Generation af indfødte kromatin Immunoprecipitation sekventering biblioteker for Nucleosome tæthed analyse

Genetics
 

Summary

Vi præsenterer en modificeret indfødte kromatin immunoprecipitation sekventering (ChIP-seq) metode for generation af sekvens datasæt egnet til en nucleosome tæthed ChIP-seq analytiske rammer, som integrerer micrococcal nukleasen (MNase) tilgængelighed med Histon ændring målinger.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi præsenterer en modificeret indfødte kromatin immunoprecipitation sekventering (ChIP-seq) forsøgsplan kompatibel med en Gaussisk blanding distribution baseret analyse metodologi (nucleosome tæthed ChIP-seq; ndChIP-seq) der gør det muligt for generation af kombinerede målinger af micrococcal nukleasen (MNase) tilgængelighed med Histon ændring genome-wide. Nucleosome position og lokale tæthed og den posttranslationelle modifikation af deres Histon underenheder, handle i fællesskab for at regulere lokale transskription stater. Kombinatorisk målinger af nucleosome tilgængelighed med Histon ændring genereret af ndChIP-seq muliggør samtidige afhøring af disse funktioner. NdChIP-seq metode kan anvendes til et lille antal primærelementer utilgængelige for danne tvaerbindinger baseret ChIP-seq protokoller. Tilsammen, muliggør ndChIP-seq måling af Histon ændring i kombination med lokale nucleosome tæthed til at opnå nye indsigter i fælles mekanismer, der regulerer RNA transskription inden for sjældne primære cellepopulationer.

Introduction

Det eukaryote genom er pakket ind i kromatin via gentagne nucleosome strukturer, der består af to kopier af fire Histon proteiner (fx, H2A, H2B, H3 og H4) afgrænset af 146 basepar af DNA1,2. Kromatin remodeling komplekser styre nucleosome position inden for gen promotor grænser og deltage i reguleringen af genekspression ved at ændre tilgængeligheden af DNA til transskriptionsfaktorer og RNA polymerase maskiner3, 4.

Amino terminal haler af histonerne inden for nucleosome udsættes for forskellige kovalente ændringer, herunder acetylation, methylering, fosforylering, ubiquitylation, sumoylation, formylation og hydroxylering af bestemte aminosyrer5 , 6 , 7 , 8. holdninger og grader af disse ændringer diktere en kromatin tilstand, der påvirker kromatin struktur og kontrol adgang af de molekylære komplekser, der tillader aktivering af transskription7. I betragtning af at begge nucleosome tæthed og Histon ændring spiller en rolle i den lokale kontrol af genet transskription, udviklede vi en native ChIP tilgang, der muliggør samtidige måling af nucleosome tæthed og Histon ændring9, 10.

Native ChIP-seq udnytter liv1975 micrococci nukleasen (MNase) til at fordøje intakt kromatin i sin oprindelige tilstand inden for kernen11,12, en egenskab, der har været gearede til at tilknytte nucleosome positionering13 , 14 , 15. nucleosome tæthed ChIP-seq (ndChIP-seq) tager fordel af præferentiel adgang for MNase til at åbne områder af kromatin at generere målinger, der kombinerer MNase tilgængelighed med Histon ændring10ejendom. ndChIP-seq er velegnet til profilering af Histon ændringer i sjældne primære celler, væv og dyrkede celler. Vi præsenterer her, en detaljeret protokol, der giver mulighed for generation af sekvens datasæt egnet til en tidligere beskrevet analytiske ramme arbejde10 , der integrerer fragment størrelse post immunoprecipitation, bestemmes af parret-end læse grænser, at samtidig undersøge MNase tilgængelighed med Histon ændring målinger. Tidligere anvendelse af denne protokol på 10.000 primære menneskelige navlestrengsblod afledt CD34+ celler og humane embryonale stamceller afslørede unikke relationer mellem kromatin struktur og Histon ændringer inden for disse celle typer10 . Grund af dens evne til samtidig måle nucleosome tilgængelighed og Histon ændring, ndChIP-seq er i stand til at afsløre epigenomiske funktioner i en celle population på et enkelt nucleosome niveau, og løse heterogene underskrifter ind i deres konstituerende elementer. Et eksempel på udforskning af heterogene cellulære populationer af ndChIP-seq er undersøgelse af bivalent initiativtagere, hvor både H3K4me3, en aktiv mark og H3K27me3, en undertrykkende mark, er nuværende10.

Protocol

Bemærk: Minimum input for denne protokol er 10.000 celler pr. enkelt immuno-nedbør (IP) reaktion. Udskrive den medfølgende eksperimentelle regneark og udnytte som en retningslinje til at planlægge ud i eksperimentet. Inkubationer ved stuetemperatur antages for at være på ~ 22 ° C. Alle buffer opskrifter er fastsat i tabel 1. Alle bufferne skal opbevares ved 4 ° C og opbevares på is under proceduren, medmindre andet er angivet.

1. celle forberedelse

  1. Dyrkede celler
    1. Cellerne vaskes med 1 mL af fosfat buffer saltvand (PBS) og præcist bestemme celle koncentrationen ved hjælp af en hemocytometer. Hvis der er mere end en million celler, øge omfanget af PBS.
    2. Baseret på celletal, alikvot en svarer til 70.000-100.000 celler ind i en sterile 1,5 mL tube, og spin-ned på 500 x g for 6 min. ved 4 ° C. Ved hjælp af en pipette, langsomt fjerne og supernatanten (uden at forstyrre den celle pellet) og resuspenderes i iskold lysisbuffer + 1 x protease hæmmer cocktail (PIC) til en koncentration af 1000 celler / µL. Bland godt af pipettering op og ned ad 20-30 gange. Det er afgørende, at celle klumper er forstyrret. Prøv ikke at skabe bobler.
    3. Fortsætte direkte til dag 1 (afsnit 2) i protokollen om ndChIP-seq eller flash fryse celle pellet i flydende nitrogen og opbevares ved-80 ° C.
  2. Sorterede celler
    1. Indsamle 70.000-100.000 sorteret16 celler ind i en 1,5 mL rør med 350 µL af Hank's salt bufferopløsning (HBSS), eller PBS + 2% føtal bovint serum (FBS).
    2. Spin ned hver celle alikvot på 500 x g for 6 min. ved 4 ° C. Ved hjælp af en pipette, langsomt Fjern supernatanten (uden at forstyrre den celle pellet) og resuspend i iskold lysisbuffer + 1 x PIC til en endelig koncentration på 1000 celler / µL. Bland godt i lysisbuffer af pipettering op og ned 20 - 30 gange. Sikre, at cellen klumper er forstyrret. Prøv ikke at skabe bobler.
    3. Fortsætte direkte til dag 1 (afsnit 2) i protokollen om ndChIP-FF., eller flash fryse celle pellet i flydende nitrogen og opbevares ved-80 ° C.

2. dag 1: ndChIP-seq

  1. Forberedelse af antistof-perle kompleks
    1. Forberede et 37 ° C vandbad og en isspand. Arbejder på is, forberede 1 x IP buffer/1 x PIC og 1 x antistof (Ab) fortynding buffer, og holde dem på is. Hente Protein A (eller G) magnetiske perler (Se diskussion for udvælgelseskriterier) fra 4 ° C opbevaring og mix meget godt af blid pulse-vortexing. Hold det på køl.
      Bemærk: Pulse-vortexing betyder, at vortexing er stoppet hver gang en fuld vortex dannes i røret.
    2. Overføre 24 µL af Protein A (eller G) magnetiske perler per IP reaktion ind i et nyt 2 mL rør. Registrere omfanget af perler og holde røret på is. For eksempel, for 7 IPs, bruge 24 µL x 7 = 168 µL.
    3. Røret anbringes på tube magnet og vente på opklaring at blive klar angivelse perle adskillelse. Uden at forstyrre perlerne, omhyggeligt Fjern supernatanten ved hjælp af en pipette og kassér. Tage tube off tube magnet og placere den på is.
    4. Tilføje en tilsvarende mængde (dvs., første bind af perler) iskold IP buffer + 1 x PIC mix. Mix af pipettering op og ned. Gør ikke vortex.
    5. Placere den IP buffer + 1 x PIC + perler tilbage på tube magnet og vente på opklaring at blive klar angivelse perle adskillelse. Uden at forstyrre perlerne, omhyggeligt Fjern supernatanten ved hjælp af en pipette og kassér. Gentag kolde IP buffer + 1 X PIC vask, to gange mere for i alt 3 vasker.
    6. Efter den sidste vask, resuspend perler i en tilsvarende mængde (dvs., første bind af perler) iskold IP buffer + 1 x PIC mix. Mix af pipettering op og ned. Gør ikke vortex. Hold røret på is.
    7. På is, hæld 10 mL af IP buffer + PIC i en 25 mL V-formet reservoir. Ved hjælp af en multikanalpipette, tilføje 130 µL af iskold IP buffer + 1 x PIC mix i individuelle brønde på en ren V-bund 96-brønd plade. Udfylde et godt pr. IP. Mærke pladen som "Ab-perle complex".
    8. Tilføj 12 µL af den vasket Protein A (eller G) magnetiske perler i hver godt indeholder IP buffer + PIC, og mix af pipettering op og ned. Holde de resterende vasket perler på is.
    9. Få validerede antistoffer fra deres kølelager og tø på is, hvis det kræves. Arbejder på is, fortyndes antistoffer med 1 x Ab fortynding buffer til de koncentrationer, der er vist i tabel 2.
    10. Hver brønd af Ab-perle komplekse plade, tilføje 1 µL af de relevante, fortyndede antistof (tabel 1). Optage godt til nøglen antistof. Ved hjælp af multikanalpipette mix hver række af pipettering op og ned ad 20 gange. Ændre tips mellem rækkerne. Forsegle Ab-perle komplekse pladen meget godt med en aluminium plade cover og inkuberes ved 4 ° C på en roterende platform i mindst 2 timer.
      Bemærk: Denne inkubation kan fortsætte indtil klar til at starte trin 2.4.
  2. Celle lysis og kromatin fordøjelsen
    1. Arbejder på is, forberede 1 x lysisbuffer + 1 x PIC og 1 mL af MNase jeg fortynding buffer (tabel 3) og holde dem på is.
    2. Hente cell pellets,-80 ° C opbevaring (eller fra is, hvis frisklavet). Tø hver celle pellet i et 37 ° C vandbad til en 10 s og derefter overføre til is.
    3. Til hver celle pellet straks tilføje iskold 1 x lysisbuffer + 1 x PIC til en endelig koncentration på 10.000 celler/20 µL, og -mix 10 gange af pipettering op og ned, uden at skabe bobler. For 70.000 celler er den endelige rumfang f.eks 140 µL.
    4. Arbejder på is, alikvot 20 µL/brønd af den resulterende lysates ind i en 96-brønd plade. Dække pladen med en plast sæl og inkuberes i isbad i 20 min. etiket plade "MNase fordøjelsen" og optage brønde til en skabelon nøgle. For at sikre en nøjagtig timing af kromatin fordøjelsen reaktion, ikke går til fordøjelse med mere end 2 rækker af prøver ad gangen.
    5. Lige før 20 min lysis er komplet, fortyndes MNase jeg enzym med MNase jeg fortynding buffer, til en slutkoncentration på 20 U/µL, og holde det på is.
    6. Arbejder på is, forberede MNase jeg fordøjelsen master mix ifølge tabel 4 og alikvot 20 µL af mix pr. hver række af prøver plus 5 µL dødvolumen i en række i en 96-brønd reservoir pladen og holde det på is. To rækker, volumen skal være: (20 µL x 2) + 5 µL = 45 µL.
    7. Når lysates færdig med at inkubere, fjerne MNase fordøjelse plade fra isen. Ved hjælp af en multikanalpipette, tilføje 20 µL af MNase jeg fordøjelsen master mix i hver række af prøver, og bland 10 gange af pipettering op og ned. Ændre tips mellem rækkerne. Inkuber ved stuetemperatur i nøjagtigt 5 min.
    8. Efter 5 min, til reaktionen standses, brug en multikanalpipette til at tilføje 6 µL af 250 µM ethylendiamintetra syre (EDTA) i hver række af prøver og blande op og ned et par gange. Ændre tips mellem rækkerne. Efter EDTA tilsætning, skifte indstilling af pipetten til 20 µL og mix 10 gange af pipettering op og ned for at sikre en komplet stop for fordøjelsen reaktion. Ændre tips mellem rækkerne.
    9. Ved hjælp af en multikanalpipette til hver række i MNase tilføje udtog prøver, 6 µL af 10 x lysisbuffer og bland godt ved pipettering op og ned 10 gange. Dække med en plast sæl og inkuberes i isbad i 15 min.
  3. Input adskillelse og før clearing
    1. Efter 15 min inkubation, arbejder på is, pool alle brønde til den samme celle pellet/skabelon i en steril, pre kølet på is, 1,5 mL tube (forud mærket med skabelon-ID) og blandes grundigt, men langsomt ved hjælp af en pipette til at undgå vaskemiddel skummende.
    2. For hver celle pellet/skabelon, skal du overføre 8 µL af fordøjet kromatin ind i en ny steril, 0,5 mL tube (forud mærket med skabelon-ID) og opbevares ved 4 ° C natten over. Dette vil tjene som input kontrol.
    3. Distribuere den resterende mængde af den fordøjede kromatin i 48 µL delprøver, ind i en ny 96-brønd plade. Celle pellet/skabelon 1 går ind i wells A01-A06, celle pellet/skabelon 2 går i brønde A07-A12, osv. Optage brønde til en skabelon nøgle. Label pladen "Før clearing".
    4. Ved hjælp af en multikanalpipette, tilføje 120 µL 1 x IP Buffer + 1 x PIC og 12 µL af vasket Protein A (eller G) magnetiske perler i hvert hul i den Pre-clearing plade fra trin 2.3.3. Bland hver række af pipettering op og ned 10 gange. Ændre tips mellem rækkerne. Forsegle pladen meget godt med en aluminium plade cover og Ruger på en roterende platform ved 4 ° C i mindst 2 h.
  4. Immunoprecipitation reaktion
    1. Før du starter dette trin Sørg for, at den Ab-perle komplekse plade (trin 2.1.10) og før clearing plade (trin 2.3.4) har rugede for mindst 2 h. hurtig spin begge plader ved centrifugering for 10 s på 200 x g.
    2. Ab-perle komplekse pladen (fra trin 2.1.10) anbringes på en plade magnet og vente 15 s løsning at blive klar. Forsigtigt fjerne og supernatanten ved hjælp af en pipette uden at forstyrre perlerne. Fjerne pladen fra plade magnet og holde det på is.
    3. Før clearing reaktion pladen (fra trin 2.3.4) anbringes på en plade magnet og vente 15 s for perlerne at adskille og til løsningen at blive klar. Uden at forstyrre perlerne, omhyggeligt overføre supernatanten ved hjælp af en pipette til de tilsvarende wells Ab-perle komplekse plade opbevares på is og bland forsigtigt 15 gange af pipettering op og ned. Seal pladen godt med en aluminium plade cover og der inkuberes natten over (12-18 h) ved 4 ° C på en roterende platform. Re label plade "IP reaktion".

3. dag 2: ndCHIP-seq

  1. Vasker og eluering
    1. Angiv den varme mixer til 65 ° C. På is, forberede en saltfattig wash buffer og høj-salt wash buffer. Hurtig spin IP reaktion plade fra trin 2.4.3 for 10 s på 200 x g.
    2. IP reaktion pladen anbringes på en plade magnet og vente 15 s løsning at blive klar. Ved hjælp af en multikanalpipette, uden at forstyrre perlerne, forsigtigt fjerne og supernatanten. Tag pladen ud plade magnet og placere den på is.
    3. Til hver række af prøver i IP reaktion plade, Tilføj 150 µL af iskold saltfattig vaske buffer og mix langsomt 10 gange op og ned for at fuldt resuspend perlerne.
    4. Placere IP reaktion plade tilbage på plade magnet, vente på perler til at adskille, og ved hjælp af en multikanalpipette, uden at forstyrre perlerne fjerne og supernatanten. Pladen anbringes tilbage på isen og Gentag trin 3.1.3 og 3.1.4 i alt 2 vasker.
    5. På isen, til hver række af prøver i IP reaktion plade, Tilføj 150 µL af den høje salt vaske buffer og mix langsomt 10 gange af pipettering op og ned for at fuldt resuspend perlerne.
    6. Placere IP reaktion plade tilbage på plade magnet, vente på perler til at adskille, og ved hjælp af en multikanalpipette, uden at forstyrre perlerne fjerne og supernatanten. IP reaktion pladen anbringes på is og pre chill en nye 96-brønd plade ved siden af.
    7. Til hver række af prøver i IP reaktion plade, Tilføj 150 µL af den høje salt vaske buffer og mix langsomt 10 gange af pipettering op og ned for at fuldt resuspend perlerne. Efter resuspension, overføre hver række af prøver til den tilsvarende række i den nye, pre kølet, 96-brønd plade. Label pladen "IP reaktion". Kassér den gamle plade.
    8. Ny IP reaktion pladen anbringes på plade magnet og vente på perler til at adskille. Ved hjælp af en multikanalpipette, uden at forstyrre perlerne, forsigtigt fjerne og supernatanten. Holde pladen ved stuetemperatur.
    9. Til hver række af prøver i IP reaktion plade, tilføje 30 µL af ChIP eluering buffer (EB) og bland langsomt 10 gange af pipettering op og ned. Sørg for at forhindre boble dannelse.
    10. Forsegle pladen godt med en PCR dækning og inkuberes i en varme mixer på 65 ° C til 1,5 h med en blanding hastighed på 1.350 rpm.
    11. Efter 1,5 h inkubation, spin ned IP reaktion plade ved 200 x g i 1 min. ved 4 ° C. Ændre indstillingen af varme mixer til 50 ° C.
    12. Efter spin, IP reaktion pladen anbringes på en plade magnet og vente på opklaring at rydde. Ved hjælp af en multikanalpipette, uden at forstyrre perler, omhyggeligt overføre 30 µL af supernatanten ind i en ny 96-brønd plade. Bruge friske tips for hver række. Etiket pladen "IP reaktion" og opbevare det ved stuetemperatur.
  2. Protein fordøjelse
    1. Hente 30% PIND/1 M NaCl magnetisk bead17 (buffer sammensætning tabel) løsning fra 4 ° C køleskabet og opbevare det ved stuetemperatur i mindst 30 min. kritisk: sikre at den perle løsning fuldt til stuetemperatur før du fortsætter.
    2. Hente input kontrolprøver fra 4 ° C opbevaring (trin 2.3.2) og hurtig spin. Måle volumen ved hjælp af en pipette og tilføje ultrarent vand til hvert input kontrol for en endelige mængden af 30 µL. overføre input kontrolprøver forudvalgte input brønde (Tom brønde) i Undersøgelsesperioden reaktion plade (trin 3.1.12). Post at godt at prøve nøglen.
    3. På is, forberede Protein fordøjelse Master Mix som vist i tabel 5 og rumfanget af lig i en række i en 96-brønd reservoir plade.
    4. Ved hjælp af en multikanalpipette til hver række af prøver i IP reaktion plade, tilføje 40 µL af Protein fordøjelse Master Mix og mix langsomt 10 gange op og ned. Forsegle pladen godt med en PCR cover, spin ned på 200 x g i 1 min og inkuberes i en varme mixer ved 50 ° C i 30 min på 650 rpm. Mens pladen inkubere, forberede frisk 70% ethanol (EtOH) og opbevare det ved stuetemperatur.
    5. Efter 30 min inkubation er komplet, spin IP reaktion plade ved 200 x g i 1 minut, 4 ° C. Holde pladen ved stuetemperatur.
      Bemærk: Det samlede volumen skal være nu ~ 70 µL/brønd.
  3. Perle clean-up ved hjælp af 30% PIND/1 M NaCl magnetisk bead løsning
    1. Alikvot stuetemperatur 30% af PIND/1 M NaCl magnetisk bead løsning i en række i en ren 96-brønd reservoir plade (75 µL pr. prøve x # rækker).
    2. Arbejder ved stuetemperatur, ved hjælp af en multikanalpipette, tilføje 70 µL (1:1 forholdet) af 30% PIND/1 M NaCl magnetisk bead løsning til hver række af prøver i IP reaktion plade og bland 10 gange af pipettering op og ned. Ændre tips mellem rækkerne. Inkuber plade i 15 min. ved stuetemperatur.
    3. Pladen anbringes på plade magnet og Inkuber i 5 min at lade perlerne til at adskille.
    4. Ved hjælp af en pipette, uden at forstyrre perlerne, forsigtigt fjerne og supernatanten. Holde perlerne.
    5. Mens IP reaktion plade er stadig på plade magnet, ved hjælp af en multikanalpipette til hver række i prøver, Tilføj 150 µL af stuetemperatur 70% EtOH og Inkuber i 30 s. Efter 30 s, ved hjælp af en multikanalpipette, fjerne og supernatanten. Gentag dette trin en gang mere for en total af 2 vasker.
    6. Efter den anden EtOH vask, Ruger 'tør' pladen på plade magnet for 3 min. Inspicér visuelt plade for at sikre, at alle EtOH er fordampet. Hvis ikke, inkuberes plade i 1 min. over tørring perler resulterer i et lavere udbytte.
    7. Tag pladen ud plade magnet og ved hjælp af en multikanalpipette, tilføje 35 µL EB (Tabel af materialer). Bland godt af pipettering 10 gange op og ned. Ændre tips mellem rækkerne. Inkuber ved stuetemperatur i 3 min. at eluere.
    8. Efter inkubationen placere IP reaktion plade tilbage på plade magnet og inkuberes i 2 min. Perlerne skal adskille og løsningen bliver klart.
    9. Overføre ved hjælp af en multikanalpipette, uden at forstyrre perler, omhyggeligt supernatanten ind i de tilsvarende huller i en ny 96-brønd pladen.
    10. Forsegle pladen med en aluminium plade cover, etiket "IPed + Input DNA", og opbevares ved 4 ° C natten over eller ved-20 ° C for langsigtede (> 48 h) opbevaring.

4. dag 3: Bibliotek opbygning

  1. Ende reparation og fosforylering
    1. Input til den ende reparation/fosforylering reaktion er IPed + Input plade fra trin 3.3.10. Efter optøning, dreje pladen ned på 200 x g i 1 min. ved 4 ° C og holde det på is.
    2. Hente fra-20 ° C fryser alle reagenser (bortset fra enzymer) kræves til udgangen reparation/fosforylering reaktion (tabel 6) og tø dem ved stuetemperatur, så straks overføre til is.
    3. Arbejder på is, Følg tabel 6 for at indstille op ende reparation/fosforylering Master Mix i en steril, 1,5 mL microcentrifuge tube. Efter tilsætning af alle ikke-enzymet komponenter, bland godt af puls-vortexing og læg tuben tilbage på isen.
    4. Hente de relevante enzymer fra deres kolde opbevaring og transport til bænken i en kølet rør cool rack. Bland hvert enzym ved at bladre til rør, hurtig spin, og læg den tilbage i kølet rør cool rack. Når pipettering enzymet, Aspirér langsomt for at sikre en nøjagtig volumen overførsel. Efter tilsætning, vaske spidsen i master mix af pipettering op og ned.
    5. Når enzymerne, der er tilføjet, tilbage forsigtigt pulse-vortex master mix 5 gange til at sikre en jævn fordeling af alle komponenter, så hurtig spin og straks placere røret på isen.
    6. På is, alikvot et passende volumen af slutningen reparation/fosforylering Master Mix i en række i en ny 96-brønd reservoir plade; volumen til at være aliquoted: (15 µL x # rækker) + 5 µL dødvolumen. Et eksempel beregning til to rækker: (15 µL x 2) + 5 µL = 35 µL/brønd.
    7. Ved hjælp af en multikanalpipette, tilføje 15 µL af slutningen reparation/fosforylering Master Mix til hver række af prøver og bland 10 gange af pipettering op og ned. Ændre tips mellem rækkerne. Forsegle pladen med en plastik cover, spin ned på 200 x g i 1 min. ved 4 ° C, og der inkuberes ved stuetemperatur i 30 min.
  2. Perle oprydning efter udgangen reparation og fosforylering
    1. Fra 4 ° C køleskab, hente 20% PIND/1 M NaCl magnetisk bead opløsning og 30% PIND/1 M NaCl opløsning og inkuberes ved stuetemperatur i mindst 30 min.
      Bemærk: 30% PIND/1 M NaCl løsning gør ikke indeholde magnetiske perler.
    2. Når begge løsninger nå stuetemperatur, for hver prøve forberede 80 µL af 1:2 blanding af 30% PIND/1 M NaCl og 20% PIND/1 M NaCl magnetisk bead løsninger. Et eksempel for 24 prøver: 80 µL x 24 = 1.920 µL (640 µL 30% PIND/1 M NaCl og 1,288 µL af 20% PIND/1 M NaCl magnetisk bead løsninger).
    3. Alikvot perle løsning mix, lige saa stort volumen, i en række i en 96-brønd reservoir plade og opbevare det ved stuetemperatur. Alikvot EB buffer (40 µL pr. prøve x # rækker) i en række i en ren 96-brønd reservoir plade. Et eksempel på to rækker: 40 µL x 2 = 80 µL/brønd.
    4. Ved hjælp af en multikanalpipette, tilføje 75 µL af perle blanding forberedt i trin 4.2.2 i hver række i prøver fra trin 4.1.7 og blande op og ned 10 gange. Ændre tips mellem rækkerne. Inkuber ved stuetemperatur i 15 min. Fortsæt med perle oprydning procedure som beskrevet i trin 3.3.3-3.3.10. Dække pladen med en plast sæl, hurtig spin og placere den på is. Fortsæt til trin 4.3.
  3. A-hale reaktion
    1. Hente fra-20 ° C fryser alle reagenser (bortset fra enzymer) kræves til A-hale reaktion (tabel 7), tø dem ved stuetemperatur derefter straks overføre til is.
    2. Arbejder på is, følge tabel 7 til at oprette A-hale Master Mix i en steril, 1,5 mL microcentrifuge tube. Følg instruktionerne generelle enzymatisk bryg opsætning, som beskrevet i trin 4.1.4-4.1.6.
    3. Ved hjælp af en multikanalpipette, tilføje 15 µL af A-hale Master Mix til hver række af prøver og bland 10 gange af pipettering op og ned. Ændre tips mellem rækkerne. Forsegle pladen med en PCR cover, spin ned på 200 x g i 1 min. ved 4 ° C, og Inkuber i et thermocycler ved 37 ° C i 30 min. Efter inkubation, dreje pladen ned på 200 x g i 1 min og opbevare det ved stuetemperatur.
  4. Perle oprydning efter A-hale
    1. Udfør trinene beskrevet taktfast 4.2. Dække pladen med en plast sæl, mærket "A-hale + BC", hurtig spin, og placere den på is. Fortsæt til trin 4.5.
  5. Adapter ligatur
    1. Hente fra-20 ° C fryser alle reagenser (bortset fra enzymer) kræves til adapter ligatur reaktion (tabel 8), tø dem ved stuetemperatur derefter straks overføre til is.
    2. Hente 10 µM PE adapter (supplerende tabel 1) stamopløsning og fortyndet til 0,5 µM ved hjælp af EB. Bland godt af puls vortexing. Volumen kræves er 3 µL x # af prøver. Arbejder på is, alikvot 0,5 µM PE adapter, lige saa stort volumen, til 12 brønde i en ren 96-brønd reservoir plade. Hold det på køl.
    3. Arbejder på is, Følg tabel 8 at oprette Adapter ligatur Master Mix i en steril, 1,5 mL microcentrifuge tube. Følg instruktionerne generelle enzymatisk bryg opsætning, som beskrevet i trin 4.1.4-4.1.6. Sørg for, at 5 X hurtig ligatur Buffer er helt optøede og meget godt blandet før brug.
    4. På is, alikvot et passende volumen af Adapter ligatur Master Mix i en række i en ny 96-brønd reservoir plade. For eksempel, beregning til to rækker: (23 µL x 2) + 5 µL = 51 µL/brønd. Holde pladen på is.
    5. Ved hjælp af en multikanalpipette, tilføje 2 µL af den 0,5 µM parret ende (PE) netværkskort i hver række i prøver fra trin 4.4.1 og mix. Ændre tips mellem rækkerne.
    6. Ved hjælp af en multikanalpipette, tilføje 23 µL af Adapter ligatur Master Mix til hver række af prøver og bland 15 gange af pipettering op og ned. Ændre tips mellem rækkerne. Forsegle pladen med en metal dække, etiketten "Ligatur", spin ned på 200 x g i 1 min. ved 4 ° C, og der inkuberes ved rumtemperatur natten over.
  6. Dag 4: Perle oprydning #1 efter adapter ligatur
    1. Fra 4 ° C køleskab, hente 20% PIND/1 M NaCl magnetisk bead opløsning og inkuberes ved stuetemperatur i mindst 30 min. Mens løsningen equilibrating forberede frisk 70% EtOH.
    2. Alikvot 20% PIND/1 M NaCl magnetisk bead løsning, 55 µL pr. prøve, i en række i en 96-brønd reservoir plade og opbevare det ved stuetemperatur. Et eksempel på to rækker: 55 µL x 2 = 110 µL/brønd.
    3. Alikvot EB buffer, 50 µL pr. prøve, i en række i en ren 96-brønd reservoir plade. Et eksempel på to rækker: 50 µL x 2 = 100 µL/brønd.
    4. Ved hjælp af en multikanalpipette, tilføje 48 µL af 20% PIND/1 M NaCl magnetisk bead løsning i hver række af prøver i ligatur plade fra trin 4.5.6 og blande op og ned 10 gange. Ændre tips mellem rækkerne. Inkuber ved stuetemperatur i 15 min. Fortsæt med perle oprydning procedure som beskrevet i trin 3.3.3-3.3.7.
    5. Tag pladen ud plade magnet og ved hjælp af en multikanalpipette, tilføje 45 µL EB (Tabel af materialer). Bland godt af pipettering 10 gange op og ned. Ændre tips mellem rækkerne. Inkuber i stuetemperatur i 3 min. at eluere.
    6. Efter inkubationen sted IP reaktion plade tilbage på plade magnet og inkuberes i 2 min. ved hjælp af en multikanalpipette, uden at forstyrre perlerne, omhyggeligt overføre supernatanten ind i de tilsvarende huller i en ny 96-brønd pladen. Mærke pladen, "Ligatur + 1 f.kr.".
    7. Til hver brønd tilsættes 5 µL af 10 x PCR high fidelity buffer og bland godt ved pipettering op og ned. Ændre tips mellem rækkerne. Dække pladen med en plast sæl, hurtig spin, og opbevare det ved stuetemperatur.
  7. Perle oprydning #2 efter adapter ligatur
    1. Udføre oprydning til perle, som beskrevet i afsnit 4.6 med følgende ændringer: tilsættes 60 µL af 20% PIND/1 M NaCl magnetisk bead løsning til hver aktive brønd i ligatur + 1 BC plade (trin 4.6.7) og elueres fra perlerne ved hjælp af 35 µL af EB buffer. Etiket pladen "Ligatur + 2 f.kr." og holde det på is.
  8. PCR-amplifikation
    1. Hente fra-20 ° C fryser alle reagenser (bortset fra enzymer) kræves til PCR reaktion (tabel 9), tø dem ved stuetemperatur og derefter straks placere dem på is.
    2. Arbejder på is, Følg tabel 9 at oprette PCR Master Mix i en steril, 1,5 mL microcentrifuge tube. Følg generelle bryg set-up instruktioner, som beskrevet i trin 4.1.4-4.1.5. På is, alikvot et passende volumen af PCR Master Mix i en række i en ny 96-brønd reservoir plade. Hold det på køl. Se trin 4.5.4 for prøven beregninger.
    3. Arbejder på is, ved hjælp af en multikanalpipette, tilføje 2 µL af hver unik 12,5 µM PCR reverse indeksering primer (supplerende tabel 2) i hver brønd i Ligation + 2 BC plade (trin 4.7.1) og bland langsomt op og ned. Ændre tips mellem rækkerne. Holde pladen på is.
    4. Arbejde på is, ved hjælp af en multikanalpipette, tilføje 23 µL PCR master mix i hver række i prøver fra trin 4.8.3 og mix 10 gange af pipettering op og ned. Forsegle pladen med en PCR cover, spinde det ned på 200 x g i 1 min og inkuberes i en thermocycler (Se tabel 10 for PCR cykling betingelser).
  9. Perle oprydning efter PCR-amplifikation
    1. Efter PCR-amplifikation spin plade ved 200 x g i 1 minut, 4 ° C. Udføre perle oprensning som beskrevet i afsnit 4.6 med følgende ændringer: tilføje 51 µL af 20% PIND/1 M NaCl magnetisk bead løsning til hver PCR reaktion og elueres fra perlerne ved hjælp af 25 µL af EB buffer. Forsegle pladen med en aluminium cover og spin ned på 200 x g til 1 min. butik prøver ved-20 ° C.
    2. For at validere opbygget biblioteker, udføre DNA kvantificering ved hjælp af et fluorescens-baseret analyse, visualisere det færdige produkt ved hjælp af en chip-baserede kapillær elektroforese analyzer (høj følsomhed assay) og køre berigelse kvantitativ PCR (qPCR) (Se Repræsentant resultater, validering af ndChIP-seq bibliotek kvalitet af qPCR).

Representative Results

Kromatin fordøjelsen profiler
Optimering af MNase fordøjelse er afgørende for succes i denne protokol. Det er afgørende for at generere en fordøjelsen profil domineret af indre nucleosome fragment størrelser, mens ikke over fordøjet, at give mulighed for genoprettelse af højere orden nucleosome fragmenter. En ideel fordøjelsen profil består af et flertal af enkelt nucleosome fragmenter med en lille brøkdel der repræsenterer fragmenter mindre og større end enkelt nucleosomes. Figur 1 viser eksempler på en ideel, over fordøjet og under-fordøjet størrelse distribution profiler. Bemærk at sub-optimale fordøjelsen af kromatin også bliver synlige i profilen for biblioteket sekventering genereret fra IP materiale (figur 2).

Validering af ndChIP-seq bibliotek kvalitet af qPCR
qPCR er en veletableret metode til vurdering af kvaliteten af ChIP18,19,20. Hvornår udføres ndChIP-seq på 10.000 celler udbyttet af nukleinsyre efter IP vil være under 1 ng. Derfor er det vigtigt at udføre qPCR efter bibliotek byggeri til at vurdere den relative berigelse af målområder over baggrund. For at give en baggrund skøn, genereres biblioteker konstrueret fra MNase fordøjet kromatin (Input). For hver IP bibliotek, er to sæt primere nødvendig (jf. supplerendetabel 3 for en liste af primere for almindeligt anvendte Histon mærker). En primer sæt skal være specifik for en genomisk region, der er konsekvent forbundet med Histon ændring af interesse (positive mål) og en anden region, der ikke er markeret med Histon ændring af interesse (negative mål). Kvaliteten af ChIP-seq bibliotek vil blive vurderet som fold berigelse med hensyn til input bibliotek. Fold berigelse kan beregnes ved hjælp af følgende ligning, der antager eksponentiel forstærkning af genomisk målområde: 2Ctinput-CtIP. Vores custom lavet R statistisk softwarepakke, qcQpcr_v1.2, er egnet til qPCR berigelse analyse af lav input indfødte ChIP-seq biblioteker (Supplerende kodefiler). Figur 3 repræsenterer et qPCR resultat for vellykkede og mislykkede ChIP-seq biblioteker. Den mindste forventede fold berigelse værdi for god kvalitet ndChIP-seq biblioteker er 16 til smalle mærker, såsom H3K4me3 og 7 for bred mærker, for eksempel H3K27me3.

Modellering MNase tilgængelighed
Beregningsmæssige analyse af ChIP-seq er kompleks og unik for hver eksperimentelle indstilling. Et sæt af retningslinjer fastsat af International menneskelige epigenomiske Consortium (IHEC) og The encyklopædi af DNA elementer (INDKODE) kan bruges til at vurdere kvaliteten af ChIP-seq biblioteker21. Det er vigtigt at bemærke, at sekventering dybden af bibliotekerne konsekvenser detektering og løsning af beriget regioner20. Antallet af toppe registreret stigning og nærmer sig et plateau som Læs dybde stigninger. Vi anbefaler ndChIP-seq biblioteker at blive sekventeret i overensstemmelse med IHEC anbefalinger af 50 millioner parret-læser (25 millioner fragmenter) for smalle mærker (f.eks.H3K4me3) og 100 millioner parret-læser (50 millioner fragmenter) for bred mærker ( f.eks., H3K27me3) og indgang22. Disse sekventering dybder give tilstrækkelig sekvens linjeføringer for påvisning af de mest betydningsfulde toppe ved hjælp af almindeligt anvendte ChIP-seq peak opkaldere, såsom MACS2 og HOMER, uden at nå mætning23,24. En høj kvalitet pattedyr ndChIP-seq bibliotek har en PCR dublerede sats af < 10% og reference genom justering sats > 90% (herunder dublerede læser). Vellykket ndChIP-seq biblioteker vil indeholde stærkt korreleret flergangsbestemmelser med en betydelig del (> 40%) af justeret læsninger i MACS222 identificeret beriget toppe og inspektion af justeret læser på en genom browser skal afsløre visuelt påviselig enrichments i forhold til inputbiblioteket (figur 4). Derudover ndChIP-seq kan bruges til at vurdere nucleosome tæthed ved at udnytte en Gaussisk blanding distribution algoritme (w1 * n(x; Μ 1,σ1) + w2 * n(x, μ2, σ2) = 1) på MACS2 identificeret beriget regioner for at model nucleosome tæthed som defineret af MNase tilgængelige grænser. I denne model, w1 repræsenterer mono-nucleosome distribution vægt og w2 repræsenterer di-nucleosome distribution vægt. Hvor w1 er større end w2, er der dominans af mono-nucleosome fragmenter og vice versa. Denne analyse kræver, at biblioteker blive sekventeret i en parret ende mode, således at fragment størrelser kan defineres. Anvende Gaussian blanding distribution algoritmen, er statistisk signifikant beriget regioner først identificeret. Vi foreslår peak kald med MACS2 ved hjælp af Input som en kontrol og med standardindstillingerne for smalle varemærker og en q værdi cutoff 0,01 for bred mærker. En række statistiske pakker beskæftiger en Gaussisk blanding distribution algoritme er tilgængelige fra udbredt statistiske programpakker. Udnytte gennemsnitlig fragment størrelse, bestemmes af parret ende Læs grænserne for IPed prøver, distributioner på MACS2 identificeret beriget initiativtagere, og en Gaussisk blanding distribution algoritme kan anvendes på hver promotor, ved hjælp af R-statistisk pakke Mclust version 3.025 til at beregne et vægtet fordeling. I dette program anbefaler vi, at fjerne initiativtagere indeholdende mindre end 30 justeret fragmenter, fordi denne tærskel den resulterende vægt skøn blive upålidelige. En god kvalitet ndChIP-seq bibliotek genererer en Gaussisk blanding distribution, der består af to hovedkomponenter med gennemsnitlige værdier svarende til mono-, di-nucleosome fragment længder.

Figure 1
Figur 1 : Vurdering af MNase fordøjelse før bibliotek generation. Chip-baserede kapillær elektroforese analyzer profiler af en optimal MNase fordøjet (A), fordøjet (B) og over fordøjet (C) kromatin. Biologiske replikater vises som blå, røde og grønne spor. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Vurdering af MNase fordøjelse efter bibliotek generation. (A) sende bibliotek byggeri profiler af optimalt fordøjet input (biologiske replikater, rød, grøn, sort) og IP (biologiske replikater; cyan, lilla, blå) og (B) sub-optimale input (biologiske replikater, rød, grøn, blå) og IP ( biologiske replikater; cyan, lilla, orange) biblioteker. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Sende bibliotek konstruktion kvantitativ PCR kan anvendes til at vurdere kvaliteten af ndChIP-seq biblioteker. Fold berigelse af H3K4me3 IP biblioteker med hensyn til input biblioteker beregnes som 2(Ct af input - Ct af IP) for positive og negative mål ved hjælp af qcQpcr_v1.2. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Repræsentative ndChIP-seq bibliotek bygget fra 10.000 primære CD34+ ledning blod celler. Pearson korrelation af H3K4me3 signal (læser per million tilknyttede læser) beregnet i initiativtagere (TSS +/-2Kb) mellem 3 biologiske replikater, (A) replikeres 1 og 2, (B) kopiere 1 og 3, (C) kopiere 2 og 3. (D) UCSC browservisning af HOXA gen klynge af krydsbundet ChIP-seq genereret fra 1 million celler pr. IP, succesfulde ndChIP-seq fra 10.000 celler pr. IP og mislykket ndChIP-seq fra 10.000 celler pr. IP. (red: H3K27me3, grøn: H3K4me3, og sort: Input). (E) brøkdel af tilknyttede læser i MACS2 identificeret beriget regioner af H3K4me3 (sort) og H3K27me3 (grå). Venligst klik her for at se en større version af dette tal.

Buffer sammensætning
A.1. Immunoprecipitation buffer (IP)
20 mM Tris-HCl pH 7,5
2 mM EDTA
150 mM NaCl
0,1% Triton X-100
0,1% Deoxycholate
10 mM natrium butyrat
A.2. lav Salt Wash buffer
20 mM Tris-HCl pH 8.0
2 mM EDTA
150 mM NaCl
1% Triton X-100
0,1% SDS
A.3. høje Salt Wash buffer
20 mM Tris-HCl pH 8.0
2 mM EDTA
500 mM NaCl
1% Triton X-100
0,1% SDS
A.4. ChIP eluering buffer
100 mM NaHCO3
1% SDS
A.5. 1 x lysisbuffer – 1 mL
0,1% Triton
0,1% Deoxycholate
10 mM natrium butyrat
A.6. Ab fortynding buffer
0,05% (w/v) indeholder
0,05% bredt spektrum antimikrobiel (fx ProClin 300)
i PBS
A.7. 30% PIND / 1M NaCl magnetisk Bead løsning (reference16)
30% PLØK
1 M NaCl
10 mM Tris HCl pH 7,5
1 mM EDTA
1 mL af vasket super-Paramagnetiske perler
A.8. 20% PIND / 1M NaCl magnetisk Bead løsning (reference16)
30% PLØK
1 M NaCl
10 mM Tris HCl pH 7,5
1 mM EDTA
1 mL af vasket super-Paramagnetiske perler

Tabel 1: ndChIP-seq buffer sammensætning.

Histon ændring Koncentrationen (µg/µL)
H3K4me3 0,125
H3K4me1 0,25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabel 2: Antistof beløb, der kræves for ndChIP-FF.

Reganet Volumen (µL)
Ultra rent vand 478
1 M Tris-HCl pH 7,5 10
0,5 M EDTA 10
5 M NaCl 2
Glycerol 500
Samlede volumen 1.000

Tabel 3: Opskrift på MNase fortynding buffer.

Reagens Volumen (µL)
Ultra rent vand 13
20 mM DTT 1
10 x MNase Buffer 4
20 U/µl Mnase 2
Samlede volumen 20

Tabel 4: Opskrift på MNase Master Mix.

Reagens Volumen (µL)
Eluering Buffer 30
Buffer G2 8
Protease 2
Samlede volumen 40

Tabel 5: Opskrift på DNA oprensning Master Mix.

Reagens Volumen (µL)
Ultra rent vand 3.3
10 x begrænsning Liv1975 Buffer (f.eks. NEBuffer) 5
25 mM ATP 2
10 mM dNTP'er 2
T4 Polynucleotide Kinase (10 U/µl) 1
T4 DNA polymerase (3 U/µl) 1.5
DNA-polymerase I, Large (Klenow) Fragment (5 U/µl) 0,2
Samlede volumen 15

Tabel 6: Opskrift på udgangen reparation Master Mix.

Reagens Volumen (µL)
Ultra rent vand 8
10 x begrænsning Liv1975 Buffer (f.eks. NEBuffer) 5
10 mM dATP 1
Klenow (3' - 5' exo-) 1
Samlede volumen 15

Tabel 7: Opskrift på A-hale Master Mix.

Reagens Volumen (µL)
Ultra rent vand 4.3
5 x hurtig ligatur buffer 12
T4 DNA ligase (2000 U/µl) 6.7
Samlede volumen 23

Tabel 8: Opskrift på Adapter ligatur Master Mix.

Reagens Volumen (µL)
Ultra rent vand 7
25 uM PCR primer 1,0 2
5 x HF buffer 12
DMSO 1.5
DNA Polymerase 0,5
Samlede volumen 23

Tabel 9: Opskrift på PCR Master Mix.

Temprature (° C) Varighed (s) Antal cyklusser
98 60 1
98 30
65 15 10
72 15
72 300 1
4 hold hold

Tabel 10: PCR run-metoden.

Oligo Sekvens Ændring
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 ' 5' ændring: fosforylering
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' ændring: * T er et phosphorothioate bånd

Supplerende tabel 1: Oligo sekvenser for generation af PE adapter.

Primer navn Sekvens Indeks IndexRevC (skal bruges til sekvensering)
PCR reverse indeksering primer 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR reverse indeksering primer 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR reverse indeksering primer 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR reverse indeksering primer 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR reverse indeksering primer 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR reverse indeksering primer 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR reverse indeksering primer 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR reverse indeksering primer 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR reverse indeksering primer 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR reverse indeksering primer 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR reverse indeksering primer 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR reverse indeksering primer 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR reverse indeksering primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR reverse indeksering primer 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR reverse indeksering primer 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR reverse indeksering primer 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR reverse indeksering primer 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR reverse indeksering primer 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR reverse indeksering primer 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR reverse indeksering primer 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR reverse indeksering primer 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR reverse indeksering primer 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR reverse indeksering primer 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR reverse indeksering primer 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Supplerende tabel 2: PCR reverse indeksering primer sekvenser.

Primere Sekvens
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Histon ændring Positive mål Negative mål
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Supplerende tabel 3: En liste over primere for almindeligt anvendte Histon mærker (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 og H3K36me3).

Supplerende fil 1: ndChIP-seq regneark. Venligst klik her for at downloade denne fil.

Supplerende kodefiler: qcQpcr_v1.2. R statistisk softwarepakke til qPCR berigelse analyse af lav input indfødte ChIP-seq biblioteker. Venligst klik her for at downloade denne fil.

Discussion

Da kombinatorisk kromatin modifikation og nucleosome positionering i transkriptionel regulering, er en metode, der muliggør samtidige målinger af disse funktioner tilbøjelige til at give ny indsigt i epigenetisk regulering. NdChIP-seq protokollen præsenteres her er en indbygget ChIP-seq protokol optimeret for at aktivere samtidige forhør af Histon modifikation og nucleosome tæthed i sjældne primærelementer9,10. ndChIP-seq udnytter Enzymatisk nedbrydning af kromatin, når koblet til parret slutningen massivt parallel sekvensering og Gaussisk blanding distributionsmodel, giver mulighed for undersøgelse Histon ændringer på enkelt nucleosome niveau og den deconvolution af epigenomiske profiler drevet af heterogenitet i en befolkning. Ved hjælp af denne protokol, har vi tidligere rapporteret en entydig fordeling af immuno-udfældet fragment størrelser, bestemmes af parret-end læse grænser, forbundet med specifikke kromatin stater defineret af ChromHMM10,24.

Kvaliteten af en ndChIP-seq bibliotek, afhænger af flere faktorer, såsom antistof specificitet og sensitivitet, optimale MNase fordøjelse betingelser og kvaliteten af kromatin. Specificiteten af antistofferne anvendes er afgørende i at producere vellykket ndChIP-seq bibliotek. En ideel antistof viser høj affinitet mod epitop af interesse med lille cross reaktivitet med andre epitoper. Det er også vigtigt at vælge magnetiske perler med det højeste affinitet for antistof valg.

MNase fordøjelse er en kritisk og tid og koncentration følsomme reaktion i denne protokol. Derfor, når de behandler flere prøver, er det vigtigt, at hver reaktion er inkuberes i en tilsvarende mængde tid (Se trin 2.2). Kvaliteten af kromatin er en anden faktor, der væsentligt effekter resultatet af ndChIP-FF. spredte kromatin fører til en optimal MNase fordøjelse profil og resultater i biblioteker med et lavt signal / støjforhold. Primære prøver med lav cellernes levedygtighed eller forringet kromatin, såsom formalin-fast paraffin-embedded (FFPE) væv ikke anbefales til denne protokol.

Tilsætning af en PIC under kromatin udvinding reducerer uønskede (dvs., random) kromatin fragmentering og bevarer integriteten af Histon haler. Som sådan, skal PIC tilføjes til lysisbuffer og immunoprecipitation buffer bare forudgående at bruge. Mens vælge celler via flowcytometri, Vælg for levedygtige celler og sikre sorteres celler på et lavt flow til at øge celle nummer skønnets nøjagtighed og levedygtighed af celler. Undgå sortering celler direkte til lysisbuffer. Den kappe buffer vil udvande lysisbuffer og forhindrer effektiv permeabilization af cellemembranen til MNase. Afhængigt af typen af celler eller organisme, kan titrering af MNase være nødvendigt at opnå optimal fordøjelse.

ndChIP-seq på pattedyrceller kræver en minimum sekventering dybde af 50 millioner parret-læser (25 millioner fragmenter) for smalle mærker og 100 millioner parret-læser (50 millioner fragmenter) for bred mærker og input. Gaussian blanding distribution algoritmen vil ikke fungere optimalt på biblioteker, der har blevet sekventeret til en dybde betydeligt under denne henstilling. ndChIP-seq vil ikke klassificere initiativtagere med lille adskillelse mellem vejede distribution værdi for mono - og di-nucleosome fragment længder i mono - eller di-nucleosome dominerede initiativtagere. Derfor, disse initiativtagere skal fjernes i den efterfølgende analyse. Biologiske replikater kan genereres for at øge tilliden til forudsagt distributioner og identificere tekniske variabilitet i MNase fordøjelse og bibliotek konstruktion.

I modsætning til tidligere udgaver af indfødte ChIP-seq protokoller giver ndChIP-seq mulighed for at undersøge kombinatorisk effekt af kromatin struktur og Histon ændring ved at udnytte fragment størrelse indlæg immunoprecipitation for at integrere nucleosome tæthed, bestemmes af MNase tilgængelighed, med Histon ændring målinger. Anvendelse af ndChIP-seq primære celler og væv vil give ny indsigt i Integrativ arten af epigenetisk regulering og identificering af epigenetiske underskrifter på grund af heterogenitet i befolkningen.

Disclosures

Forfatterne erklærer, at de har ingen konkurrerende finansielle interesser.

Acknowledgements

A.L. blev støttet af en canadisk Graduate stipendium fra den canadiske institutter for sundhedsforskning. Dette arbejde blev støttet af tilskud fra genom British Columbia og den canadiske institutter for sundhedsforskning (CIHR-120589) som en del af den canadiske Epigenetik, miljø og sundhed Research Consortium initiativ og Terry Fox Research Institute Program Project Grant #TFF-122869 til M.H. og en Terry Fox Research Institute nye Investigator Award (Grant # 1039) til M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics