Generasjon av prostata kreft cellen modeller av motstand mot anti-mitotisk Agent Docetaxel

Cancer Research
 

Summary

Motstand mot kreft terapi bidrar til sykdomsprogresjon og død. Avgjøre mekanistisk grunnlaget motstand er avgjørende for å forbedre terapeutiske svar. Dette manuskriptet detaljer protokollen for å generere taxane-resistente celle modeller av prostatakreft (PC) å dissekere veier involvert i progresjon til Docetaxel motstand i PC pasienter.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Microtubule målretting agenter (MTAs) er en bærebjelke i behandlingen av en rekke svulster. Ervervet motstand mot cellegifter er imidlertid en vanlig mekanisme av sykdomsprogresjon og Prognostisk-determinant kjennetegner ondsinnethet svulst. I prostatakreft (PC) dikterer motstand mot MTAs som taxane Docetaxel behandling feil samt progresjon mot dødelige stadier av sykdom som er definert av en dårlig prognose og høy dødelighet. Men studerte i flere tiår, en rekke mekanismer bidra til ervervet motstand er ikke fullstendig forstått, og dermed utgjør en vesentlig unntak til utvikling av nye strategier som kan nytte pasientene i disse avanserte stadier av sykdom. I denne protokollen, beskriver vi generering av Docetaxel-motstandsdyktig prostatakreft linjer som etterligner dødelige funksjoner for sent prostatakreft, og derfor kan brukes å studere mekanismer av hvilke ervervet chemoresistance oppstår. Til tross for potensielle begrensninger iboende å en cellen basert modell, som tap av motstand egenskaper over tid, de Docetaxel-resistente cellelinjer produsert av denne metoden har blitt brukt i studier og tilbyr muligheten til å fremme vår molekylær forståelse av ervervet chemoresistance i dødelige prostatakreft.

Introduction

Økt hastighet på spredning forårsaket av tap av cellen syklus kontroll er et kjennetegn på kreft1. Denne funksjonelle egenskapen gjengir kreftceller unikt avhengig gjengivelsen av cellen syklus nøkkelprosesser i S - og M-faser, som har ført til utviklingen av ulike celle syklus perturbing medikamenter som forårsaker DNA skade eller mitotisk defekter. Selv om mange anti-mitotisk agenter, liker hemmere av mitotisk kinaser eller motoren proteiner, er nå utviklet og testet i kliniske studier, fortsette eldre microtubule målretting agenter (MTAs) å være eneste klinisk godkjent tilnærming for målretting mitose i kreft2,3,4. MTAer enten destabilisere (Vinblastine, Vincristine, Vinorelbine) eller stabilisere (taxane-avledet agenter paklitaxel, Docetaxel eller Cabazitaxel) piskehale som henger, og hindre dermed dannelse av en fungerende mitotisk spindel5,6. Disse agentene utløse spindelen montering checkpoint7,8, som resulterer i en langvarig mitotisk arrestasjon og eventuell celledød i kulturperler celler9,10 og mitotisk defekter i svulster11 ,12 og er derfor nyttig for behandling av en rekke kreftformer, blant dem prostatakreft13.

Prostatakreft er mest diagnostisert kreft og en ledende årsak til kreft dødsfall i menn14. Antimitotic stoffer som Docetaxel forbedre prostatakreft pasientens overlevelse og er en bærebjelke i behandling av denne sykdommen15,16,17. Dessverre, til tross for innledende svulst krymping, kreftceller ofte utvikle resistens under behandling. Flere cellulære mekanismer har vært innblandet i forårsaker utvikling av chemoresistance, inkludert dereguleringen av apoptotisk og provoserende trasé eller aktivisering/overuttrykte narkotika middelklasseinnbyggere pumper som den ATP-bindende kassett transporter P-glykoprotein (P-gp/ABCB1), som resulterer i eksport av chemotherapeutic agenter av celler18,19. Motstand mot taxanes har også vært knyttet til andre årsaker, for eksempel endringer i uttrykk for tubulin isotypes eller tubulin mutasjoner, hvilke forhindre samspillet mellom stoffet og sine mål 20,21. Videre har motstand vært knyttet til genomet ustabilitet akkumulering og svulst heterogenitet22,23. Men er mekanismer bidra til taxane motstand ikke fullstendig forstått, som er tydelig ved fravær av strategier som hindrer utseendet. Derfor er det et presserende behov for å generere eksperimentelle modeller som hjelper i Disseksjon av disse mekanismene og å identifisere romanen terapeutiske metoder som forhindrer utvikling av resistens mot disse stoffene.

I denne artikkelen beskriver vi en metode som tillater generering av Docetaxel-resistente (DR) prostata kreftceller. Videre vil vi beskrive hvordan validere statusen motstand for disse cellene kolonien formasjon analyser og kvantitative RT PCR. Celler produsert av denne metoden har fordelen av recapitulating mange av molekylære funksjonene i offentlig tilgjengelige menneskelige svulst Eksempeldatabaser med fordelen av å gi allsidigheten for å utføre en rekke eksperimentelle analyser lengre perioder enn tillatt svulst prøver. Modellene kreft terapi motstand kan utvides i mange uker på vev kultur og blant andre tilnærminger, kan genetisk manipulerte, visualisert ved mikroskopi metoder og analysert for genuttrykk. Videre kan de være xenotrasplanted i mus å analysere effektene i tumor formasjon og vekst i vivo. Foreløpig er den viktigste alternative metoden å studere resistens i sammenheng med prostatakreft direkte analyse av tumor prøver. Mens disse prøvene presentere en svært potent system for å samle informasjon om genuttrykk og mutational status for den angitte svulst, tilgang til dem kan være svært begrenset og de er vanskelig å opprettholde for ytterligere manipulasjoner og eksperimentelle analyse, som kan enkelt gjøres med cellelinjer generert med denne protokollen24,25. Viktigere, i fremtiden, tilnærminger alternative som generering av menneskelig avledede organoids direkte fra pasienter ville være et svært kraftig verktøy og alternativ til den nåværende metoden26,27. Siden de vil recapitulate i 3D sammenheng hva en svulst var i sine opprinnelige omgivelser, vil organoids være perfekt modellen mellom linjer og menneskelige svulster. Likevel, eksperimentelle celle-modellene som er beskrevet i denne protokollen er fortsatt mer rimelig å opprettholde og egnet for raskere analyse. Resultatene som oppnås ved å studere disse linjer kan være extrapolated til og bekreftet i prøver fra mennesker og 3D kulturer. Derfor kan denne protokollen være av interesse for forskere søker celle modeller å studere chemoresistance mekanismer i enhver celle linje, siden våre protokollen kan tilpasses til studiet av andre rusmidler og typer kreft. Metodene som er beskrevet her er enkel å bruke i et laboratorium, rimelig og lar Foreløpige undersøkelser av molekylære og cellulære mekanismer for resistens.

Protocol

1. fastsettelse av Docetaxel konsentrasjonen forårsaker 50% nedgang i kolonien formasjon evne (IC50)

Merk: I denne protokollen, Docetaxel IC50 konsentrasjon har blitt evaluert med kolonien formasjon evne. Alternative metoder brukt for å vurdere celle levedyktighet (dvs. MTS analyser) kan brukes basert på etterforskere ' preferanser.

  1. Vokser DU145 eller 22Rv1 celler i en 75 cm 2 kolbe og forberede varebeholdningen 10 mm Docetaxel fortynnet i DMSO brukes i senere eksperimenter.
  2. Plate celler for fastsettelse av IC50 av Docetaxel, Fjern medier fra flasken, nøye vask celler med 5 mL PBS og ruge med 2 mL 0,05% Trypsin-EDTA i 3-5 min på 37 ° C koble celler fra kolbe overflaten.
  3. Skyll trypsinized celler fra flasken med 5 mL av fersk media og samle celle suspensjon i en 15 mL tube. Pellets celler med sentrifugering (300 x g, 3 min, romtemperatur (RT)).
  4. Fjerne nedbryting, resuspend celle pellet i 5 mL av fersk media og telle celler. Fortynne celle suspensjon 2-2,5 x 10 5 celler/mL for DU145 og 4-4.5 x 10 5 celler/mL for 22Rv1, bland godt pipettering opp og ned og frø 2 mL suspensjonen i hver brønn av to 6-vel plater.
  5. Etter 24 h, når cellene på 70-80% samløpet, legge dose økende Docetaxel konsentrasjoner av 1 nM, 2.5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM og 1000 nM i hver brønn. Behandle kontrollen med DMSO på høyeste volum brukes til Docetaxel ( figur 2A).
  6. Etter 72 h, Sug opp stoffet som inneholder medier og legge 2 mL frisk media. Innen ca 4-5 dager, plater vil være klar til farging.
  7. Til stain koloniene, vask dem forsiktig med 2-3 mL PBS og ruge dem med 2-3 mL crystal violet løsning (0,1% w/v i 10% formalin) for 20 min vev kultur panseret eller avtrekksvifte.
  8. Fjerne flekker løsning og vask plater med 2-3 mL av H 2 O, fjerne H 2 O og air-dry plater.
  9. Analyserer resultatene ved å visualisere brønnene for å avgjøre hvilke har Docetaxel konsentrasjonen som reduserer celle levedyktighet av 50% (IC50). Manuelt teller kolonier ved hjelp av en markør penn (for å unngå telle de samme koloniene to ganger) og angi prosentvise celle levedyktighet i et diagram ( figur 2A). Til slutt, tar digitale bilder av platene for figur representasjon (som vist i figur 3A).

2. Generasjon av Docetaxel-motstandsdyktig prostata kreftceller

Merk: utføre cellen behandlinger med samme Docetaxel løsning aksjen brukes for fastsettelse av IC50 narkotika konsentrasjon (forberede varebeholdningen på forhånd for eksperimentell Bruk). Alltid holde en liten bolle med celler fra forrige trinn, for alle tilfellers skyld noe ikke fungerer riktig. Foreldrekontroll celler bør vokst parallelt i en liten bolle gjennom hele prosedyren og utsatt for kjøretøy (DMSO) i tilhørende volumer mimicking beløpene i Docetaxel behandlet kolber.

  1. Plate DU145 eller 22Rv1 celler i 150 cm 2 flasker som inneholder 20 mL av media (3,5 x 10 6 celler per kolbe for DU145 og 6.5 * 10 6 celler per kolbe for 22Rv1). Bruk av 10 til 20 flasker av celler anbefales å ha nok celler på slutten av protokollen.
  2. Etter 24 timer, når cellene er på ca 70-80% samløpet ( figur 2B, før Docetaxel), legge Docetaxel på IC50 konsentrasjonen i trinn 1 av protokollen (5 nM for cellene som beskrevet i denne protokollen).
  3. Etter 72 h, Sug opp stoffet som inneholder medier og legge fersk, Docetaxel-frie medier ( figur 2B, 72 h etter Docetaxel). Endre media hver 3-4 dager. Motstandsdyktig kloner vises tydelig under mikroskopet ( figur 2B, 7 og 14 dager etter Docetaxel) i ca 1-2 uker,.
  4. Sug opp media og nøye vask celler med 15 mL PBS ruge 4 mL 0,05% Trypsin-EDTA i 3-5 min på 37 ° C koble celler fra kolbe overflaten.
  5. Resuspend trypsinized celler fra flasken med 8 mL av fersk media. Basseng celler fra alle behandlet flasker. Pellets celler med sentrifugering (300 x g, 3 min, RT).
  6. Fjerne nedbryting, resuspend celle pellet i 20 mL av fersk media og plate cellene i 150 cm 2 flasker (3,5 x 10 6 celler per kolbe for DU145 og 6.5 * 10 6 celler per kolbe for 22Rv1).
  7. Etter 24 timer, når cellene er på ca 70-80% samløpet, legge til 5 nM Docetaxel (første IC50 konsentrasjon) igjen.
  8. Gjenta 2.3 til 2.6 på dag 3.
  9. Etter 24 timer, når cellene er på ca 70-80% samløpet, behandle celler med 2 X IC50 Docetaxel konsentrasjon (10 nM for cellene som beskrevet i denne protokollen).
  10. Gjenta trinn 2.3 til 2.8, etter en doseopptrapping for Docetaxel (25 nM, 50 nM, 100 nM og 250 nM), til å generere en stabil populasjon av celler vokser i din kolber under den endelige høyeste konsentrasjonen. For høyere konsentrasjoner, doseopptrapping protokollen kan implementeres for inntil 6 måneder til 1000 nM konsentrasjonen ( figur 1A).

3. Funksjonell karakteristikk av ervervet Docetaxel motstand av kolonien formasjon analysen

Merk: I denne protokollen, chemoresistance har blitt evaluert med kolonien formasjon analyser. Alternative metoder brukt for å vurdere celle levedyktighet (dvs. MTS analyser) kan brukes basert på etterforskere ' preferanser.

  1. Tallerken 2000 celler (DU145 eller 22Rv1, både foreldre og Docetaxel-resistente) per brønn i 6-og plater, med 2 mL media per brønn.
  2. Etter 24 h, legger til økende konsentrasjoner av Docetaxel (foreldre celler: 0,25, 0,5, 1, 2,5 og 5 nM; DR celler: 50, 125, 250, 500 og 1000 nM). For både DU145 og 22Rv1 linjer. DMSO bare legge til én brønn som en kontroll på samme volum brukes for høyeste Docetaxel dosen.
  3. Etter 72 h, Sug opp stoffet som inneholder medier og legge fersk Docetaxel-frie medier.
  4. Ruge plater for 1-2 uker til koloniene er synlige under mikroskopet.
  5. Til stain koloniene, vask dem forsiktig med 2-3 mL PBS og ruge dem med 2-3 mL crystal violet løsning (0,1% w/v i 10% formalin) for 20 min vev kultur panseret eller avtrekksvifte.
  6. Fjerne flekker løsning og vask plater med 2-3 mL av H 2 O, fjerne H 2 O og air-dry plater.
  7. Analysere resultatet av visualisere brønnene og manuelt teller kolonier ved hjelp av en markør penn (for å unngå telle de samme koloniene to ganger) og representerer prosentandelen av cellen levedyktighet i et diagram. Ta digitale bilder av platene for figur representasjon ( figur 3A).

4. Fenotypiske karakterisering av Docetaxel motstand ervervet fenotypen via qRT PCR analyse

Merk: Docetaxel-resistente (DR) celler viser en annerledes uttrykk profil i forhold til sine foreldre cellelinjer 28 , 29. derfor suksessen til utvalget kan verifiseres ved qRT PCR primere i bestemte indikatorer (for primer sekvenser, se avsnittet materiale, for detaljer, se resultater). Dette bør gjøres etter hver runde utvalg fra etter tredje runde. Alternativt, evaluering av Docetaxel-motstandsdyktig fenotypen av vestlige blotting er også mulig.

  1. Ekstra RNA fra både foreldre og Docetaxel-resistente celler hjelp en RNA utvinning pakke og følge produsenten ' s instruksjoner (se Tabell av materialer og reagenser for detaljer). Bruke minst 1-2 x 10 6 celler anbefales.
  2. Kvantifisere RNA på 260 nm absorbansen, bruker et spektrofotometer. For beste renhet, 260 nm/280 nm absorbansen forholdstallene bør være nær 2.0.
  3. PerfoRM reversere transkripsjon hente komplementære DNA (cDNA) ved hjelp av omvendt transkripsjon kit og følge produsenten ' s instruksjoner (se Tabell av materialer og reagenser for detaljer), hjelp 1 µg av RNA i en 20 µL Reaksjonen blanding (Hvis et høyere beløp av cDNA er nødvendig, skalere opp reaksjonen blanding følgelig).
  4. Forberede qPCR reaksjonen i tre eksemplarer for hver genet av interesse som følger:
    - 2 µL av 10 µM frem primer
    - 2 µL av 10 µM omvendt primer
    - 10 µL SYBR Green PCR master blanding
    - 5 µL H 2 O
    -1 µL av den nylig forberedt cDNA fra trinn 4.3.
    Merk: Se Tabell for materiale for sekvenser av primere brukt i denne protokollen.
  5. Sette PCR-programmet som følger:
    - 95 ° C i 15 min
    - 94 ° C for 30 s |
    -56 ° C i 40 s | 40 ganger
    - 72 ° C for 30 s |
  6. å analysere qPCR resultatene og se endringer i genuttrykk mellom foreldre og DR prøver, syklus terskelen (Ct) verdier for hver genet av interesse fastsettes i tre eksemplarer og gjennomsnittet normalisert lasting kontrollen (begrepsordbok tre eksemplarer gjennomsnitt ) for DR (Ct DR) og foreldrenes celler (Ct foreldre). Verdier for foreldre cellene blir normalisert til 1. ΔCt (Ct DR - Ct foreldre) er fast bestemt på å få siste mRNA fold endringer og representert i et diagram. En økning på > 2 eller en reduksjon av < 0,5 anses betydelig og en god validering av etableringen av Docetaxel kjøpt motstandsdyktig fenotypen ( figur 3B).

Representative Results

Denne protokollen vil føre til generering av Docetaxel-resistente (DR) prostata kreftceller. Tidslinjen for gjennomføring kan variere fra 4 til 7 måneder slik den skjematisk fremstillingen av protokollen trinnene i figur 1A og figur 1B. Bruke tid investeringen kan variere avhengig av cellen linjen valgfrihet og området for stoffet brukes i protokollen. Viktigere, kan fastsettelse av Docetaxel IC50 konsentrasjonen for hver celle linje utformingen av stoffet økende konsentrasjon området bruke i protokollen for cellene i valg (figur 2A). Når protokollen startes, kan første Docetaxel effekter på DU145 og 22Rv1 celler observeres på ulike tidspunkt under mikroskop for å overvåke hvis protokollen fungerer. Foreslått tidspunkt å overvåke Docetaxel behandlingsprosessen er: før Docetaxel eksponering (grunnlinje) etter Docetaxel eksponering for 72 timer, 7 dager og 14 dager. Merk at bare et mindretall av kreftceller overleve Docetaxel eksponering og generere kloner, som kan observeres under mikroskopet (figur 2B).

Representant kolonien formasjon analyser og kvantifisering grafer av foreldre og de nyopprettede Docetaxel-resistente (DR) cellene vises i figur 3A. Merk at de genererte Docetaxel-resistente cellene kan overleve narkotika konsentrasjoner opptil 1000 ganger høyere enn foreldre cellene.

Endelig kan Docetaxel-resistente fenotypen valideres av qRT PCR (figur 3B). Merk at Docetaxel-resistente celler, i forhold til foreldrenes cellene, vise karakteristiske opp-regulering av ABCB1 og GATA2 og ned-regulering av CK19 og CDH1. Disse genene ble valgt for validering fordi vi har allerede eksperimentelt vist i våre tidligere utgitte verk GATA2 oppregulering og downregulation av CK19 med CDH1 i begge DR celle modeller28,29. ABCB1 genet ble også valgt som en stift genet som har blitt vist av andre til å være konsekvent upregulated i resistente celler18,19. Det er imidlertid viktig å merke seg at andre gener kan velges ifølge litteratur og avhengig av den celle modeller og narkotika valgt for generering motstandsdyktig celler av forskeren.

Figure 1
Figur 1: tidsplan for generering av Docetaxel-motstandsdyktig prostatakreft celle modeller. (A) representant diagram av protokollen tidslinjen for generering av Docetaxel-motstandsdyktig celle modeller. Illustrasjonen viser den Docetaxel behandlingen godkjenningen skritt og tid for hver del. (B) skjematisk fremstilling av det godkjenning skritt av protokollen inkludert funksjonell koloni formasjon analyser av foreldre og Docetaxel-resistente cellene behandlet med de angitte Docetaxel konsentrasjonene 72 h (i rødt), representant Graf kolonien prosentandel og qRT PCR for fenotypiske validering. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: generering av Docetaxel-motstandsdyktig prostatakreft celle modellsystemer. (A) Diagram som viser fastsettelse av Docetaxel IC50 i foreldrenes prostatakreft cellelinjer DU145 og 22Rv1 (trinn 1 av protokollen). Forventet prosenter av cellen levedyktighet og Docetaxel dose økende konsentrasjoner nødvendig er inkludert. Representant DU145 og 22Rv1 celle levedyktighet grafer som angir 5 nM som IC50 etter 72 h Docetaxel eksponering er inkludert. Forsøkene er triplicates og dataene representerer gjennomsnittlig ± SD. (B) representant lyse feltet mikroskopi bilder av DU145 og 22Rv1 celler på angitt tidspunkt under generering av Docetaxel motstand (trinn 2 av protokollen). Røde piler indikerer en Docetaxel motstandsdyktig klone etter protokollen er fullført. Skalere barer = 50 nm. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: funksjonell og fenotypiske karakterisering av Docetaxel-motstandsdyktig celle modeller. (A) representant kolonien formasjon analyser av foreldre og Docetaxel-resistente cellene behandlet med de angitte Docetaxel konsentrasjonene for 72 h. andelen koloniene for hver behandling konsentrasjon er representert i inkludert grafen. Forsøkene er triplicates og dataene representerer den gjennomsnittlig ± SD. skala barer = 5 mm. (B) DR/foreldre mRNA fold økningen kvantifisert ved qRT PCR av ABCB1, GATA2, CK19 og CDH1 vises. Alle qPCR rådata er normalisert til utgangen (se protokoll for detaljer). Eksperimentene triplicates og dataene representerer den gjennomsnittlig ± SD. * p < 0,05. Klikk her for å se en større versjon av dette tallet.

Discussion

I dette manuskriptet beskriver vi en metode for å generere Docetaxel-resistente prostatakreft celle modellsystemer der for å studere mekanismer bidra til anskaffelse av chemoresistance fenotypen. Mens denne tilnærmingen er svært pålitelig og reproduserbar, anses noen potensielle begrensninger. Siden bare en liten brøkdel av befolkningen bulk celler har chemoresistance28, er det anbefalt å starte med en stor befolkning av celler (vi vanligvis plate 20 flasker av 150 cm2, som står for ca 1.2 x 108 celler). Nøkkeltrinn protokollen anses å sikre suksess av prosedyren. Først, er det svært viktig å bruke de samme Docetaxel nylagde lager for lang tids bruk (10 mM stock dele kan brukes til år når lagret riktig i-80 ° c). Små endringer i Docetaxel aliquot kan påvirke resultatene av IC50, generasjon av cellen linje timing og kolonien formasjon resultatene. Det andre, er det avgjørende å starte protokollen bestemmer IC50 i hver enkelt celle linje, siden variasjoner kan oppstå når du bruker en ny gruppe med celler. For det tredje er det viktig å overvåke at behandlingsapparatet er effektivt ved å merke celler under microscope ofte så feil kan oppdages raskt og korrigert. Til slutt, vi anbefaler å alltid holde et lager av mellomliggende trinn ved forurensning eller uventede problemer som kan påvirke levedyktigheten til cellene i protokollen. Viktigere, våre protokollen skal generere modeller av resistens ved å utsette prostatakreft cellene til høye doser av Docetaxel 72 h etterfulgt av lang utvinning perioder, snarere enn lavere konstant konsentrasjoner av stoffet i et forsøk på å etterligne best kliniske scenariet rapportert prostatakreft behandling med denne taxane agent15,16.

I tillegg bør det bemerkes at stoff-resistent celler ha en høy plastisitet, som kan føre til en progressiv tap av ervervet motstand egenskaper over tid. Derfor er utvide bruken av disse cellene for mer enn 2-3 måneder i kultur ikke anbefalt. Hvis en permanent forsyning er nødvendig er det tilrådelig å kontinuerlig generere nye grupper av motstandsdyktig celler. Men hvis grupper av celler har blitt kultivert for en lengre periode, kan koloni formasjon analyser og qPCR brukes til å revurdere sin motstand. Et annet alternativ er å øke avtagende motstand ved behandling av celler med en høy dose Docetaxel 72 h (500-1000 nM). Etter en restitusjonsperiode en til to uker, fenotypen kan bli re-testet av qPCR og kolonien formasjon analyser. Det er også mulig, men ikke anbefalt, lagre dele behandlet celler i flytende nitrogen (i FBS, 10% DMSO). Vær oppmerksom på at etter en fryse-Tin syklus, chemoresistance fenotypen bør alltid revurderes med de nevnte metodene.

Til tross for disse begrensningene, vi28,29 og andre30,31,32,33 kunne vellykket benytter disse modellsystemer å identifisere viktige romanen mobilnettet og molekylære mekanismer fører til opphøyet svulst-starte kapasitet, celle overlevelse og aggressivitet i Docetaxel-resistente celler. Bruker disse kreft celle modellsystemer, oppdaget vi at cellene viser en udifferensierte fenotype, preget av fravær av epitel og prostata-relaterte differensiering markører og overuttrykte targetable utviklingsmessige (hakk og Hedgehog) signalveier, overleve chemotherapeutic eksponering28. I en annen studie, avdekket bruker disse modellene med offentlig tilgjengelig pasienten genet datasett24,25, vi at pioneer transkripsjonstjenester faktoren GATA2 er svært overexpressed i metastatisk kastrering-motstandsdyktig kjemoterapi-resistente prostata kreftceller. GATA2 øker overlevelse av celler ved å aktivere direkte en IGF2-avhengige nedstrøms kinase signalering nettverk29. Spesielt disse studiene bidratt til å identifisere romanen nøkkelroller av GATA2 i avansert metastatisk prostatakreft aggressivitet34.

Utvikling av resistens er et problem som ikke er begrenset til Docetaxel og prostata kreft, som det er utbredt blant mange andre typer kreft behandles med en rekke cellegifter. Faktisk ligner på tilgjengeligheten av eksperimentelle modeller restriksjoner, og det er tenkelig at våre protokollen kan tilpasses andre typer av kreft og deres respektive chemoresistance mekanismer.

Generering av Docetaxel-motstandsdyktig celler som beskrevet i denne protokollen kan brukes som et funksjonelle verktøy for å identifisere romanen relevante molekylære og cellulære mekanismer for chemoresistance. Dette åpner døren for å finne nye mål, som utvikling av nye behandlinger for svært ondartet prostatakreft kan velformulerte, skyve gang grensene for hva vi vet om denne sykdommen og hvordan vi behandler sine pasienter.

Disclosures

Forfatterne erklærer at de har ingen konkurrerende økonomiske interesser.

Acknowledgments

V.R.-B. mottar midler fra det amerikanske Department of Health & menneskelige tjenester, NIH, National Cancer Institute gi nummer 1 K22 CA207458-01 og J.D.-D. mottar støtte fra USAs Department of Health & menneskelige tjenester, NIH, National Cancer Institute gi nummer 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics