Поколение моделей клеток рака простаты сопротивления против митотическая агент доцетаксел

Cancer Research
 

Summary

Устойчивость к терапии рака способствует прогрессирования заболевания и смерти. Определение механистический основы сопротивления имеет решающее значение для улучшения терапевтического ответа. Эта рукопись детали протокола для создания модели taxane устойчивостью клеток рака простаты (ПК), чтобы помочь рассекает пути участвует в прогрессии Доцетаксел сопротивление в больных PC.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Микротрубочки ориентации агентами (MTA) являются опорой в лечении широкого спектра опухолей. Однако приобретенных сопротивление химиотерапевтических препаратов является общим механизмом прогрессирования заболевания и функцию прогнозно определитель злокачественных опухолей. В рак простаты (PC) устойчивость к МТС например taxane Доцетаксел диктует неэффективности лечения, а также прогрессии к смертельной стадиях заболевания, которые определяются плохой прогноз и высокой смертности. Хотя учился на протяжении десятилетий, массив механизмов, способствующих приобретенных сопротивления полностью не поняты и таким образом создают значительные ограничения для развития новых терапевтических стратегий, которые могли бы принести пользу пациентам, в эти дополнительные этапы болезни. В этом протоколе, мы описываем поколения Доцетаксел стойкие простаты рак клеточных линий, которые имитируют смертельной черты поздней стадии рака простаты и поэтому может использоваться для изучения механизмов, которые приобретенных chemoresistance возникает. Несмотря на потенциальные ограничения, присущие ячейки на основе модели, например потери свойств сопротивления со временем, доцетаксел устойчивые клеточные линии, производимые этот метод успешно применялись в недавних исследованиях и предлагают возможность для продвижения вперед наших молекулярные понимание приобретенных chemoresistance смертоносных рака простаты.

Introduction

Увеличение скорость распространения, вызванные потерей контроля клеточного цикла является отличительной чертой рака1. Это функциональное свойство оказывает раковые клетки однозначно зависит от точности ключевых процессов клеточного цикла во время S - и М-фазы, которая привела к развитию различных клеточного цикла нарушается препаратов, которые вызывают повреждение ДНК или митотическая дефектов. Хотя многочисленные анти митотическая агентов, например ингибиторов митотическая киназы или моторов белков, в настоящее время разрабатываются и испытываются в клинических испытаниях, наследие микротрубочек таргетинга агентов (MTA) по-прежнему быть единственный клинически утвержденных подход для ориентация митоз в рак2,3,4. MTA либо дестабилизировать (винбластин, винкристин, винорелбин) или стабилизировать микротрубочек (taxane производные агентов паклитаксел, доцетаксел или Cabazitaxel) и тем самым предотвратить формирование функционирования митотического шпинделя5,6. Эти агенты вызвать шпинделя Ассамблеи контрольно-пропускной пункт7,8, что приводит к длительной митотическая арест и возможного клеточной гибели в культивируемых клеток9,10 и митотического дефекты в опухоли11 ,12 и поэтому полезны для лечения рака простаты13большое разнообразие видов рака, среди них.

Наиболее часто диагностируется рак простаты рак и ведущей причиной рака смертей мужчин14. Antimitotic агенты, такие как Доцетаксел улучшить выживаемость рака простаты пациента и являются опорой в лечении этой болезни по15,16,17. К сожалению несмотря на первоначальные опухоли усадка, опухолевые клетки часто развиваются лекарственной устойчивости во время лечения. Несколько клеточных механизмов были причастны причиной развития chemoresistance, включая дерегулирование apoptotic и воспалительных пути, или активации/гиперэкспрессия наркотиков измеряем насосов как АТФ привязки кассеты транспортер Р-гликопротеина (P-gp/ABCB1), последний из которых в результате экспорта химиотерапевтических агентов из клетки18,19. Устойчивость к таксаны также были связаны с другими причинами, такими, как изменения в выражении тубулин изотипов или тубулин мутации, которые препятствуют взаимодействию между наркотиками и его цели 20,21. Кроме того сопротивление была связана с накоплением нестабильности генома и опухоли неоднородность22,23. Однако механизмов, способствующих taxane сопротивления являются полностью не поняты, что является очевидным отсутствием терапевтические стратегии, которые препятствуют его внешний вид. Таким образом существует настоятельная необходимость для создания экспериментальных моделей, которые помогают в рассечение этих механизмов и определить новые терапевтические подходы, которые предотвращать развитие резистентности к этим препаратам.

В этой статье мы опишем метод, который позволяет генерировать Доцетаксел стойкие (DR) раковые клетки простаты. Далее мы опишем способы проверки сопротивления статус этих клеток с помощью анализов формирования колонии и количественного RT-PCR. Клетки, производимых этим методом имеют преимущество, изложив многие молекулярные функции в публично доступных человека опухоли образцов баз данных с дополнительным преимуществом, обеспечивая гибкость для выполнения широкого ряда экспериментальных анализов более длительные периоды времени, чем разрешено в образцах опухоли. Эти модели рака терапии сопротивления может быть расширен для многих недель в культуре ткани и среди других подходов, можно генетически манипулировать, визуализируется методами микроскопии и проанализированы для экспрессии генов. Кроме того они могут быть xenotrasplanted в мышах для дальнейшего анализа эффектов для формирования и роста опухоли в естественных условиях. В настоящее время основной альтернативный метод для изучения лекарственной устойчивости в контексте рака простаты является прямой анализ образцов опухоли. Хотя эти примеры представляют очень мощные системы для сбора информации о экспрессии генов и мутационного статуса данной опухоли, доступ к ним может быть весьма ограниченным и они трудно сохранить для дальнейших манипуляций и экспериментального анализа, который легко может быть сделано с клеточных линий, созданных с этот протокол24,25. Важно отметить, что в будущем, альтернативные подходы, такие, как поколения человека organoids производные непосредственно от пациентов будет очень мощным инструментом и альтернативой нынешней метод26,27. Поскольку они будут пилки в 3D контексте, что опухоль была в его исходном среде, organoids будет идеальной моделью между клеточных линий и человека опухоли. Тем не менее экспериментальные ячейки модели, описанные в настоящем Протоколе, еще более доступным для поддержания и подходит для более быстрый анализ. Результаты, полученные путем изучения этих клеточных линий можно экстраполировать и подтверждены в образцах и 3D культур. Таким образом этот протокол может представлять интерес для исследователей, стремящихся ячейки модели для изучения механизмов chemoresistance в любой линии клетки, так как наш протокол может быть адаптирована к изучению других наркотиков и типов рака. Методы, описанные здесь легко применять в любой лаборатории, доступным и позволить предварительные исследования молекулярных и клеточных механизмов лекарственной устойчивости.

Protocol

1. Определение концентрации Доцетаксел вызывает 50% уменьшение в колонии формирования способности (IC50)

Примечание: В настоящем Протоколе, доцетаксел IC50 концентрация проводилась с помощью формирования колонии способность. Могут использоваться альтернативные методы, используемые для оценки жизнеспособности клеток (т.е., МТС анализов), основанный на следователей ' предпочтения.

  1. Растут DU145 или 22Rv1 клетки в колбе 2 75 см и подготовить достаточно запас 10 мм Доцетаксел разводят в ДМСО, которые будут использоваться в будущих экспериментах.
  2. Плита клетки для определения IC50 доцетаксел, извлеките из колбы, тщательно вымыть клетки с 5 мл PBS и проинкубируйте с 2 мл 0,05% трипсина-ЭДТА для 3-5 минут при 37 ° C для отсоединения клетки с поверхности колбы.
  3. Промыть trypsinized клеток из колбы, используя 5 мл свежего СМИ и собирать суспензию клеток в 15 мл. Пелле клетки центрифугированием (300 x g, 3 мин, комнатной температуры (RT)).
  4. Удалить супернатант, Ресуспензируйте Пелле клеток в 5 мл свежего СМИ и подсчитать количество ячеек. Разбавления суспензии клеток до 2-2,5 x 10 5 клеток/мл для DU145 и 4-4.5 x 10 5 клеток/мл для 22Rv1, смешайте хорошо закупорить вверх и вниз и семян 2 мл суспензии в каждой скважине двух пластин 6-а.
  5. После 24 ч, при впадении в 70-80%, когда клетки добавить эскалации дозы Доцетаксел концентрации 1 Нм, 2,5 Нм, 5 Нм, 10 Нм, 25 Нм, 50 Нм, 100 Нм, 250 Нм, 500 Нм и 1000 Нм для каждой скважины. Лечить управления хорошо с ДМСО на наибольший объем, используемый для Доцетаксел ( рис. 2A).
  6. После 72 ч, аспирационная препарат, содержащий средства массовой информации и добавить 2 мл свежего средств массовой информации. В течение примерно 4-5 дней, пластины будет готова для пятнать.
  7. Пятно колоний, мыть их мягко с 2-3 мл PBS и инкубировать их с 2-3 мл раствора Фиолетовый Кристалл (0,1% w/v в формалина 10%) для 20 мин внутри культура ткани капот или зонт.
  8. Удалить окрашивание раствора и мыть тарелки с мл 2-3 H 2 O, удалить H 2 O и просушите пластин.
  9. Анализировать результаты визуализации скважинах для определения, какой из них имеет Доцетаксел концентрации, уменьшается жизнеспособность клеток на 50% (IC50). Вручную подсчета колоний с помощью маркер ручка (чтобы избежать подсчета же колонии дважды) и представляют собой процент жизнеспособность клеток в графике ( рис. 2A). Наконец, принимать цифровые изображения пластин для представительства рис (как показано на рисунке 3A).

2. Поколение Доцетаксел устойчивостью клеток рака простаты

Примечание: выполняют клетки лечения, используя тот же запас решение Docetaxel используется для определения концентрации наркотиков IC50 (подготовить достаточно складе заранее для экспериментальных использование). Всегда держите небольшой флакон клеток из предыдущего шага, в случае, если что-то не работает хорошо. Родительские клетки должны вырос параллельно в небольшой флакон на протяжении всей процедуры и подвергается транспортное средство (ДМСО) в соответствующие тома, подражая сумм, используемых в колбах Доцетаксел лечить.

  1. DU145 плита или 22Rv1 клеток в колбах 2 150 см, содержащие 20 мл средства массовой информации (3,5 х 10 6 клеток за флакон для DU145 и 6,5 * 10 6 клеток за флакон для 22Rv1). Иметь достаточное количество клеток в конце протокола рекомендуется использовать 10-20 Колб клеток.
  2. После 24 часов, когда клетки находятся около 70-80% слияния ( Рисунок 2Б, перед Доцетаксел), добавить Доцетаксел IC50 концентрация, определенный на шаге 1 протокола (5 Нм для клетки, указанных в настоящем протоколе).
  3. После 72 ч, аспирационная препарат, содержащий средства массовой информации и добавить свежие, доцетаксел свободных средств массовой информации ( Рисунок 2Б, 72 ч после Доцетаксел). Измените СМИ каждые 3-4 дня. В течение примерно 1-2 недели, устойчивостью клоны будут отображаться очевидным под микроскопом ( Рисунок 2Б, 7 и 14 дней после Доцетаксел).
  4. Аспирационная СМИ, тщательно вымыть клетки с 15 мл PBS и проинкубируйте с 4 мл 0,05% трипсина-ЭДТА для 3-5 минут при 37 ° C для отсоединения клетки с поверхности колбы.
  5. Ресуспензируйте trypsinized клеток из колбы с использованием 8 мл свежего СМИ. Бассейн клетки от всех обработанных колбы. Пелле клетки центрифугированием (300 x g, 3 мин, RT).
  6. Удалить супернатант, Ресуспензируйте Пелле клеток в 20 мл свежего СМИ и тарелка клеток в колбах 2 150 см (3,5 х 10 6 клеток за флакон для DU145 и 6,5 * 10 6 клеток за флакон для 22Rv1).
  7. После 24 часов, когда клетки находятся около 70-80% слияния, добавить 5 Нм Доцетаксел (первоначальный IC50 концентрация) снова.
  8. Повторите шаги 2,3-2,6 в день 3.
  9. После 24 часов, когда клетки находятся около 70-80% слияния, лечить клетки с 2 X Доцетаксел IC50 концентрация (10 Нм для клетки, указанных в настоящем протоколе).
  10. Повторить шаги 2.3 до 2,8, дозы эскалации Доцетаксел концентраций (25 Нм, 50 Нм, 100 Нм и 250 Нм), для создания стабильного населения растет в вашем колбах под окончательный высокая концентрация клеток. В более высокой концентрации, дозы эскалации протокол может быть реализован на срок до 6 месяцев до 1000 Нм концентрация достигается ( рис. 1A).

3. Функциональная характеристика приобрела Доцетаксел сопротивление в путем формирования Assay колонии

Примечание: В настоящем Протоколе, chemoresistance проводилась с помощью анализов формирования колонии. Могут использоваться альтернативные методы, используемые для оценки жизнеспособности клеток (т.е., МТС анализов), основанный на следователей ' предпочтения.

  1. Пластины 2000 клеток (DU145 или 22Rv1, как родителей, так и Доцетаксел устойчивостью) за хорошо в 6-ну пластины, используя 2 мл СМИ за хорошо.
  2. После 24 ч, добавить увеличение концентрации Доцетаксел (родительской клетки: 0.25, 0.5, 1, 2.5 и 5 Нм; Д-р клетки: 50, 125, 250, 500 и 1000 Нм). Для DU145 и 22Rv1 клеточных линий. Добавить ДМСО только одно также как элемент управления на том же томе, используемых для высокой дозы Доцетаксел.
  3. После 72 ч, аспирационная препарат, содержащий средства массовой информации и добавить свежие Доцетаксел свободных СМИ.
  4. Инкубировать пластины для 1-2 недели до колоний видны под микроскопом.
  5. Пятно колоний, мыть их мягко с 2-3 мл PBS и инкубировать их с 2-3 мл раствора Фиолетовый Кристалл (0,1% w/v в формалина 10%) для 20 мин внутри культура ткани капот или зонт.
  6. Удалить окрашивание раствора и мыть тарелки с мл 2-3 H 2 O, удалить H 2 O и просушите пластин.
  7. Проанализировать результат визуализации скважин и вручную подсчета колоний с помощью маркер ручка (чтобы избежать подсчета же колонии дважды) и представляют собой процент жизнеспособность клеток в графе. Цифровые изображения пластин для представительства рисунок ( рис. 3A).

4. Фенотипические характеристики из Доцетаксел сопротивления приобрел фенотип через qRT ПЦР анализа

Примечание: Доцетаксел стойкие (DR) клетки демонстрируют различные выражения профиль, по сравнению с их родителей клеточных линий 28 , 29. Таким образом, успех выделения могут быть проверены qRT ПЦР с праймерами для конкретных маркеры (для последовательностей праймера, обратитесь в раздел материалы; для деталей, обратитесь к разделу результаты). Это должно быть сделано после каждого раунда отбора, начиная после третьего раунда. Кроме того, также возможна оценка Доцетаксел устойчивостью фенотипа, Западный blotting.

  1. Извлечь РНК от родителей и Доцетаксел устойчивостью клеток с помощью РНК добыча комплект и после производитель ' s инструкции (см. Таблицу материалы и реагенты для подробной информации). Рекомендуется использовать как минимум 1-2 х 10 6 клеток.
  2. Quantify РНК на 260 Нм поглощения, используя спектрофотометр. Для лучших чистоты, 260 Нм/280 Нм поглощения соотношения должен быть близок к 2.0.
  3. PerfoRM обратный транскрипции для получения комплементарной ДНК — (cDNA кДНК) с помощью комплекта обратной транскрипции и после производитель ' s инструкции (см. Таблицу материалы и реагенты для подробной информации), используя 1 мкг РНК в 20 мкл реакция смеси (если требуется большее количество cDNA, масштабы реакции микс, соответственно).
  4. Подготовить ПЦР-реакции в трех экземплярах для каждого гена интереса следующим:
    - 2 мкл 10 мкм вперед грунтовка
    - 2 мкл 10 мкм обратный грунтовка
    - 10 мкл SYBR зеленый ПЦР Мастер микс
    - 5 мкл H 2 O
    -1 мкл недавно подготовленный cDNA от шаг 4.3.
    Примечание: Смотрите Таблицу материалы для последовательностей грунты, используемые в настоящем Протоколе.
  5. Установите программу PCR следующим:
    - 95 ° C в течение 15 мин
    - 94 ° C за 30 s |
    -56 ° C 40 s | 40 раз
    - 72 ° C для 30 s |
  6. Для анализа результатов ПЦР и определить изменения в экспрессии генов между родительской и доктор образцы, значения порога (Ct) цикла для каждого гена интереса определяются в трех экземплярах и среднем нормированы контроль погрузки (актина тройные среднее ) для DR (Ct DR) и родительской клетки (Ct родителей). Значения для родительской клетки нормализуются к 1. ΔCt (Ct DR - Ct родителей) определяется для получения окончательного мРНК раз изменения и представлены на графике. Увеличение > 2 или снижение < 0,5 считаются значительным и хорошие проверки создания Доцетаксел приобрела устойчивость к фенотипу ( рис. 3B).

Representative Results

Этот протокол будет приводить к генерации Доцетаксел стойкие (DR) клеток рака простаты. Сроки для завершения может варьироваться от 4 до 7 месяцев приводится в схематическое представление протокола шаги в рисунке 1A и 1B рисунок. Времени инвестиции могут отличаться в зависимости от линии клетки выбора и диапазон концентраций наркотиков, как описано в протоколе. Важно отметить, что определение Docetaxel IC50 концентрации для каждой ячейки строки позволяет дизайн эскалации диапазон концентраций препарата для использования в протоколе для клеток выбора (рис. 2A). После запуска протокола, первоначальный Доцетаксел воздействие на DU145 и 22Rv1 клетки могут наблюдаться в разное время точках под микроскопом, чтобы контролировать Если протокол работает должным образом. Предложил моменты времени для наблюдения за процессом лечения Доцетаксел являются: прежде чем воздействия (базовый), доцетаксел после воздействия Доцетаксел за 72 часа, 7 дней и 14 дней. Обратите внимание, что лишь меньшинство опухолевых клеток выжить Доцетаксел экспозиции и создавать клоны, которые можно наблюдать под микроскопом (Рисунок 2Б).

Представитель колонии формирования анализов и количественной оценки графиков родительских и созданный Доцетаксел стойкие (DR) клетки показаны на рисунке 3A. Обратите внимание, что созданный Доцетаксел устойчивостью клеток может выжить концентрации наркотиков до Гарибова выше, чем родительский клетки.

Наконец Доцетаксел устойчивостью фенотип может быть проверен qRT ПЦР (рис. 3B). Обратите внимание, что Доцетаксел устойчивостью клеток, по сравнению с родительской клетки, отображения характерных вверх регулирование ABCB1 и GATA2 и вниз регулирование CK19 и CDH1. Эти гены были отобраны для проверки, потому что мы уже экспериментально показали в нашем ранее опубликованной работе GATA2 upregulation и Даунрегуляция CK19 вместе с CDH1 в обоих DR ячейки модели28,29. Ген ABCB1 также был выбран в качестве основных генов, проявленная другими быть последовательно upregulated в лекарственной устойчивостью клеток18,19. Однако важно отметить, что другие гены могут быть выбраны согласно литературе и в зависимости от модели клетки и наркотиков, выбрали для генерации устойчивостью клеток на исследователя.

Figure 1
Рисунок 1: временная шкала для поколения Доцетаксел устойчивых моделей клеток рака простаты. (A) представитель диаграмма временной шкалы протокол для генерации Доцетаксел устойчивостью клеток моделей. Иллюстрация изображает Доцетаксел лечения, проверочные шаги и время, необходимое для каждой части. (B) схематическое представление шагов проверки протокола, включая анализы формирования функциональных колонии родителей и Доцетаксел устойчивостью клеток, относились с указанной концентрации Доцетаксел за 72 ч (в красном), представитель граф процент колонии и qRT ПЦР для фенотипические проверки. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: поколение Доцетаксел устойчивостью клеток рака простаты модели систем. (A) диаграмма, изображающая Определение Docetaxel IC50 в родительский простаты рак клеточных линий, DU145 и 22Rv1 (шаг 1 из протокола). Ожидаемый процент жизнеспособность клеток и доцетаксел, дозы эскалации концентрации требуется включены в стоимость номера. Представитель DU145 и 22Rv1 клетки жизнеспособности графики, указывающее 5 Нм как IC50 после 72 ч Доцетаксел воздействия включены. Эксперименты triplicates и данные представляют собой среднее ± SD. (B) представитель светлые области изображения микроскопия DU145 и 22Rv1 клеток на указано время поколения Доцетаксел сопротивления (шаг 2 из протокола). Красные стрелки показывают Доцетаксел устойчивый клон после завершения протокола. Масштаб баров = 50 Нм. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: функциональные и фенотипические характеристики Доцетаксел устойчивостью клеток моделей. (A) представитель колонии анализов формирования родительских и Доцетаксел устойчивостью клеток, относились с указанной концентрации Доцетаксел за 72 ч. процент колоний для каждого лечения концентрация представлена в графе включены. Эксперименты, triplicates и данные представляют собой среднее ± SD. масштаба бары = 5 mm. (B) DR/родительского относительный раза мРНК увеличение количественно qRT-ПЦР ABCB1, GATA2, CK19 и CDH1 отображаются. Все ПЦР необработанные данные нормируется актина (см. протокол для подробной информации). Эксперименты triplicates и данные представляют среднее ± SD. * p < 0,05. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

В этой рукописи мы описываем метод для создания Доцетаксел устойчивостью клеток рака простаты модель систем, что позволяет для изучения механизмов, способствующих приобретению chemoresistance фенотип. Хотя такой подход является очень надежных и воспроизводимых, следует рассмотреть некоторые потенциальные ограничения. С тех пор только малую часть массовая популяция клеток будет экспонат chemoresistance28, рекомендуется начать с большой популяции клеток (мы обычно пластины 20 колбы 150 см2, которые составляют приблизительно 1.2 x 108 клетки). Основные этапы протокола следует обеспечить успех процедуры. Во-первых очень важно использовать же Доцетаксел свежеприготовленные складе для длинный срок использования (10 мм сток аликвоты могут быть использованы для лет, когда должным образом в температуре-80 ° C). Незначительные изменения в аликвота Доцетаксел может повлиять на результаты IC50, генерации клеток линии времени и результаты формирования колонии. Во-вторых важно начать в протоколе Определение IC50 в каждой отдельной ячейки линии, так как вариации может произойти при использовании новой партии клеток. В-третьих важно отслеживать, что медикаментозное лечение является эффективным путем проверки клетки под микроскопом часто, поэтому любые ошибки могут быть быстро обнаружены и исправлены. Наконец мы рекомендуем всегда держать запас промежуточных шагов в случае загрязнения или неожиданные проблемы, которые могут повлиять на жизнеспособность клеток в середине протокол. Важно отметить, что наш протокол стремится создавать модели лекарственной устойчивости, подвергая раковых клеток простаты на высоких доз Доцетаксел за 72 ч, следуют периоды длительного восстановления, а не ниже постоянной концентрации препарата в попытке имитировать лучших клинических сценарий сообщил для лечения рака простаты с этой taxane агента15,16.

Кроме того следует отметить, что лекарственно-клетки exhibit высокая пластичность, которые могут привести к прогрессивной потере приобретенного сопротивления свойств с течением времени. Таким образом расширение использования этих клеток для более чем 2-3 месяца в культуре не рекомендуется. Если требуется постоянного питания рекомендуется постоянно создавать новые пакеты устойчивостью клеток. Однако если пакеты клеток были культивированный на длительное время, колонии формирования анализов и ПЦР может использоваться пересмотреть их сопротивление. Другой альтернативой является стимулирование убывающей сопротивления, рассматривая клетки с высокой дозой Доцетаксел за 72 ч (500-1000 Нм). После периода восстановления одной-двух недель, фенотип может быть повторно проверена путем формирования ПЦР и колонии анализов. Это также возможно, хотя это не рекомендуется, чтобы хранить аликвоты лечение клеток в жидком азоте (в FBS, 10% ДМСО). Пожалуйста, обратите внимание, что после цикла замораживания оттаивания, chemoresistance фенотип должен всегда повторно вычисляться с вышеупомянутых методов.

Несмотря на эти оговорки мы29 28,и другие30,,3132,33 смогли успешно используют эти модели системы для определения ключевой роман сотовой и молекулярные механизмы, ведущие к повышенным опухоли инициирование емкости, выживание клетки и агрессивность в Доцетаксел устойчивостью клеток. С помощью этих раковых клеток модели систем, мы обнаружили, что клетки, экспонируется недифференцированные фенотип, характеризуется отсутствием маркеры эпителия и связанных с ними простаты дифференциации и Гиперэкспрессия ориентации развития (Notch и Ежик) сигнальных путей, выжить химиотерапевтических воздействия28. В втором исследовании используя эти модели вместе с общедоступной пациента гена наборы данных24,25, мы обнаружили, что пионером транскрипционный фактор GATA2 является высоко оверэкспрессировали в метастатических кастрация стойкие устойчивость к химиотерапии раковые клетки простаты. GATA2 увеличивает выживаемость клеток напрямую активируя IGF2-зависимая киназа вниз по течению, сигнализации сети29. В частности эти исследования помогли выявить Роман ключевую роль GATA2 в передовых метастатическим раком простаты агрессивность34.

Развитие лекарственной устойчивости является проблемой, которая не ограничивается Доцетаксел и рак простаты, как это распространено среди многих других видов рака, лечение с широким набором химиотерапевтических препаратов. Действительно применяются аналогичные ограничения на наличие экспериментальных моделей, и вполне возможно, что наш протокол могут быть адаптированы для изучения других типов рака и механизмы их соответствующих chemoresistance.

Поколение Доцетаксел устойчивостью клеток, как описано в настоящем Протоколе может использоваться как функциональный инструмент для выявления роман соответствующих молекулярных и клеточных механизмов chemoresistance. Это открывает двери для нахождения новых целей, на которых могли бы сформулировать разработки новых методов лечения для высоки злокачественные рака простаты, еще раз нажав границы того, что мы знаем об этой болезни и как мы относимся к своим пациентам.

Disclosures

Авторы заявляют, что они не имеют никаких финансовых интересов.

Acknowledgments

В.Р.-Б. получает финансирование от Департамента здравоохранения США & человека услуг, низ, Национальный институт рака предоставить номер 1 K22 CA207458-01 и J.D.-D. получает финансирование от Департамента здравоохранения США & человека услуг, низ, Национальный институт рака предоставить номер 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics