Generation av infödda kromatin Immunoprecipitation sekvensering bibliotek för Nucleosome densitet analys

Genetics
 

Summary

Vi presenterar en modifierad infödda kromatin immunoprecipitation sekvensering (ChIP-seq) metodik för generering av sekvens datamängder lämpar sig för en nukleosomens densitet ChIP-seq analytisk ram att integrera micrococcal nuclease (MNase) hjälpmedel med Histon modifiering mätningar.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi presenterar en modifierad infödda kromatin immunoprecipitation sekvensering (ChIP-seq) experimentellt protokoll kompatibel med en Gaussisk blandning distribution baserad analys metod (nukleosomens densitet ChIP-seq; ndChIP-seq) som möjliggör generering av kombinerade mätningar av micrococcal nuclease (MNase) hjälpmedel med Histon modifiering genome-wide. Nukleosomens position och lokala densitet och posttranslationell modifiering av sina Histon subenheter, agera i samförstånd reglera lokala transkription stater. Kombinatoriska mätningar av nukleosomens tillgänglighet med Histon modifiering genereras av ndChIP-seq möjliggör samtidiga förhör av dessa funktioner. NdChIP-seq metoden är tillämplig på litet antal primära celler otillgängliga för cross-linking baserade ChIP-seq protokoll. NdChIP-seq sammantaget och möjliggör mätning av Histon ändring i kombination med lokala nukleosomens densitet att få nya insikter i delade mekanismer som reglerar RNA transkriptionen inom sällsynta primära cellpopulationer.

Introduction

Eukaryota genomet är förpackade i kromatin via upprepande nukleosomens strukturer som består av två kopior av fyra Histon proteiner (t.ex., H2A H2B, H3 och H4) avgränsat genom 146 baspar i DNA1,2. Kromatin remodeling komplex kontroll nukleosomens ställning inom genen arrangören gränser och delta i regleringen av genuttryck genom att ändra tillgängligheten av DNA att transkriptionsfaktorer och RNA-polymeras maskiner3, 4.

Amino terminal svansar av histoner inom nukleosomens utsätts för olika kovalenta modifieringar, inklusive acetylering, metylering, fosforylering, ubiquitin, sumoylation, formylation och hydroxylering av specifika aminosyror5 , 6 , 7 , 8. positioner och grader av dessa modifieringar diktera ett kromatin-tillstånd som påverkar kromatin struktur och kontroll tillgång av de molekylära komplexen som tillåter aktivering av transkription7. Med tanke på att båda nukleosomens densitet och Histon modifiering spela en roll i den lokala kontrollen av gentranskription, utvecklat vi en native ChIP metod som möjliggör samtidig mätning av nukleosomens täthet och Histon ändring9, 10.

Infödda ChIP-seq tar fördel av den Amiiiiin micrococci nuclease (MNase) att smälta intakt kromatin i dess infödda stat inom nucleus11,12, en fastighet som har varit skuldsatt för att mappa nukleosomens positionering13 , 14 , 15. nucleosome densitet ChIP-seq (ndChIP-seq) tar fördel av egenskapen förmånstillträde för MNase att öppna regioner av kromatin att generera mätningar som kombinerar MNase tillgänglighet med Histon ändring10. ndChIP-seq är lämplig för profilering av Histon ändringar i sällsynta primära celler, vävnader och odlade celler. Här presenterar vi ett detaljerat protokoll som möjliggör generering av sekvens datamängder lämpar sig för en tidigare beskrivna analytisk ram arbete10 som integrerar fragment storlek post immunoprecipitation, bestäms av Parade-slutet läsa gränser, till samtidigt undersöka MNase tillgänglighet med Histon modifiering mätningar. Tidigare tillämpning av detta protokoll till 10.000 primära mänskliga navelsträngsblod härrör CD34+ celler och mänskliga embryonala stamceller avslöjade unika relationer mellan kromatin struktur och Histon ändringar inom dessa cell typer10 . Med tanke på dess förmåga att samtidigt mäta nukleosomens tillgänglighet och Histon modifiering, ndChIP-seq är kapabel att avslöjar epigenetisk funktioner i en cell på en enda nukleosomens nivå, och att lösa heterogena signaturer i deras brottsrekvisit. Ett exempel på utforskandet av heterogena cellulära populationer av ndChIP-seq är undersökning av bivalent initiativtagare, där både H3K4me3, en aktiv mark och H3K27me3, en repressiv mark, är nuvarande10.

Protocol

Obs: Minsta ingång för detta protokoll är 10 000 celler per enskild immuno-nederbörd (IP) reaktion. Skriva ut kalkylbladet medföljande experimentella och använda som riktlinje att planera ut experimentet. Inkubationer rumstemperatur antas vara vid ~ 22 ° C. Alla buffert recept finns i tabell 1. Alla buffertar bör lagras vid 4 ° C och hålls på is under förfarandet, om inte annat anges.

1. cell förberedelse

  1. Odlade celler
    1. Tvätta cellerna med 1 mL av fosfat buffert saltlösning (PBS) och noggrant bestämma cellkoncentrationen använder en hemocytometer. Om det finns mer än en miljon celler, öka volymen av PBS.
    2. Baserat på celltalet, alikvotens en motsvarighet till 70,000-100,000 celler i en steril 1,5 mL tub, och varva ner på 500 x g under 6 minuter vid 4 ° C. Med pipett långsamt bort och kasta bort supernatanten (utan störande cellpelleten) och återsuspendera pelleten i iskall lyseringsbuffert + 1 x cocktail proteashämmare (PIC) till en koncentration av 1 000 celler / µL. Blanda väl genom pipettering upp och ner 20-30 gånger. Det är viktigt att cellen klumpar störs. Försök inte att skapa bubblor.
    3. Gå direkt till dag 1 (avsnitt 2) i protokollet om ndChIP-seq eller flash frysa cellpelleten i flytande kväve och förvaras vid-80 ° C.
  2. Sorterade celler
    1. Samla in 70,000-100,000 sorterade16 celler i ett 1,5 mL rör med 350 µL av Hanks buffrad saltlösning (HBSS), eller PBS + 2% fetalt bovint serum (FBS).
    2. Snurra ner varje cell delmängd vid 500 x g under 6 minuter vid 4 ° C. Med pipett långsamt bort supernatanten (utan störande cellpelleten) och återsuspendera i iskall lyseringsbuffert + 1 x PIC till en slutlig koncentration på 1 000 celler / µL. Blanda väl i lyseringsbuffert genom pipettering upp och ner 20 - 30 gånger. Se till att cell klumpar störs. Försök inte att skapa bubblor.
    3. Gå direkt till dag 1 (avsnitt 2) i protokollet om ndChIP-seq eller flash frysa cellpelleten i flytande kväve och förvaras vid-80 ° C.

2. dag 1: ndChIP-seq

  1. Beredning av antikropp-pärla anläggningen
    1. Förbered ett vattenbad på 37 ° C och en ishink. Arbetar på is, förbereda 1 x IP buffert/1 x PIC och 1 x antikropp (Ab) förtunningsbuffert, och hålla dem på isen. Hämta Protein A (eller G) magnetiska pärlor (se diskussion för urvalskriterier) från 4 ° C lagring och blanda mycket väl med mild puls-vortexa. Håll det på is.
      Obs: Puls-vortexa innebär vortexa stoppas varje gång en full vortex bildas i röret.
    2. Över 24 µL av Protein A (eller G) magnetiska pärlor per IP reaktion till en ny 2 mL tub. Spela in volymen av pärlor och hålla röret på is. För exempel, för 7 IPs, Använd 24 µL x 7 = 168 µL.
    3. Placera röret på tube magneten och vänta för att lösningen skall bli tydligt indikerande pärla separation. Utan att störa pärlorna, noggrant avlägsna supernatanten med pipett och kassera. Ta tunnelbanan utanför tube magneten och placera den på is.
    4. Lägg till en lika stor volym (dvs, Ursprunglig volym av pärlor) iskall IP buffert + 1 x PIC mix. Blanda genom pipettering upp och ner. Gör inte vortex.
    5. Placera den IP buffert + 1 x PIC + pärlor rygg onto tube magneten och vänta för att lösningen skall bli tydligt indikerande pärla separation. Utan att störa pärlorna, noggrant avlägsna supernatanten med pipett och kassera. Upprepa kalla IP buffert + 1 X PIC tvätta två gånger för totalt 3 tvättar.
    6. Efter den sista tvättningen, resuspendera pärlor i en lika stor volym (dvs, Ursprunglig volym av pärlor) iskall IP buffert + 1 x PIC mix. Blanda genom pipettering upp och ner. Gör inte vortex. Håll röret på is.
    7. Häll 10 mL av IP-buffert + PIC i en 25 mL V-formade reservoar på is. Med hjälp av en flerkanalspipett, Lägg till 130 µL av iskall IP buffert + 1 x PIC mix i enskilda brunnar i en blandningskopp V-botten 96-plattan. Fyll en väl per IP. Etikett på plattan som ”Ab-pärla komplex”.
    8. Lägg 12 µL av den tvättade Protein A (eller G) magnetiska pärlor i varje brunn innehållande IP buffert + PIC och blanda genom pipettering upp och ner. Håll återstående tvättade pärlorna på is.
    9. Få validerade antikroppar från deras kyllagring och Tina på is, om det behövs. Arbetar på is, späd antikroppar med 1 x Ab förtunningsbuffert till de koncentrationer som anges i tabell 2.
    10. Till varje brunn Ab-pärla komplexa plattan, tillsätt 1 µL av lämpliga, utspädda antikroppen (tabell 1). Spela in brunnen för att nyckeln antikropp. Med hjälp av flerkanalspipett, blanda varje rad genom pipettering upp och ner 20 gånger. Ändra tips mellan raderna. Försegla Ab-pärla komplexa plattan mycket väl med en aluminium plattan täcker och inkubera vid 4 ° C på en roterande plattform för minst 2 h.
      Obs: Denna inkubation kan fortsätta tills det att starta steg 2,4.
  2. Cell lysis och kromatin matsmältningen
    1. Arbetar på is, förbereda 1 x lyseringsbuffert + 1 x PIC och 1 mL MNase jag utspädning buffert (tabell 3) och hålla dem på isen.
    2. Hämta cell pellets från-80 ° C lagring (eller is, om nyberedd). Tina varje cellpelleten i 37 ° C vattenbad för en 10 s, då överföring till is.
    3. Till varje cellpelleten omedelbart lägga iskall 1 x lyseringsbuffert + 1 x PIC till en slutlig koncentration på 10 000 celler/20 µL och mix 10 gånger av pipettering upp och ned, utan att skapa bubblor. För 70.000 celler är exempelvis den slutliga volymen 140 µL.
    4. Arbetar på is, alikvotens 20 µL per brunn av den resulterande lysates till en plattan med 96 brunnar. Täcka plattan med en plast tätning och inkubera på is för 20 min. etikett plattan ”MNase matsmältningen” och registrera brunnarna till en mall. För att säkerställa en exakt tidpunkt för kromatin matsmältningen reaktionen, Fortsätt inte att rötning med mer än 2 rader av prover på en gång.
    5. Strax innan 20 min Lys är komplett, späd MNase jag enzym med MNase jag utspädning buffert, till en slutlig koncentration av 20 U/µL, och hålla det på is.
    6. Arbetar på is, förbereda MNase jag matsmältningen master mix enligt tabell 4 och alikvotens 20 µL av blandningen per varje rad prover plus 5 µL död volym i en rad av en platta med 96 brunnar reservoar och hålla det på is. För två rader, volymen bör vara: (20 µL x 2) + 5 µL = 45 µL.
    7. Efter lysates avsluta ruvning, avlägsna MNase matsmältningen plattan från isen. Med hjälp av en flerkanalspipett, tillsätt 20 µL av MNase jag matsmältningen master mix i varje rad av prover och blanda 10 gånger genom pipettering upp och ner. Ändra tips mellan raderna. Odla i rumstemperatur för exakt 5 min.
    8. Efter 5 min, stoppa reaktionen, Använd en flerkanalspipett att lägga till 6 µL av 250 µM etylendiamintetraättiksyrans dinatriumsalt (EDTA) i varje rad av prover och mixa upp och ner några gånger. Ändra tips mellan raderna. Efter EDTA dessutom växla inställningen av pipetten till 20 µL och mix 10 gånger genom pipettering upp och ner för att säkerställa ett fullständigt stopp för matsmältningen reaktion. Ändra tips mellan raderna.
    9. Med hjälp av en flerkanalspipett, till varje rad i MNase rötas proverna, tillsätt 6 µL 10 x lyseringsbuffert och blanda väl genom pipettering upp och ner 10 gånger. Täcka med plast sigill och inkubera på is i 15 min.
  3. Ingående separation och före röjning
    1. Efter 15 min ruvning, arbetar på isen, pool alla brunnar för samma cell pellets/mall i en steril, pre kyld på is, 1,5 mL tub (pre märkt med mall-ID) och blanda grundligt men långsamt med pipett till Undvik tvättmedel.
    2. För varje cell pellets/mall, över 8 µL av smält kromatin i en ny steril, 0,5 mL rör (pre märkt med mall-ID) och förvaras vid 4 ° C över natten. Detta kommer att fungera som ingående kontroll.
    3. Fördela den resterande volymen av smält kromatinet i 48 µL portioner i en nya plattan med 96 brunnar. Cell pellets/mall 1 går i brunnar A01-A06, cell pellets/mall 2 går in i brunnar A07-A12, etc. Spela in brunnarna till en mall. Etikett på plattan ”före röjning”.
    4. Med hjälp av en flerkanalspipett, tillsätt 120 µL 1 x IP buffert + 1 x PIC och 12 µL av tvättade Protein A (eller G) magnetiska pärlor i varje brunn före röjningen plattan från steg 2.3.3. Blanda varje rad genom pipettering upp och ner 10 gånger. Ändra tips mellan raderna. Försegla plattan mycket väl med en aluminium plattan täcker och inkubera i en roterande plattform vid 4 ° C i minst 2 h.
  4. Immunoprecipitation reaktion
    1. Innan du börjar detta steg se till att den Ab-pärla komplexa (steg 2.1.10) och den före röjningen plåten (steg 2.3.4) har inkuberas för minst 2 h. Quick snurra båda plattorna genom centrifugering för 10 s vid 200 x g.
    2. Placera Ab-pärla komplexa plattan (från steg 2.1.10) på en tallrik magnet och vänta 15 s för att lösningen skall bli klart. Försiktigt bort och kasta bort supernatanten med pipett utan att störa pärlorna. Avlägsna plattan från plattan magneten och hålla det på is.
    3. Placera före röjningen reaktion plattan (från steg 2.3.4) på en tallrik magnet och vänta 15 s för pärlor för att separera och för att lösningen skall bli klart. Utan att störa pärlorna, noggrant överför supernatanten med pipett till de motsvarande brunnarna i Ab-pärla komplexa plattan förvaras på is och blanda försiktigt 15 gånger av pipettering upp och ner. Seal plattan väl med en aluminium pläterar locket och inkubera över natten (12-18 h) vid 4 ° C på en roterande plattform. Märka plattan ”IP reaktion”.

3. dag 2: ndCHIP-seq

  1. Tvättar och eluering
    1. Ställ in värme mixern till 65 ° C. På isen, förbereda en låg salthalt tvättbuffert och hög salthalt tvättbuffert. Snabb snurra IP reaktion plattan från steg 2.4.3 för 10 s vid 200 x g.
    2. Placera IP reaktion plattan på en tallrik magnet och vänta 15 s för att lösningen skall bli klart. Med hjälp av en flerkanalspipett, utan att störa pärlorna, noggrant avlägsna och Kassera supernatanten. Ta plattan utanför plattan magneten och placera den på is.
    3. Varje rad av prover i IP-reaktion plattan, tillsätt 150 µL av iskall låg salthalt tvätta buffert och blanda långsamt 10 gånger upp och ner för att fullt Omsuspendera pärlorna.
    4. Placera IP reaktion plattan tillbaka på plattan magneten, vänta på pärlor för att separera och med hjälp av en flerkanalspipett, utan att störa pärlorna avlägsna och Kassera supernatanten. Placera plattan tillbaka på isen och upprepa steg 3.1.3 och 3.1.4 för sammanlagt 2 tvättar.
    5. På isen, till varje rad av prover i IP-reaktion plattan, lägga 150 µL av hög salt tvätta buffert och blanda långsamt 10 gånger genom pipettering upp och ner för att fullt Omsuspendera pärlorna.
    6. Placera IP reaktion plattan tillbaka på plattan magneten, vänta på pärlor för att separera och med hjälp av en flerkanalspipett, utan att störa pärlorna avlägsna och Kassera supernatanten. Placera plattan IP reaktion på is och pre chill en nya plattan med 96 brunnar bredvid den.
    7. Varje rad av prover i IP-reaktion plattan, tillsätt 150 µL av hög salt tvätta buffert och blanda långsamt 10 gånger genom pipettering upp och ner för att fullt Omsuspendera pärlorna. Efter resuspension, överföra varje rad av prover till motsvarande rad av nya, pre kylda, 96 brunnar plattan. Etikett på plattan ”IP reaktion”. Kassera den gamla plattan.
    8. Placera den nya IP-reaktion plattan på plattan magneten och vänta på pärlor för att separera. Med hjälp av en flerkanalspipett, utan att störa pärlorna, noggrant avlägsna och Kassera supernatanten. Förvara plattan i rumstemperatur.
    9. Till varje rad av prover i IP-reaktion plattan, tillsätt 30 µL av ChIP eluering bufferten (EB) och blanda långsamt 10 gånger genom pipettering upp och ner. Se till att förhindra bubbla bildandet.
    10. Försegla plattan väl med en PCR-cover och inkubera i en värme mixer vid 65 ° C för 1,5 h med en blandande fart av 1 350 rpm.
    11. Efter 1,5 h inkubation, snurra ner IP reaktion plattan vid 200 x g för 1 min vid 4 ° C. Ändra inställningen för uppvärmning mixern till 50 ° C.
    12. Efter spin, placera IP reaktion plattan på en tallrik magnet och vänta på lösningen att rensa. Med hjälp av en flerkanalspipett, utan att störa pärlorna, noggrant över 30 µL av supernatanten till en nya plattan med 96 brunnar. Använd färska tips för varje rad. Etikett på plattan ”IP reaktion” och förvara det i rumstemperatur.
  2. Protein matsmältningen
    1. Hämta 30% PEG/1 M NaCl magnetiska pärla17 (buffert sammansättning tabell) lösning från 4 ° C kylskåpet och förvara det i rumstemperatur i minst 30 min. kritisk: se till att pärla lösningen fullt når rumstemperatur innan du fortsätter.
    2. Hämta Inspelningsvolym prover från 4 ° C lagring (steg 2.3.2) och snabb spinn. Mäta volymen med hjälp av en pipett och tillsätt ultrarent vatten till varje Inspelningsvolym för en slutlig volym av 30 µL. överföra Inspelningsvolym proverna till förvalda ingående brunnarna (tomma brunnar) i IP-reaktion plattan (steg 3.1.12). Spela in brunnen till prov nyckel.
    3. På isen, förbereda Protein matsmältningen Master Mix som visas i tabell 5 och alikvotens lika volym i en rad av en platta med 96 brunnar reservoar.
    4. Med hjälp av en flerkanalspipett, till varje rad av prover i IP-reaktion plattan, tillsätt 40 µL av Protein matsmältningen Master Mix och blanda långsamt 10 gånger upp och ner. Försegla plattan väl med en PCR-cover, snurra ner vid 200 x g i 1 min och inkubera i en värme mixer vid 50 ° C i 30 min på 650 rpm. Medan plattan ruvning, förbereda färska 70% etanol (EtOH) och förvara det i rumstemperatur.
    5. Efter 30 min ruvning är komplett, snurra IP reaktion plattan vid 200 x g i 1 min, 4 ° C. Förvara plattan i rumstemperatur.
      Obs: Den totala volymen bör nu ~ 70 µL per brunn.
  3. Bead ren-upp med 30% PEG/1 M NaCl magnetiska pärla lösning
    1. Alikvotens rumstemperatur 30% av PEG/1 M NaCl magnetiska bead lösning i en rad med en ren 96 brunnar reservoar tallrik (75 µL per prov x antal rader).
    2. Arbetar vid rumstemperatur, med hjälp av en flerkanalspipett, lägga till 70 µL (1:1 ratio) 30% PEG/1 M NaCl magnetiska pärla lösningen i varje rad av prover i IP-reaktion plattan och blanda 10 gånger genom pipettering upp och ner. Ändra tips mellan raderna. Inkubera plattan för 15 min i rumstemperatur.
    3. Placera plattan på plattan magneten och inkubera i 5 min att tillåta pärlor för att separera.
    4. Med pipett, utan att störa pärlorna försiktigt avlägsna och Kassera supernatanten. Förvara pärlorna.
    5. Medan IP-reaktion plattan är fortfarande på plattan magneten, med hjälp av en flerkanalspipett, till varje rad av prover, tillsätt 150 µL av rumstemperatur 70% EtOH och inkubera i 30 s. Efter 30 s, med hjälp av en flerkanalspipett, avlägsna och Kassera supernatanten. Upprepa detta en gång för sammanlagt 2 tvättar.
    6. Efter den andra EtOH tvättningen, inkubera plattan magneten 'torra' plattan för 3 min. okulärbesiktiga plattan att se till att alla EtOH indunstas. Om så inte är fallet, inkubera plattan för 1 min. uttorkning pärlor resultaten i en lägre avkastning.
    7. Ta plattan utanför plattan magneten och med hjälp av en flerkanalspipett, tillsätt 35 µL EB (Tabell för material). Blanda väl genom pipettering 10 gånger upp och ner. Ändra tips mellan raderna. Odla i rumstemperatur i 3 min till eluera.
    8. Efter inkubation, placera IP reaktion plattan tillbaka på plattan magneten och inkubera i 2 min. Pärlorna ska separera och lösningen blir klart.
    9. Med hjälp av en flerkanalspipett, utan att störa pärlorna, noggrant över supernatanten i motsvarande brunnar av en nya plattan med 96 brunnar.
    10. Försegla plattan med en aluminium plattan täcker, etikett ”IPed + Input DNA” och förvaras vid 4 ° C över natten, eller vid-20 ° C för långsiktig (> 48 h) lagring.

4. dag 3: Bibliotek konstruktion

  1. Slutet reparation och fosforylering
    1. Ingång för slutet reparation/fosforylering reaktionen är IPed + ingång plattan från steg 3.3.10. Efter upptining, snurra plattan ner vid 200 x g för 1 minuter vid 4 ° C och hålla det på is.
    2. Hämta från-20 ° C frys alla reagenser (utom enzymer) krävs för slutet reparation/fosforylering reaktionen (tabell 6) och Tina dem i rumstemperatur och sedan omedelbart överföra för att is.
    3. Arbetar på is, följ tabell 6 ställa in slutet reparation/fosforylering Master Mix i ett sterilt, 1,5 mL mikrocentrifug rör. Efter tillägg av alla icke-enzym komponenter, blanda väl genom puls-vortexa och placera röret tillbaka på is.
    4. Hämta de relevanta enzymerna från deras kall förvaring och transport till bänken i ett kylt tube cool rack. Blanda varje enzym genom att snärta den tube, snabb spinn och placera den tillbaka i kylda tube cool rack. När pipettering enzymet, aspirera långsamt för att säkerställa en korrekt volym överföring. Efter tillägg, skölj spetsen i huvudmixen genom pipettering upp och ner.
    5. När enzymer tillsätts, tillbaka försiktigt puls-vortex master mix 5 gånger att garantera en jämn fördelning av alla komponenter och sedan snabb spinn och placera röret omedelbart på is.
    6. På isen, alikvot en lämplig volym av slutet reparation/fosforylering Master Mix till en rad nya platta som 96 brunnar reservoar; volymen ska vara aliquoted: (15 µL x # rader) + 5 µL dödvolym. Ett beräkningsexempel för två rader: (15 µL x 2) + 5 µL = 35 µL per brunn.
    7. Med hjälp av en flerkanalspipett, tillsätt 15 µL slutet reparation/fosforylering Master Mix i varje rad av prover och blanda 10 gånger genom pipettering upp och ner. Ändra tips mellan raderna. Försegla plattan med en plastkåpa, snurra ner vid 200 x g för 1 minuter vid 4 ° C och odla i rumstemperatur i 30 min.
  2. Bead sanering efter slutet reparation och fosforylering
    1. Från 4 ° C kylskåp, Hämta 20% PEG/1 M NaCl magnetiska pärla lösning och 30% PEG/1 M NaCl-lösning och odla i rumstemperatur i minst 30 min.
      Obs: De 30% PEG/1 M NaCl-lösningen inte innehåller magnetiska pärlor.
    2. När båda lösningarna rumstemperatur, för varje prov förbereda 80 µL av 1:2 blandning av 30% PEG/1 M NaCl och 20% PEG/1 M NaCl magnetiska pärla lösningar. Ett exempel för 24 prov: 80 µL x 24 = 1,920 µL (640 µL av 30% PEG/1 M NaCl och 1 288 µL 20% PEG/1 M NaCl magnetiska pärla lösningar).
    3. Alikvotens pärla lösningen blanda, lika volym, i en rad av en platta med 96 brunnar reservoar och förvara det i rumstemperatur. Alikvotens EB buffert (40 µL per prov x # rader) i en rad med en ren 96 brunnar reservoar tallrik. Ett exempel på två rader: 40 µL x 2 = 80 µL per brunn.
    4. Med hjälp av en flerkanalspipett, tillsätt 75 µL pärla mix beredd i Stig 4.2.2 in i varje rad av prover från steg 4.1.7 och blanda upp och ner 10 gånger. Ändra tips mellan raderna. Odla i rumstemperatur i 15 min. Fortsätt med pärla sanering förfarande som beskrivs i steg 3.3.3-3.3.10. Täcka plattan med en plast tätning, snabb spinn och placera den på is. Fortsätt till steg 4,3.
  3. A-Tailing reaktion
    1. Hämta från-20 ° C frysen alla reagenser (utom enzymer) som krävs för A-Tailing reaktionen (tabell 7), Tina dem i rumstemperatur och sedan omedelbart överföra för att is.
    2. Arbetar på is, följ tabell 7 att ställa in A-Tailing Master Mix i ett sterilt, 1,5 mL mikrocentrifug rör. Följ instruktionerna allmänna enzymatisk brew setup som beskrivs i steg 4.1.4-4.1.6.
    3. Med hjälp av en flerkanalspipett, tillsätt 15 µL A-Tailing Master Mix i varje rad av prover och blanda 10 gånger genom pipettering upp och ner. Ändra tips mellan raderna. Försegla plattan med en PCR-cover, snurra ner vid 200 x g för 1 minuter vid 4 ° C och inkubera i en termocykler vid 37 ° C i 30 min. Efter inkubering, snurra plattan ner vid 200 x g i 1 min och förvara det i rumstemperatur.
  4. Bead sanering efter A-Tailing
    1. Utföra stegen som beskrivs i steg 4,2. Täcka plattan med en plast tätning, etikett ”A-tail + BC”, snabb spinn, och placera den på is. Fortsätt till steg 4,5.
  5. Adapter ligatur
    1. Hämta från-20 ° C frysen alla reagenser (utom enzymer) krävs för adapter ligering reaktionen (tabell 8), Tina dem i rumstemperatur och sedan omedelbart överföra för att is.
    2. Hämta 10 µM PE adaptern (kompletterande Tabell1) stamlösning och späd till 0,5 µM med EB. Blanda väl genom puls vortexa. Den volym som krävs är 3 µL x # av prover. Arbetar på is, alikvotens 0,5 µM PE adaptern, lika volym, i 12 brunnar ren 96 brunnar reservoar platta. Håll det på is.
    3. Arbetar på is, följ tabell 8 ställa in Adapter Ligation Master Mix i ett sterilt, 1,5 mL mikrocentrifug rör. Följ instruktionerna allmänna enzymatisk brew setup som beskrivs i steg 4.1.4-4.1.6. Kontrollera att 5 X snabb Ligation buffert är helt tinade och mycket väl blandas före användning.
    4. På isen, alikvot en lämplig volym av Adapter Ligation Master Mix till en rad nya platta som 96 brunnar reservoar. Exempelvis beräkning för två rader: (23 µL x 2) + 5 µL = 51 µL per brunn. Hålla plattan på is.
    5. Med hjälp av en flerkanalspipett, tillsätt 2 µL av den 0,5 µM ihopkopplade slutet (PE) adaptern i varje rad av prover från steg 4.4.1 och mix. Ändra tips mellan raderna.
    6. Med hjälp av en flerkanalspipett, tillsätt 23 µL Adapter Ligation Master Mix i varje rad av prover och blanda 15 gånger genom pipettering upp och ner. Ändra tips mellan raderna. Försegla plattan med en metall täcka, etikett ”Ligation”, varva ner på 200 x g för 1 min vid 4 ° C, och odla i rumstemperatur över natten.
  6. Dag 4: Bead sanering #1 efter adapter ligatur
    1. Från 4 ° C kylskåp, hämta den magnetiska pärla 20% PEG/1 M NaCl-lösningen och odla i rumstemperatur i minst 30 min. Medan lösningen equilibrating förbereda färska 70% EtOH.
    2. Alikvot 20% PEG/1 M NaCl magnetiska pärla lösningen, 55 µL per prov, i en rad av en 96 brunnar reservoar tallrik och förvara det i rumstemperatur. Ett exempel på två rader: 55 µL x 2 = 110 µL per brunn.
    3. Alikvotens EB buffert, 50 µL per prov, i en rad med en ren 96 brunnar reservoar tallrik. Ett exempel på två rader: 50 µL x 2 = 100 µL per brunn.
    4. Med hjälp av en flerkanalspipett, tillsätt 48 µL av 20% PEG/1 M NaCl magnetiska pärla lösningen i varje rad av prover i ligatur plattan från steg 4.5.6 och blanda upp och ner 10 gånger. Ändra tips mellan raderna. Odla i rumstemperatur i 15 min. Fortsätt med pärla sanering förfarande som beskrivs i steg 3.3.3-3.3.7.
    5. Ta plattan utanför plattan magneten och med hjälp av en flerkanalspipett, tillsätt 45 µL EB (Tabell för material). Blanda väl genom pipettering 10 gånger upp och ner. Ändra tips mellan raderna. Inkubera i rumstemperatur i 3 min till eluera.
    6. Efter inkubation, placera IP reaktion plattan tillbaka på plattan magneten och inkubera i 2 min. med hjälp av en flerkanalspipett, utan att störa pärlorna, noggrant överför supernatanten i motsvarande brunnar av en nya plattan med 96 brunnar. Etikett på plattan ”ligering + 1 BC”.
    7. Till varje brunn Tillsätt 5 µL 10 x PCR HiFi buffert och blanda väl genom pipettering upp och ner. Ändra tips mellan raderna. Täcka plattan med en plast tätning, snabb spinn, och förvara det i rumstemperatur.
  7. Bead sanering #2 efter adapter ligatur
    1. Utför sanering i pärla som beskrivs i avsnitt 4.6 med följande ändringar: Tillsätt 60 µL 20% PEG/1 M NaCl magnetiska pärla lösningen för varje aktiv brunn i ligering + 1 BC plattan (steg 4.6.7) och eluera från pärlorna med 35 µL av EB buffert. Etikett på plattan ”ligering + 2 f.Kr”. och hålla den på is.
  8. PCR-amplifiering
    1. Hämta från-20 ° C frysen alla reagenser (utom enzymer) krävs för PCR-reaktionen (tabell 9), Tina dem i rumstemperatur och sedan placera dem omedelbart på is.
    2. Arbetar på is, följ tabell 9 konfigurera PCR Master Mix i ett sterilt, 1,5 mL mikrocentrifug rör. Följ instruktionerna allmänna brygga set-up som beskrivs i steg 4.1.4-4.1.5. På isen, alikvot en lämplig volym av PCR-Master Mix till en rad nya platta som 96 brunnar reservoar. Håll det på is. Se punkt 4.5.4 för prov beräkningar.
    3. Arbetar på isen, med hjälp av en flerkanalspipett, tillsätt 2 µL av varje unik 12,5 µM PCR omvänd indexering primer (kompletterande tabell2) till varje brunn i ligering + 2 f.kr plattan (steg 4.7.1) och blanda långsamt upp och ner. Ändra tips mellan raderna. Hålla plattan på is.
    4. Arbeta på isen, med hjälp av en flerkanalspipett, tillsätt 23 µL av PCR huvudmixen i varje rad av prover från steg 4.8.3 och mix 10 gånger av pipettering upp och ner. Försegla plattan med en PCR-cover, snurra den ner vid 200 x g i 1 min och inkubera i en termocykler (se tabell 10 för PCR-cykling villkor).
  9. Bead sanering efter PCR-amplifiering
    1. Efter PCR-amplifiering snurra plattan vid 200 x g i 1 min, 4 ° C. Utför pärla saneringen som beskrivs i avsnitt 4.6 med följande ändringar: Lägg 51 µL 20% PEG/1 M NaCl magnetiska pärla lösning till varje PCR-reaktion och eluera från pärlorna med 25 µL av EB buffert. Försegla plattan med en aluminium locket och snurra ner vid 200 x g för 1 min. Store proverna vid-20 ° C.
    2. För att validera Byggyta bibliotek, utföra DNA kvantifiering med en fluorescens-baserad analys, visualisera den slutliga produkten med hjälp av ett chip-baserade kapillärelektrofores analyzer (hög känslighet analys) och köra anrikning kvantitativ PCR (qPCR) (se Representativa resultat, validering av ndChIP-seq bibliotek kvalitet av qPCR).

Representative Results

Kromatin matsmältningen profiler
Optimering av MNase matsmältningen är avgörande för framgång i detta protokoll. Det är avgörande för att generera en matsmältningen profil domineras av enstaka nukleosomens fragment storlekar, medan inte över smält, som möjliggör återvinning av högre ordning nukleosomens fragment. En perfekt matsmältning-profil består av en majoritet av enstaka nukleosomens fragment med en bråkdel som representerar fragment mindre och större än enstaka nucleosomes. Figur 1 visar exempel på en perfekt över smält och under-rötas storlek distribution profiler. Observera att optimal matsmältning av kromatin blir också uppenbart i profilen för sekvensering biblioteket genereras från IP-materialet (figur 2).

Validering av ndChIP-seq bibliotek kvalitet av qPCR
qPCR är en väletablerad metod för bedömning av kvaliteten på ChIP18,19,20. När utför ndChIP-seq på 10 000 celler avkastningen av nukleinsyra efter IP kommer att understiga 1 ng. Därför är det viktigt att utföra qPCR efter bibliotek konstruktion att bedöma den relativa anrikningen av målregionerna under bakgrund. För att ge en bakgrund uppskattning, genereras bibliotek tillverkad av MNase rötas kromatinet (ingång). För varje IP-bibliotek behövs två uppsättningar av primers (se Supplementaltabell 3 för en lista av primers för vanliga Histon märken). En primer uppsättning bör vara specifika för en genomisk som konsekvent med Histon ändring av intresse (positiva mål) och en annan region som inte är markerad med Histon ändring av intresse (negativa mål). Kvaliteten på ChIP-seq biblioteket kommer att bedömas som vik berikning med avseende på ingående bibliotek. Fold anrikning kan beräknas med hjälp av följande ekvation som förutsätter exponentiell amplifiering av målregionen genomisk: 2Ctingående-CtIP. Våra anpassade gjort statistiskt programpaket som R, qcQpcr_v1.2, är lämplig för qPCR anrikning analys av låg input infödda ChIP-seq bibliotek (Kompletterande koden filer). Figur 3 representerar en qPCR resultat för lyckade och misslyckade ChIP-seq bibliotek. Minsta beräknade fold anrikning värdet för god kvalitet ndChIP-seq bibliotek är 16 för smala märken, såsom H3K4me3 och 7 för breda märken, till exempel H3K27me3.

Modeling MNase tillgänglighet
Computational analys av ChIP-seq är komplexa och unika för varje experimentella inställning. En uppsättning riktlinjer som fastställts av internationella mänskliga epigenetisk Consortium (IHEC) och The Encyclopedia av DNA element (koda) kan användas för att bedöma kvaliteten på de ChIP-seq bibliotek21. Det är viktigt att notera att biblioteken sekvensering djup effekter detektering och upplösning av berikade regioner20. Antalet toppar detekterade och närmar sig en platå som Läs djup ökar. Vi rekommenderar ndChIP-seq bibliotek ska sekvenseras enligt IHEC rekommendationer av 50 miljoner Parade-läser (25 miljoner fragment) för smala märken (t.ex., H3K4me3) och 100 miljoner Parade-läsningar (50 miljoner fragment) för breda märken ( e.g., H3K27me3) och ingång22. Dessa sekvensering djup ger tillräcklig sekvens linjeföring för detektion av de mest betydelsefulla topparna med allmänt använda ChIP-seq peak uppringare, såsom MACS2 och HOMER, utan att nå mättnad23,24. En hög kvalitet hos däggdjur ndChIP-seq bibliotek har en PCR-dubbla < 10% och referens genomet anpassningen klassar på > 90% (inklusive duplicerade läsningar). Framgångsrika ndChIP-seq bibliotek kommer att innehålla högt korrelerade replikerar med en betydande del (> 40%) av justerad läsningar inom MACS222 identifierade berikad toppar och inspektion av arrangera i rak linje läser på en genomet webbläsare bör avslöja visuellt detekterbara rikedomar jämfört med ingång biblioteket (figur 4). Dessutom ndChIP-seq kan användas för att bedöma nukleosomens densitet genom att utnyttja en Gaussisk blandning distribution algoritm (w1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) vid MACS2 identifieras berikade regioner till modell nukleosomens densitet som definieras av MNase tillgängliga gränser. I den här modellen w1 representerar mono-nukleosomens distribution vikt och w2 representerar di-nukleosomens distribution vikt. Där w1 är större än w2, finns det dominans av mono-nukleosomens fragment och vice versa. Denna analys kräver att biblioteken sekvenseras i en parad-end mode så att fragmentet storlekar kan definieras. För att tillämpa Gaussisk blandning distribution algoritmen, identifieras först statistiskt signifikant berikade regioner. Vi föreslår topp yrken med MACS2 med ingång som kontroll och med standardinställningarna för smala märken och en q värde cutoff 0,01 för breda märken. Ett antal statistiska paket anställa en Gaussisk blandning distribution algoritm finns tillgängliga från allmänt använda statistisk programvarupaket. Utnyttja genomsnittliga fragment storlek, bestäms av Parade-end Läs gränser av IPed proverna, distributioner på MACS2 identifieras berikad initiativtagare, och en Gaussisk blandning distribution algoritm kan tillämpas på varje arrangören med R-statistiska paket Mclust version 3.025 att beräkna en vägda fördelning. I denna ansökan rekommenderar vi att eliminera initiativtagare som innehåller mindre än 30 justerad fragment eftersom under denna tröskel den resulterande vikten uppskattningar blir otillförlitliga. En god kvalitet ndChIP-seq bibliotek genererar en Gaussisk blandningsfördelningen som består av två huvudkomponenter med genomsnittliga värden som motsvarar mono-, di-nukleosomens fragment längder.

Figure 1
Figur 1 : Bedömning av MNase matsmältningen innan biblioteket generation. Chip-baserade kapillärelektrofores analyzer profiler av en optimal MNase rötas (A), under-rötas (B) och över rötas (C) kromatin. Biologiska replikat visas som blå, röda och gröna spår. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Bedömning av MNase matsmältning efter bibliotek generation. (A) publicera bibliotek konstruktion profiler av optimalt smält input (biologiska replikat; röd, grön, svart) och IP (biologiska replikat, cyan, lila, blå) och (B) optimal inmatning (biologiska replikat; röd, grön, blå) och IP ( biologiska replikat; cyan, lila, orange) bibliotek. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Post bibliotek konstruktion kvantitativa PCR kan användas för att bedöma kvaliteten på ndChIP-seq bibliotek. Fold anrikningen av H3K4me3 IP bibliotek med avseende på ingående bibliotek beräknas som 2(Ct av input - Ct av IP) för positiva och negativa mål med hjälp av qcQpcr_v1.2. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Representativa ndChIP-seq biblioteket konstruerat från 10.000 primära CD34+ sladd blodkroppar. Pearson korrelation av H3K4me3 signal (läsningar per miljon mappade läsningar) beräknas i initiativtagarna (TSS +/-2Kb) mellan 3 biologiska replikat, (A) replikera 1 och 2, (B) replikera 1 och 3, (C) replikera 2 och 3. (D), UCSC Webbläsarvy av HOXA gen klustret av tvärbunden ChIP-seq genereras från 1 miljon celler per IP, framgångsrika ndChIP-seq från 10 000 celler per IP och misslyckade ndChIP-seq från 10 000 celler per IP. (röd: H3K27me3, grön: H3K4me3, och svart: Input). (E) bråkdel av mappade läsningar inom MACS2 identifierade berikade regioner av H3K4me3 (svart) och H3K27me3 (grå). Klicka här för att se en större version av denna siffra.

Buffert sammansättning
A.1. Immunoprecipitation buffert (IP)
20 mM Tris-HCl pH 7,5
2 mM EDTA
150 mM NaCl
0,1% Triton x-100
0,1% deoxicholat
10 mM natrium Butyrate
A.2. låg Salt tvättbuffert
20 mM Tris-HCl pH 8,0
2 mM EDTA
150 mM NaCl
1% Triton x-100
0,1% SDS
A.3. hög Salt tvättbuffert
20 mM Tris-HCl pH 8,0
2 mM EDTA
500 mM NaCl
1% Triton x-100
0,1% SDS
A.4. ChIP eluering buffert
100 mM NaHCO3
1% SDS
A.5. 1 x lyseringsbuffert – 1 mL
0,1% Triton
0,1% deoxicholat
10 mM natrium Butyrate
A.6. Ab förtunningsbuffert
0,05% (w/v) natriumazid
0,05% brett spektrum antimikrobiell (t.ex. ProClin 300)
i PBS
A.7. 30% PEG / 1M NaCl magnetiska pärla lösning (referens16)
30% PEG
1 M NaCl
10 mM Tris HCl pH 7,5
1 mM EDTA
1 mL av tvättade Super paramagnetiska pärlor
A.8. 20% PEG / 1M NaCl magnetiska pärla lösning (referens16)
30% PEG
1 M NaCl
10 mM Tris HCl pH 7,5
1 mM EDTA
1 mL av tvättade Super paramagnetiska pärlor

Tabell 1: ndChIP-seq buffert sammansättning.

Histon modifiering Koncentration (µg/µL)
H3K4me3 0,125
H3K4me1 0,25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabell 2: Antikropp belopp som krävs för ndChIP-följande punkter

Reganet Volym (µL)
Ultrarent vatten 478
1 M Tris-HCl pH 7,5 10
0,5 M EDTA 10
5 M NaCl 2
Glycerol 500
Totala volymen 1 000

Tabell 3: Recept för MNase förtunningsbuffert.

Reagens Volym (µL)
Ultrarent vatten 13
20 mM DTT 1
10 x MNase buffert 4
20 U/µl Mnase 2
Totala volymen 20

Tabell 4: Recept för MNase Master Mix.

Reagens Volym (µL)
Eluering buffert 30
Buffert G2 8
Proteashämmare 2
Totala volymen 40

Tabell 5: Recept för DNA rening Master Mix.

Reagens Volym (µL)
Ultrarent vatten 3.3
10 x begränsning Amiiiiin buffert (t.ex. NEBuffer) 5
25 mM ATP 2
10 mM dNTP 2
T4 Polynucleotide Kinase (10 U/µl) 1
T4 DNA-polymeras (3 U/µl) 1.5
DNA-polymeras I, Large (Klenow) Fragment (5 U/µl) 0,2
Totala volymen 15

Tabell 6: Recept på slutet reparation Master Mix.

Reagens Volym (µL)
Ultrarent vatten 8
10 x begränsning Amiiiiin buffert (t.ex. NEBuffer) 5
10 mM dATP 1
Klenow (3' - 5' exo-) 1
Totala volymen 15

Tabell 7: Recept för A-Tailing Master Mix.

Reagens Volym (µL)
Ultrarent vatten 4.3
5 x snabb ligering buffert 12
T4 DNA-ligase (2000 U/µl) 6,7
Totala volymen 23

Tabell 8: Recept för Adapter Ligation Master Mix.

Reagens Volym (µL)
Ultrarent vatten 7
25 uM PCR primer 1.0 2
5 x HF buffert 12
DMSO 1.5
DNA-polymeras 0,5
Totala volymen 23

Tabell 9: Recept för PCR-Master Mix.

Temprature (° C) Varaktighet (s) Antal cykler
98 60 1
98 30
65 15 10
72 15
72 300 1
4 Håll Håll

Tabell 10: PCR kör metoden.

Oligo Sekvens Ändring
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 ' 5' modifiering: fosforylering
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' modifiering: * T är en phosphorothioate bond

Kompletterande tabell 1: Oligo sekvenser för generering av PE-adapter.

Primer namn Sekvens Index IndexRevC (att användas för sekvensering)
PCR-omvänd indexering primer 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR-omvänd indexering primer 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR-omvänd indexering primer 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR-omvänd indexering primer 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR-omvänd indexering primer 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR-omvänd indexering primer 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR-omvänd indexering primer 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR-omvänd indexering primer 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR-omvänd indexering primer 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR-omvänd indexering primer 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR-omvänd indexering primer 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR-omvänd indexering primer 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR-omvänd indexering primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR-omvänd indexering primer 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR-omvänd indexering primer 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR-omvänd indexering primer 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR-omvänd indexering primer 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR-omvänd indexering primer 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR-omvänd indexering primer 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR-omvänd indexering primer 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR-omvänd indexering primer 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR-omvänd indexering primer 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR-omvänd indexering primer 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR-omvänd indexering primer 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Kompletterande tabell 2: PCR omvänd indexering primer sekvenser.

Grundfärger Sekvens
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Histon modifiering Positiva mål Negativa mål
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Kompletterande tabell 3: En lista av primers för vanliga Histon markerar (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 och H3K36me3).

Kompletterande fil 1: ndChIP-seq kalkylblad. Vänligen klicka här för att hämta den här filen.

Kompletterande koden filer: qcQpcr_v1.2. R statistiska programpaket för qPCR anrikning analys av låg input infödda ChIP-seq bibliotek. Vänligen klicka här för att hämta den här filen.

Discussion

Kombinatoriska med tanke på kromatin modifiering och nukleosomens positionering i Transkriptionsreglering, är en metod som möjliggör samtidiga mätningar av dessa funktioner sannolikt att ge nya insikter i epigenetisk reglering. NdChIP-seq protokollet presenteras här är en native ChIP-seq protokoll optimerad för att möjliggöra samtidiga förhör av Histon modifiering och nukleosomens täthet i sällsynta primära celler9,10. ndChIP-seq använder tredjeparts enzymatisk nedbrytning av kromatin som, när kopplat till parat-end massivt parallella sekvensering och en Gaussisk blandning distributionsmodell, möjliggör undersökning Histon ändringar på enstaka nukleosomens nivå och den deconvolution av epigenetisk profiler drivs av heterogenitet inom en befolkning. Använder det här protokollet, har vi tidigare rapporterat en unik distribution av immuno-fällt fragment storlekar, bestäms av Parade-end Läs gränser, associerade med specifika kromatin stater definieras av ChromHMM10,24.

Kvaliteten på en ndChIP-seq bibliotek beror på flera faktorer, såsom antikropp specificitet och känslighet, optimala MNase matsmältning och kvalitet av kromatinet. Specificiteten av antikroppar används är avgörande i att producera framgångsrika ndChIP-seq bibliotek. En idealisk antikropp visar hög affinitet mot epitop sevärdheter med lite arg reactivity med andra epitoper. Det är lika viktigt att välja magnetiska pärlor med det högsta affinitet för antikroppen val.

MNase matsmältning är en kritisk och tid - och koncentration-känslig reaktion i detta protokoll. När du bearbetar flera prover, det är därför viktigt att varje reaktion inkuberas i motsvarande mängd tid (se steg 2.2). Kvaliteten på kromatinet är en annan faktor som kraftigt påverkar resultatet av ndChIP-följande punkter fragmenterade kromatin leder till en suboptimal MNase matsmältningen profil och resultat i bibliotek med en låg signal-brus-förhållande. Primära prover med låg cellviabilitet eller försämrad kromatin, såsom formalin-fast paraffin-inbäddat (FFPE) vävnad inte rekommenderas för detta protokoll.

Tillägg av en PIC under kromatin extraktion minskar oönskade (dvsslumpmässiga) kromatin fragmentering och bevarar integriteten hos Histon svansar. Som sådan, behöver PIC läggas till lyseringsbuffert och immunoprecipitation buffert strax före användning. Samtidigt välja celler via flödescytometri, Välj för viabla celler och säkerställa sorteras celler med en låg flödeshastighet att öka noggrannheten i cell nummer uppskattningen och viabiliteten hos celler. Undvika sortering celler direkt in lyseringsbuffert. Skidan bufferten kommer att späda ut lyseringsbuffert och förhindrar effektivt permeabilisering av cellmembranet till MNase. Beroende på en typ av celler eller organism krävas titrering av MNase att erhålla optimal matsmältning.

ndChIP-seq på däggdjursceller kräver ett minsta sekvensering djup 50 miljoner Parade-läsningar (25 miljoner fragment) för smala märken och 100 miljoner Parade-läsningar (50 miljoner fragment) för breda märken och input. Gaussisk blandning distribution algoritmen kommer inte att fungera optimalt på bibliotek som har varit sekvenserade djup betydligt under denna rekommendation. ndChIP-seq kommer inte klassificera initiativtagare med lite separation mellan vägda distribution värdet för mono - och di-nukleosomens fragment längder in mono - eller di-nukleosomens dominerade initiativtagare. Därför måste dessa initiativtagare tas bort i den efterföljande analysen. Biologiska replikat kan skapas för att öka förtroendet för förväntade distributioner och identifiera tekniska variabilitet i MNase matsmältning och bibliotek byggandet.

Till skillnad från tidigare iterationer av infödda ChIP-seq protokoll ger ndChIP-seq möjlighet att undersöka kombinatoriska effekten av kromatin struktur och Histon ändring genom att utnyttja fragment storlek post immunoprecipitation för att integrera nukleosomens täthet, bestäms av MNase tillgänglighet, med Histon modifiering mätningar. Tillämpning av ndChIP-seq på primära celler och vävnader kommer att ge nya insikter i integrativ beskaffenhet epigenetisk reglering och möjliggöra identifiering av epigenetiska signaturer på grund av heterogenitet inom befolkningen.

Disclosures

Författarna förklarar att de har inga konkurrerande finansiella intressen.

Acknowledgements

A.L. stöddes av en kanadensisk Graduate stipendium av kanadensiska institut för hälsa forskning. Detta arbete fick stöd genom bidrag från genomet British Columbia och kanadensiska institut för hälsa forskning (CIHR-120589) som en del av den kanadensiska epigenetik, miljö och hälsa Research Consortium Initiative och Terry Fox forskningsprogrammet Institute Projektet Grant #TFF-122869 till M.H. och ett forskningsinstitut för Terry Fox nya Investigator Award (Grant # 1039) till M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics