajo. Cambio de puntas entre las filas. Sellar la placa con una cubierta PCR, desactivación a 200 x g durante 1 min a 4 ° C e incubar en un termociclador a 37 ° C durante 30 minutos. Después de la incubación, la placa de la vuelta abajo a 200 x g durante 1 minuto y mantenerlo a temperatura ambiente.
  4. Limpiar el grano después de relaves A
    1. Siga los pasos descritos en el paso 4.2. Cubra la placa con un sello plástico, vuelta rápida "A cola + BC", la etiqueta y coloque en hielo. Continúe con el paso 4.5.
  5. Ligadura de adaptador
    1. Recuperar en el congelador de-20 ° C todos los reactivos (excepto enzimas) necesarios para la reacción de la ligadura de adaptador (Tabla 8), descongelar a temperatura ambiente y transferir inmediatamente hielo.
    2. Recuperar 10 μm PE adaptador (suplemento tabla 1) solución y diluir a 0.5 μm utilizando EB. Mezclar bien todo con un vórtex de pulso. El volumen requerido es de 3 μl x # de muestras. Trabajo en hielo, alícuota el adaptador de 0.5 μm PE, igual volumen, en 12 pocillos de una placa de 96 pocillos limpia depósito. Mantener en hielo.
    3. Trabajando en el hielo, sigue Tabla 8 para configurar el adaptador de la ligadura de Master Mix en un tubo de microcentrífuga de 1,5 mL estéril. Siga las instrucciones de configuración general preparación enzimática como se indica en pasos 4.1.4-4.1.6. Asegúrese de que el 5 X Buffer de ligadura rápida es completamente descongelada y bien mezclado antes de usar.
    4. En el hielo, alícuota un volumen adecuado del adaptador ligadura de Master Mix en una fila de una placa de 96 pocillos depósito nuevo. Por ejemplo, cálculo de dos filas: (23 μl x 2) + 5 μl = 51 μL/pocillo. Mantenga la placa de hielo.
    5. Utilizando una pipeta multicanal, añadir 2 μl de las 0,5 μm adaptador extremo apareado (PE) en cada fila de las muestras de paso 4.4.1 y mezcla. Cambio de puntas entre las filas.
    6. Usando una pipeta multicanal, añadir 23 μl de adaptador ligadura Master Mix a cada fila de las muestras y mezclar 15 veces transfiriendo hacia arriba y hacia abajo. Cambio de puntas entre las filas. Selle la placa con una cubierta del metal, etiqueta "Ligadura", giro de a 200 x g durante 1 min a 4 ° C e incubar a temperatura ambiente durante la noche.
  6. Día 4: Grano limpiar #1 después de la ligadura de adaptador
    1. Desde la nevera de 4 ° C, recuperar la solución grano magnético PEG/1 M de NaCl al 20% e incubar a temperatura ambiente durante al menos 30 minutos. Mientras que la solución es equilibrar preparar fresco 70% EtOH.
    2. Alícuota de la solución de grano magnético 20% PEG/1 M de NaCl, 55 μl por muestra, en una fila de un depósito de 96 pocillos de la placa y mantener a temperatura ambiente. Un ejemplo de dos filas: 55 μl x 2 = 110 μL/pocillo.
    3. Tampón EB alícuota, 50 μL por muestra, en una fila de una placa de 96 pocillos limpia depósito. Un ejemplo para dos hileras: 50 μl x 2 = 100 μL/pocillo.
    4. Usando una pipeta multicanal, añadir 48 μl de la solución grano magnético PEG/1 M de NaCl al 20% en cada fila de las muestras en la placa de la ligadura del paso 4.5.6 y mezclar hacia arriba y abajo 10 veces. Cambio de puntas entre las filas. Incubar a temperatura ambiente durante 15 min continuar con el procedimiento de limpieza de grano, como se indica en pasos 3.3.3-3.3.7.
    5. Tomar la placa del imán de la placa y con una pipeta multicanal, añadir 45 μl EB (Tabla de materiales). Mezclar por pipeteo 10 veces hacia arriba y hacia abajo. Cambio de puntas entre las filas. Incubar a temperatura ambiente durante 3 min eluir.
    6. Después de la incubación, coloque la placa de reacción de IP en el imán de la placa e Incube por 2 minutos utilizando una pipeta multicanal, sin molestar a los granos, transferir cuidadosamente el sobrenadante en los pocillos correspondientes de una nueva placa de 96 pocillos. Etiqueta de la placa "Ligadura + 1 A.C.".
    7. A cada pocillo añadir 5 μl de buffer de alta fidelidad de x PCR 10 y mezclar bien mediante pipeteo arriba y abajo. Cambio de puntas entre las filas. Cubra la placa con un sello plástico, vuelta rápida y guardar a temperatura ambiente.
  7. Grano de limpiar #2 después de la ligadura de adaptador
    1. Realizar limpiar el grano, como se describe en la sección 4.6 con las siguientes modificaciones: Añadir 60 μL de solución al 20% PEG/1 M NaCl grano magnético a cada pozo activo en la ligadura + placa de 13:00 (paso 4.6.7) y responsables de los granos usando 35 μl de tampón de EB. Etiqueta de la placa "Ligadura + 2 BC" y mantenerlo en hielo.
  8. Amplificación por PCR
    1. Recuperar en el congelador de-20 ° C todos los reactivos (excepto enzimas) necesarios para la reacción de PCR (Tabla 9), descongelar a temperatura ambiente y colóquelos inmediatamente en hielo.
    2. Trabajando en hielo, siga la Tabla 9 para configurar la PCR Master Mix en un tubo de microcentrífuga de 1,5 mL estéril. Siga las instrucciones de instalación preparación general como se indica en pasos 4.1.4-4.1.5. En el hielo, alícuota un volumen adecuado de PCR Master Mix en una fila de una placa de 96 pocillos depósito nuevo. Mantener en hielo. Consulte el paso 4.5.4 para cálculos de la muestra.
    3. Trabajando en el hielo, utilizando una pipeta multicanal, añadir 2 μl de cada única 12.5 μm PCR inversa indexación cartilla (tabla 2 suplementaria) en cada pocillo de la ligadura + placa BC 2 (paso 4.7.1) y mezclar lentamente arriba y abajo. Cambio de puntas entre las filas. Mantenga la placa de hielo.
    4. Trabajo en el hielo, utilizando una pipeta multicanal, añadir 23 μl de la mezcla principal de PCR en cada fila de las muestras de paso 4.8.3 y mezcla 10 veces mediante pipeteo arriba y abajo. Sellar la placa con una cubierta PCR, desactivación a 200 x g durante 1 min e incubar en un termociclador (véase la tabla 10 para ciclismo condiciones PCR).
  9. Limpiar el grano después de la amplificación por PCR
    1. Después de la amplificación por PCR de la vuelta la placa a 200 x g durante 1 min, 4 ° C. Realizar el grano de limpiar como se describe en la sección 4.6 con las siguientes modificaciones: Añadir 51 μl de solución grano magnético PEG/1 M de NaCl al 20% a cada reacción de PCR y responsables de los granos con 25 μl de tampón de EB. Sellar la placa con una cubierta de aluminio y desactivación a 200 x g para 1 minuto tienda las muestras a-20 ° C.
    2. Para validar las bibliotecas construidas, realizar la cuantificación de ADN usando un análisis basado en la fluorescencia, visualizar el producto final utilizando un analizador de electroforesis capilar basadas en chip (ensayo de alta sensibilidad) y ejecutar enriquecimiento PCR cuantitativa (qPCR) (véase Representante de resultados, validación de calidad de biblioteca ndChIP-seq por qPCR).

Representative Results

Perfiles de la digestión de la cromatina
Optimización de la digestión de MNase es esencial para el éxito de este protocolo. Es crucial para generar un perfil de digestión dominado por tamaños de fragmento de solo de nucleosoma, mientras que no demasiado digeridos, para permitir la recuperación de fragmentos de nucleosoma de orden superiores. Un perfil ideal de la digestión consiste en una mayoría de fragmentos de nucleosoma solo con una pequeña fracción que representan fragmentos más pequeños y más grandes que los nucleosomas individuales. La figura 1 muestra ejemplos de una perfiles de distribución de tamaño ideal, demasiado digerido y digerido bajo. Tenga en cuenta que la digestión subóptima de la cromatina también será evidente en el perfil de la biblioteca de secuencia generado por el material IP (figura 2).

Validación de la calidad de biblioteca ndChIP-seq por qPCR
qPCR es un método bien establecido para la evaluación de la calidad del ChIP18,19,20. Cuándo realizar ndChIP seq en 10.000 células la producción de ácido nucleico después IP estará por debajo de 1 ng. Por lo tanto, es imprescindible realizar qPCR después de la construcción de la biblioteca para evaluar el enriquecimiento relativo de las regiones de destino sobre fondo. Para proporcionar una estimación de fondo, se generan las bibliotecas construidas a partir de la cromatina MNase digerido (entrada). Para cada biblioteca IP, se necesitan dos sistemas de cartillas (véase suplementariacuadro 3 para una lista de cebadores para las marcas de histona utilizados). Un primer conjunto debe ser específico para una región genómica que está consistentemente asociada con la modificación de la histona de interés (meta positiva) y otra región que no está marcado con la modificación de la histona de interés (target negativo). Se evaluó la calidad de la biblioteca de ChIP-seq como doble enriquecimiento con respecto a la entrada biblioteca. Doble enriquecimiento puede calcularse utilizando la siguiente ecuación que asume la amplificación exponencial de la región genómica de destino: 2 delCtentrada-CtIP. Nuestra costumbre hizo el paquete de software estadístico R, qcQpcr_v1.2, es conveniente para el análisis del enriquecimiento de qPCR de baja entrada nativa ChIP-seq las bibliotecas (Archivos suplementarios). Figura 3 representa un resultado de qPCR para bibliotecas de ChIP-seq exitosos y fracasados. El valor mínimo esperado doble enriquecimiento bibliotecas ndChIP seq de buena calidad son 16 para las marcas estrechas, como H3K4me3 7 para grandes marcas, por ejemplo H3K27me3.

Modelado MNase accesibilidad
Análisis computacional de ChIP-seq es compleja y única para cada ajuste experimental. Un conjunto de pautas establecidas por el consorcio internacional de epigenómica humana (IHEC) y enciclopedia el de elementos de ADN (ENCODE) puede utilizarse para evaluar la calidad del ChIP-seq bibliotecas21. Es importante tener en cuenta que la profundidad de la secuencia de las bibliotecas afecta la detección y resolución de las regiones enriquecido20. El número de picos detectado aumento y una meseta acerca a medida que aumenta la profundidad de lectura. Recomendamos las bibliotecas ndChIP-seq para ser ordenados conforme a las recomendaciones de la IHEC de 50 millones emparejado-Lee (fragmentos 25 millones) para las marcas estrechas (por ejemplo, H3K4me3) y 100 millones emparejado-Lee (fragmentos 50 millones) para las grandes marcas ( por ejemplo,, H3K27me3) y22. Estas profundidades de secuenciación proporcionan suficiente alineaciones de la secuencia para la detección de los picos más significativos utilizando ampliamente utilizan que llaman de pico ChIP-seq, como MACS2 y HOMER, sin llegar a saturación23,24. Una biblioteca de mamíferos ndChIP-seq de alta calidad tiene un PCR duplicados de < 10% y referencia genoma alineación de > 90% (incluyendo lecturas duplicadas). Bibliotecas de éxito ndChIP-seq contendrá repeticiones altamente correlacionadas con una porción significativa (> 40%) de picos Lee alineada dentro de MACS222 identificado enriquecido e inspección de Lee alineado en un browser del genoma debe revelar visualmente enriquecimientos detectables en comparación con la biblioteca de entrada (figura 4). Además, ndChIP-seq puede utilizarse para evaluar la densidad de nucleosoma utilizando un algoritmo de distribución Gaussian de la mezcla (w1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) identificado en MACS2 regiones enriquecidas a densidad de nucleosoma modelo definidos por límites accesibles MNase. En este modelo, w1 representa el peso de mono-nucleosoma distribución y w2 representa peso de distribución di-nucleosoma. Donde w1 es mayor que w2, hay dominancia de fragmentos de mono-nucleosoma y viceversa. Este análisis requiere que las bibliotecas ser secuenciadas de manera final emparejado para que tamaños de fragmento pueden ser definidos. Para aplicar el algoritmo de distribución Gaussian de la mezcla, primero se identifican regiones enriquecidas estadísticamente significativas. Sugerimos llamar pico con MACS2 con entrada como control y con la configuración predeterminada para marcas estrechas y un atajo de q valor de 0,01 para las grandes marcas. Una serie de paquetes estadísticos empleando un algoritmo de distribución Gaussian de la mezcla es de paquetes de software estadístico utilizado. Tamaño del fragmento promedio, determinado por límites leerlas final emparejado de las muestras de IPed, distribuciones en MACS2 identificaron promotores enriquecidos, y un algoritmo de distribución Gaussian de la mezcla puede ser aplicado a cada promotor utilizando el paquete estadístico R Mclust versión 3.025 para calcular una distribución ponderada. En esta aplicación, recomendamos eliminar los promotores que contiene menos de 30 fragmentos alineados porque debajo de este umbral el peso resultante las estimaciones son poco fiables. Una biblioteca de calidad buena ndChIP-seq genera una distribución Gaussian de la mezcla que consisten en dos componentes principales con valores promedio correspondientes a mono-, longitud de fragmento de di-nucleosoma.

Figure 1
Figura 1 : Evaluación de la digestión de MNase antes de generación biblioteca. Perfiles de analizador de electroforesis capilar basado en el chip de un MNase óptimo digestión (A), bajo-digestión (B) y demasiado digestión (C) la cromatina. Réplicas biológicas se muestran como rastros de azul, rojos y verdes. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Evaluación de la digestión MNase tras generación biblioteca. (A) publicar perfiles de construcción de biblioteca de entrada óptimo digerido (réplicas biológicas; rojo, verde y negro) y IP (réplicas biológicas; cian, púrpura, azul) y (B) óptimo (réplicas biológicas; rojo, verde, azul) y IP ( réplicas biológicas; bibliotecas de ciánico, púrpuras, naranja). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Post construcción biblioteca PCR cuantitativa puede utilizarse para evaluar la calidad de las bibliotecas ndChIP seq. Doble enriquecimiento de bibliotecas H3K4me3 IP con respecto a las bibliotecas de entrada se calcula como 2(Ct de entrada - Ct de IP) objetivos positivos y negativos usando qcQpcr_v1.2. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Representante ndChIP-seq biblioteca construido a partir de 10.000 CD34 primaria+ células de la sangre de la cuerda. Correlación de Pearson de señal H3K4me3 (Lee por Lee asignado millones) en los promotores (SAT +-2Kb) entre 3 repeticiones biológicas, repetición (A) 1 y 2, (B) repetir 1 y 3, repetición (C) 2 y 3. (D) UCSC vista del explorador de la agrupación del gen HOXA de reticulado ChIP-seq generados a partir de 1 millón de células por éxito ndChIP-seq de 10.000 células por IP, IP y fracasada ndChIP-seq de 10.000 células por IP. (rojo: H3K27me3, verde: H3K4me3 y negro: entrada). (E) fracción de lecturas asignadas dentro de MACS2 había identificado regiones enriquecidas de H3K4me3 (negro) y H3K27me3 (gris). Haga clic aquí para ver una versión más grande de esta figura.

Composición del buffer
A.1. amortiguamiento de inmunoprecipitación (IP)
20 mM Tris-HCl de pH 7.5
2 mM EDTA
150 mM NaCl
0,1% Tritón X-100
0.1% desoxicolato
Butirato de sodio 10 mM
A.2. tampón de lavado sal baja
20 mM Tris-HCl de pH 8.0
2 mM EDTA
150 mM NaCl
1% Tritón X-100
0.1% SDS
A.3. tampón de lavado sal alta
20 mM Tris-HCl de pH 8.0
2 mM EDTA
500 mM NaCl
1% Tritón X-100
0.1% SDS
A.4. tampón de elución de ChIP
100 mM NaHCO3
SDS 1%
A.5. 1 x de tampón de lisis – 1 mL
0,1% Triton
0.1% desoxicolato
Butirato de sodio 10 mM
A.6. tampón de dilución de Ab
0.05% (w/v) azida de
0.05% amplio espectro antimicrobiano (por ejemplo, ProClin 300)
en PBS
A.7. 30% solución de grano magnético PEG 1M NaCl (referencia16)
30% PEG
NaCl de 1 M
10 mM Tris HCl, pH 7,5
1 mM EDTA
1 mL de lavado súper paramagnéticas cuentas
A.8. 20% solución de grano magnético PEG 1M NaCl (referencia16)
30% PEG
NaCl de 1 M
10 mM Tris HCl, pH 7,5
1 mM EDTA
1 mL de lavado súper paramagnéticas cuentas

Tabla 1: composición de búfer de ndChIP seq.

Modificación de histonas Concentración (μg/μl)
H3K4me3 0,125
H3K4me1 0.25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabla 2: Cantidad de anticuerpos necesario para ndChIP-SS.

Reganet Volumen (μL)
Agua ultra pura 478
1 M Tris-HCl, pH 7,5 10
0, 5 EDTA M 10
NaCl de 5 M 2
Glicerol 500
Volumen total 1.000

Tabla 3: Receta para el tampón de dilución de MNase.

Reactivo de Volumen (μL)
Agua ultra pura 13
20 mM TDT 1
10 x Buffer de MNase 4
20 U/μl Mnase 2
Volumen total 20

Tabla 4: Receta para MNase Master Mix.

Reactivo de Volumen (μL)
Tampón de elución 30
G2 de búfer 8
Proteasa 2
Volumen total 40

Tabla 5: Receta de mezcla maestra de purificación de ADN.

Reactivo de Volumen (μL)
Agua ultra pura 3.3
10 x Buffer de restricción endonucleasa (p. ej. NEBuffer) 5
25 mM ATP 2
10 mM dNTPs 2
T4 Polinucleótido kinasa (10 U/μL) 1
Polimerasa de la DNA de T4 (3 U/μL) 1.5
ADN polimerasa I, fragmento grande (Klenow) (5 U/μL) 0.2
Volumen total 15

Tabla 6: Receta de mezcla maestra de reparación final.

Reactivo de Volumen (μL)
Agua ultra pura 8
10 x Buffer de restricción endonucleasa (p. ej. NEBuffer) 5
10 mM dATP 1
Klenow (3' - 5' exo-) 1
Volumen total 15

Tabla 7: Receta para un tizón Master Mix.

Reactivo de Volumen (μL)
Agua ultra pura 4.3
5 x buffer de ligadura rápida 12
Ligase de la DNA de T4 (2000 U/μL) 6.7
Volumen total 23

Tabla 8: Receta para el adaptador de la ligadura de Master Mix.

Reactivo de Volumen (μL)
Agua ultra pura 7
25 uM primer PCR 1.0 2
5 x buffer de HF 12
DMSO 1.5
Polimerasa de la DNA 0.5
Volumen total 23

Tabla 9: Receta para PCR Master Mix.

Temprature (° C) Duración (s) Número de ciclos de
98 60 1
98 30
65 15 10
72 15
72 300 1
4 Mantenga Mantenga

Tabla 10: PCR ejecutar método.

Oligo Secuencia de Modificación
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 ' 5' modificación: fosforilación
PE_adapter 2 5' - ACA CTC TTT CCC ACG TAC ACG CTC TTC CGA TC * T - 3' 3' modificación: * T es un bono fosfotioato

Suplemento tabla 1: Secuencias de Oligo para generación de adaptador de PE.

Primer nombre Secuencia de Índice IndexRevC (para utilizarse en la secuencia)
Polimerización en cadena inversa indexación cartilla 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
Polimerización en cadena inversa indexación cartilla 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
Polimerización en cadena inversa indexación cartilla 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
Polimerización en cadena inversa indexación cartilla 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
Polimerización en cadena inversa indexación cartilla 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
Polimerización en cadena inversa indexación cartilla 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
Polimerización en cadena inversa indexación cartilla 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
Polimerización en cadena inversa indexación cartilla 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
Polimerización en cadena inversa indexación cartilla 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
Polimerización en cadena inversa primer indexación 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
Polimerización en cadena inversa primer índice 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
Polimerización en cadena inversa indexación cartilla 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
Polimerización en cadena inversa indexación primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
Polimerización en cadena inversa primer índice 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
Polimerización en cadena inversa indexación cartilla 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
Polimerización en cadena inversa primer indexación 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
Polimerización en cadena inversa primer indexación 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
Polimerización en cadena inversa primer índice 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
Polimerización en cadena inversa primer índice 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
Polimerización en cadena inversa indexación cartilla 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
Polimerización en cadena inversa primer índice 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
Polimerización en cadena inversa primer índice 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
Polimerización en cadena inversa indexación cartilla 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
Polimerización en cadena inversa primer índice 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Tabla adicional 2: PCR inversa indexación secuencias de la cartilla.

Cartillas de Secuencia de
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Modificación de histonas Objetivo positivo Objetivo negativo
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Tabla adicional 3: Una lista de cebadores para las marcas de histona utilizados (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 y H3K36me3).

Archivo suplementario 1: hoja de cálculo ndChIP-seq. Haga clic aquí para descargar este archivo.

Archivos de código adicionales: qcQpcr_v1.2. Paquete de software estadístico R para el análisis del enriquecimiento de qPCR de baja entradas bibliotecas nativas de ChIP-seq. Haga clic aquí para descargar este archivo.

Discussion

Dada la naturaleza combinatoria de la modificación de la cromatina y en la regulación transcripcional del nucleosoma, un método que permite mediciones simultáneas de estas características es probable que proporcionar nuevas penetraciones en la regulación epigenética. El protocolo de ndChIP-seq presentado aquí es un protocolo nativo de ChIP-seq optimizado para permitir la interrogación simultánea de la modificación de las histonas y la densidad de nucleosoma en células primarias9,10. ndChIP-seq utiliza la digestión enzimática de la cromatina que, cuando está juntado a secuenciación masivamente paralela extremo apareado y un modelo de distribución Gaussian de la mezcla, permite las modificaciones de las histonas de investigación a nivel individual nucleosoma y la deconvolución de perfiles epigenómica impulsado por heterogeneidad dentro de una población. Mediante este protocolo, hemos divulgado previamente una única distribución de tamaños de fragmento precipitado inmuno, determinado por extremo apareado leer límites, asociados con Estados de cromatina específico definidos por la ChromHMM10,24.

La calidad de una biblioteca de ndChIP-seq depende de múltiples factores, tales como especificidad de anticuerpo y sensibilidad, condiciones óptimas de digestión MNase y calidad de la cromatina. La especificidad de los anticuerpos utilizados es crucial en la producción de éxito ndChIP-seq biblioteca. Un anticuerpo ideal muestra alta afinidad contra el epitopo de interés con poca reactividad cruzada con otros epitopos. Es igualmente importante seleccionar granos magnéticos con la afinidad más alta para el anticuerpo de la opción.

MNase la digestión es una reacción crítica y sensibles al tiempo y concentración en el presente Protocolo. Por lo tanto, al procesar las muestras múltiples, es importante que cada reacción se incuba durante un tiempo equivalente (véase el paso 2.2). La calidad de la cromatina es otro factor que afecta significativamente el resultado de ndChIP-SS. fragmentado cromatina provoca un óptimo Perfil de digestión MNase y resultados en las bibliotecas con una baja relación señal a ruido. Muestras primarias con baja viabilidad celular o degradan la cromatina, como formalina-fijo tejido parafina-encajado de (FFPE) no se recomiendan para este protocolo.

La adición de una foto durante la extracción de cromatina reduce indeseado (es decir, al azar) cromatina fragmentación y conserva la integridad de colas de las histonas. Como tal, PIC debe agregarse al tampón de lisis y almacenador intermediario de la inmunoprecipitación justo antes de usar. Mientras que selecciona las células mediante citometría de flujo, seleccione para células viables y asegúrese de células se ordenan en un índice del flujo bajo para aumentar la precisión de la estimación del número de celular y viabilidad de las células. Evitar clasificar las células directamente en tampón de lisis. El búfer de vaina diluiría el tampón de lisis y evita eficaz permeabilización de la membrana celular a MNase. Dependiendo de un tipo de células u organismo, se requiera la titulación de MNase para obtener una óptima digestión.

ndChIP-seq en células de mamíferos requiere una profundidad mínima secuencia de 50 millones emparejado-Lee (fragmentos 25 millones) para marcas estrechas y Lee emparejado 100 millones (50 millones de fragmentos) para la entrada y grandes marcas. El algoritmo de distribución Gaussian de la mezcla no funcionará óptimamente en las bibliotecas que han sido ordenadas a una profundidad significativamente por debajo de esta recomendación. ndChIP-seq no va clasificar promotores con poca separación entre el valor de la distribución ponderada de mono - y di-nucleosoma fragmento longitudes en mono - o di-nucleosoma dominado promotores. Por lo tanto, estos promotores deben eliminarse en el análisis posterior. Réplicas biológicas pueden generarse para aumentar la confianza en las distribuciones previstas e identificar variabilidad técnica en la construcción de la digestión y la biblioteca de MNase.

A diferencia de las anteriores iteraciones de protocolos nativos de ChIP-seq, seq ndChIP proporciona los medios para investigar efecto combinatorio de modificación de estructura y las histonas de la cromatina mediante la utilización de fragmento tamaño post inmunoprecipitación para integrar la densidad de nucleosoma, determinada por la accesibilidad de MNase, con medidas de modificación de las histonas. Aplicación de ndChIP-seq para primaria de células y tejidos será proporcionar nuevas penetraciones en la naturaleza integradora de la regulación epigenética y permitir la identificación de la firma epigenética debido a la heterogeneidad de la población.

Disclosures

Los autores declaran que no tienen intereses financieros que compiten.

Acknowledgements

A.L. fue apoyado por una beca de postgrado canadiense de los institutos canadienses de investigación en salud. Este trabajo fue financiado por becas del genoma British Columbia y los institutos canadienses de investigación en salud (CIHR-120589) como parte de la canadiense epigenética, medio ambiente y Consorcio iniciativa de investigación en salud y por el programa de Instituto de investigación de Terry Fox Proyecto beca #TFF-122869 M.H. y un Instituto de investigación de Terry Fox nuevo investigador Premio (Grant # 1039) a M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics