Generationen av prostatacancer cellmodeller av motstånd mot den anti mitotiska Agent Docetaxel

Cancer Research
 

Summary

Resistens mot cancerbehandlingar bidrar till sjukdomsprogression och döden. Bestämma den mekanistiska underbyggnaden för motstånd är avgörande för att förbättra terapeutiskt svar. Detta manuskript Detaljer protokollet att generera taxan-resistenta cellmodeller av prostatacancer (PC) för att hjälpa dissekera pathways inblandade i progression till Docetaxel resistens hos PC patienter.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mikrotubuli inriktning agenter (MTA) är en stöttepelare för behandling av ett brett utbud av tumörer. Förvärvad resistens mot cellgifter är dock en gemensam mekanism för sjukdomsprogression och en prognostiska-avgörande funktion av maligna tumörer. Vid prostatacancer (PC) dikterar motstånd till MTAs såsom Taxanen Docetaxel behandlingssvikt samt progression mot dödliga stadier av sjukdomen som definieras av en dålig prognos och hög dödlighet. Även om studerade i årtionden, utbudet av mekanismer som bidrar till förvärvad resistens är inte helt klarlagda, och således utgör en betydande begränsning till utvecklingen av nya terapeutiska strategier som skulle gynna patienterna i dessa avancerade stadier av sjukdom. I detta protokoll, beskriver vi generationen av Docetaxel-resistent prostatacancer cellinjer som efterliknar dödliga funktioner i sent stadium prostatacancer, och därför kan användas för att studera mekanismerna genom vilka förvärvade chemoresistance uppstår. Trots potentiella begränsningar inneboende till en cell baserat modell, såsom förlust av beständighet över tid, de Docetaxel-resistenta cellinjer som framställs med denna metod har använts framgångsrikt i nyligen genomförda studier och erbjuder möjlighet att avancera vår molekylär förståelse av förvärvade chemoresistance i dödlig prostatacancer.

Introduction

En ökad frekvens av spridning som orsakas av förlust av cellcykeln kontroll är ett kännetecken för cancer1. Detta funktionella boende gör cancerceller unikt beroende av trohet i cellcykelns viktiga processer under S - och M-faser, vilket har lett till utvecklingen av olika cellcykeln störande läkemedel som inducerar DNA-skador eller mitotiska defekter. Även om många anti mitotiska ombud, som hämmare av mitotiska kinaser eller motorproteiner, är för närvarande utvecklas och testas i kliniska prövningar, fortsätta äldre mikrotubulära inriktning agenter (MTA) att vara den enda kliniskt godkänd strategin för inriktning Mitos i cancer2,3,4. MTAs antingen destabilisera (vinblastin, vinkristin, vinorelbin) eller stabilisera (taxan-derived agenter Cabazitaxel, paklitaxel eller Docetaxel) mikrotubuli och förhindra därigenom bildandet av en fungerande mitotiska spindeln5,6. Dessa agenter utlösa den spindel montering checkpoint7,8, vilket resulterar i en långvarig mitotiska gripandet och eventuell celldöd i odlade celler9,10 och mitotiska defekter i tumörer11 ,12 och är därför användbar för behandling av en stor mängd cancerformer, bland dem prostatacancer13.

Prostatacancer är den vanligaste diagnosen cancer och en ledande orsak till cancer relaterade dödsfall i män14. Mitoshämmande ämnen såsom Docetaxel förbättra prostatacancer patientens överlevnad och är en stöttepelare för behandling av denna sjukdom15,16,17. Tyvärr, trots inledande tumör krympning, tumörceller ofta utveckla resistens under behandling. Flera cellulära mekanismer har varit inblandade i att orsaka utveckling av chemoresistance, inklusive avregleringen av apoptotiska och inflammatoriska vägar eller aktivering/överuttryck av drogen effluxpumpar som ATP-bindande kassett transportören P-glykoprotein (P-gp/ABCB1), den senare som resulterar i export av kemoterapeutiska medel ur celler18,19. Resistens mot taxaner har också kopplats till andra orsaker, såsom förändringar i uttrycket av tubulin isotyper eller tubulin mutationer, som förhindrar interaktionen mellan läkemedlet och dess mål 20,21. Dessutom har motståndet varit relaterade till genomet instabilitet ackumulering och tumör heterogenitet22,23. Dock är de mekanismer som bidrar till taxan motstånd inte helt klarlagda, vilket är uppenbart av avsaknaden av terapeutiska strategier som hindrar dess utseende. Därför finns det ett brådskande behov att generera experimentella modeller som bistår i dissektion av dessa mekanismer och identifiera nya terapeutiska metoder som hindrar utvecklingen av resistens mot dessa läkemedel.

I denna artikel beskrivs en metod som möjliggör generering av Docetaxel-resistenta (DR) prostatacancerceller. Vidare kommer vi att beskriva hur validera motstånd status för dessa celler med hjälp av kolonin bildandet analyser och kvantitativ RT-PCR. Celler som produceras av denna metod har fördelen av går igenom många av de molekylära funktioner som finns i allmänt tillgängliga mänskliga tumör Exempeldatabaser med fördelen av att ge mångsidighet för att utföra en mängd olika experimentella analyser över längre tid än tillåtet enligt tumörprover. Dessa cancer modeller av terapimotstånd kan utökas för många veckor i vävnadsodling och bland andra metoder, kan genetiskt manipulerade, visualiseras genom mikroskopi metoder och analyseras för genuttryck. Dessutom kan de xenotrasplanted i möss att ytterligare analysera effekter i tumör bildande och tillväxt i vivo. För närvarande är den huvudsakliga alternativa metoden att studera läkemedelsresistens i samband med prostatacancer direkt analys av tumörprover. Medan dessa prover presenterar ett mycket potent system för att samla information om genuttryck och mutationsstatus av viss tumörer, tillgång till dem kan vara mycket begränsad och de är svåra att upprätthålla för ytterligare manipulationer och experimentell analys, som kan enkelt göras med de cellinjer som genereras med detta protokoll24,25. Ännu viktigare, i framtiden, strategier alternativ såsom generering av mänskliga härledda organoids direkt från patienter skulle vara ett mycket kraftfullt verktyg och alternativ till den nuvarande metoden26,27. Eftersom de kommer att sammanfatta i ett 3D sammanhang vad en tumör var i sin ursprungliga miljö, blir organoids den perfekta modellen mellan cellinjer och mänskliga tumörer. Men är de experimentella cellmodeller som beskrivs i detta protokoll fortfarande mer överkomligt att upprätthålla och lämplig för snabbare analys. De resultat som erhålls genom att studera dessa cellinjer kan extrapoleras till och bekräftas i mänskliga prover och 3D kulturer. Detta protokoll kan därför vara av intresse för forskare som söker cellmodeller att studera chemoresistance mekanismer i någon cellinje, eftersom våra protokoll kan anpassas till studiet av andra droger och typer av cancer. De metoder som beskrivs här är lätt att applicera i något laboratorium, prisvärd och låt preliminära studier av molekylära och cellulära mekanismer för resistens.

Protocol

1. bestämning av Docetaxel koncentrationen orsakar 50% minskning av kolonin bildandet förmåga (IC50)

Observera: I detta protokoll, Docetaxel IC50 koncentration har utvärderats med hjälp av kolonin bildandet förmåga. Alternativa metoder för att utvärdera cellernas viabilitet (dvs. MTS analyser) kan användas baserat på utredare ' preferenser.

  1. Växa DU145 eller 22Rv1 celler i en 75 cm 2 kolv och förbereda tillräckligt lager 10 mm Docetaxel utspätt i DMSO att användas i framtida experiment.
  2. Till platta celler för bestämning av IC50 för Docetaxel, ta bort medier från kolven, noggrant tvätta cellerna med 5 mL PBS och inkubera med 2 mL 0,05% Trypsin-EDTA under 3-5 minuter vid 37 ° C att lossa cellerna från kolvens yta.
  3. Skölj trypsinized celler från kolven med 5 mL färsk media och samla cellsuspensionen i en 15 mL tub. Pellet celler genom centrifugering (300 x g, 3 min, rumstemperatur (RT)).
  4. Avlägsna supernatanten och återsuspendera cellpelleten i 5 mL färsk media räkna cellerna. Späd cellsuspensionen till 2-2,5 x 10 5 celler/mL för DU145 och 4-4,5 x 10 5 celler/mL för 22Rv1, blanda väl genom pipettering upp och ner och utsäde 2 mL av suspensionen i varje brunn av två 6-väl plattor.
  5. Efter 24 h, när cellerna är på 70-80% confluence, lägga till dos-eskalerande Docetaxel koncentrationer av 1 nM, 2.5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM och 1000 nM till varje brunn. Behandla kontrollen väl med DMSO på högsta volymen används för Docetaxel ( figur 2A).
  6. Efter 72 h, sug ut läkemedel som innehåller media och tillsätt 2 mL av färska media. Inom cirka 4-5 dagar, plattorna kommer att vara redo för färgning.
  7. För att färga kolonierna, tvätta dem försiktigt med 2-3 mL PBS och inkubera dem med 2-3 mL kristallviolett lösning (0,1% w/v i 10% formalin) för 20 min inuti vävnadsodling huven eller dragskåp.
  8. , Ta bort färgning lösningen och tvätta plattorna med 2-3 mL H 2 O ta bort H 2 O och lufttorka plattor.
  9. Analysera resultaten genom att visualisera brunnarna för att fastställa vilket som har Docetaxel koncentrationen som minskar cellernas viabilitet med 50% (IC50). Manuellt räkna kolonier med hjälp av en tuschpenna (för att undvika räknar samma kolonierna två gånger) och representerar procentandelen av cellernas viabilitet i ett diagram ( figur 2A). Slutligen, ta digitala bilder av plattorna för figur representation (som visas i figur 3A).

2. Generering av Docetaxel-resistenta prostata cancerceller

Obs: utföra cell behandlingar använder samma Docetaxel lösning beståndet används för bestämning av IC50 drog koncentration (förbereda tillräckligt lager i förväg för experimentell användning). Håll alltid en liten kolv med celler från föregående steg, bara i fall något inte fungerar bra. Föräldrarnas celler bör odlas parallellt i en liten kolv under hela förfarandet och utsätts för fordon (DMSO) i motsvarande volymer härma de belopp som används i Docetaxel behandlas kolvar.

  1. Plattan DU145 eller 22Rv1 celler i 150 cm 2 flaskor innehållande 20 mL media (3,5 x 10 6 celler per kolv för DU145 och 6,5 * 10 6 celler per kolv för 22Rv1). 10 till 20 kolvar av celler rekommenderas att ha tillräckligt med celler i slutet av protokollet.
  2. Efter 24 h, när cellerna är på ca 70-80% sammanflödet ( figur 2B, innan Docetaxel), lägga till Docetaxel IC50 koncentration bestäms i steg 1 i protokollet (5 nM för de celler som beskrivs i detta protokoll).
  3. Efter 72 h, sug ut läkemedel som innehåller media och lägga till färska, Docetaxel-fri media ( figur 2B, 72 h efter Docetaxel). Ändra media efter 3-4 dagar. Inom cirka 1-2 veckor, resistenta kloner visas tydligt i Mikroskop ( figur 2B, 7 och 14 dagar efter Docetaxel).
  4. Aspirera media, noggrant tvätta cellerna med 15 mL PBS och inkubera med 4 mL 0,05% Trypsin-EDTA under 3-5 minuter vid 37 ° C att lossa cellerna från kolvens yta.
  5. Resuspendera trypsinized celler från kolven med 8 mL färsk media. Pool-celler från alla behandlade kolvar. Pellet celler genom centrifugering (300 x g, 3 min, RT).
  6. Ta bort supernatanten, Återsuspendera cellpelleten i 20 mL färsk media och platta celler i 150 cm 2 kolvar (3,5 x 10 6 celler per kolv för DU145 och 6,5 * 10 6 celler per kolv för 22Rv1).
  7. Efter 24 h, när cellerna är på ca 70-80% confluence, lägga till 5 nM Docetaxel (IC50 startkoncentration) igen.
  8. Upprepa steg 2,3 till 2,6 på dag 3.
  9. Efter 24 h, när cellerna är på ca 70-80% confluence, behandla celler med 2 X IC50 Docetaxel koncentration (10 nM för de celler som beskrivs i detta protokoll).
  10. Upprepa steg 2,3 till 2.8, efter en dos-upptrappning av Docetaxel koncentrationer (25 nM, 50 nM, 100 nM och 250 nM), att generera en stabil population av celler som växer i din kolvar under den slutliga högsta koncentrationen. Högre koncentrationer, dosupptrappning protokollet kan genomföras för upp till 6 månader tills 1000 nM koncentrationen uppnås ( figur 1A).

3. Funktionell karakterisering av förvärvade Docetaxel motstånd av kolonin bildandet Assay

Observera: I detta protokoll, chemoresistance har utvärderats med hjälp av kolonin bildandet analyser. Alternativa metoder för att utvärdera cellernas viabilitet (dvs. MTS analyser) kan användas baserat på utredare ' preferenser.

  1. Plattan 2,000 celler (DU145 eller 22Rv1, både föräldrarnas och Docetaxel-resistenta) per brunn i 6-bra plattor, med 2 mL media per brunn.
  2. Efter 24 h, lägga till ökande koncentrationer av Docetaxel (parental celler: 0,25, 0,5, 1, 2,5 och 5 nM. DR celler: 50, 125, 250, 500 och 1.000 nM). För både DU145 och 22Rv1 cellinjer. DMSO bara lägga till en brunn som en kontroll med samma volym som används för den högsta dos som Docetaxel.
  3. Efter 72 h, sug ut läkemedel som innehåller media och tillsätt färsk Docetaxel-fria medier.
  4. Inkubera plattorna i 1-2 veckor tills kolonierna syns under lupp.
  5. För att färga kolonierna, tvätta dem försiktigt med 2-3 mL PBS och inkubera dem med 2-3 mL kristallviolett lösning (0,1% w/v i 10% formalin) för 20 min inuti vävnadsodling huven eller dragskåp.
  6. , Ta bort färgning lösningen och tvätta plattorna med 2-3 mL H 2 O ta bort H 2 O och lufttorka plattor.
  7. Analysera resultatet av visualisera brunnarna och manuellt räknar kolonier med hjälp av en tuschpenna (för att undvika räknar samma kolonierna två gånger) och representerar procentandelen av cellernas viabilitet i en graf. Ta digitala bilder av plattorna för figur representation ( figur 3A).

4. Fenotypisk karakterisering av Docetaxel motstånd förvärvade fenotyp via qRT-PCR analys

Obs: Docetaxel-resistenta (DR) celler uppvisar ett annat uttryck profil jämfört med deras föräldrars cellinjer 28 , 29. därför framgången för markeringen kan verifieras av qRT-PCR med primers för specifika markörer (för primer sekvenser, hänvisa till avsnittet material, för detaljer, se resultatavsnittet). Detta bör göras efter varje omgång av urval börjar efter tredje rundan. Alternativt går även utvärdering av Docetaxel-resistenta fenotypen av Western blotting.

  1. Extrahera RNA från både föräldrarnas och Docetaxel-resistenta celler med ett RNA extraktion kit och följa tillverkaren ' anvisningar (se Tabell för material och reagenser för detaljer). Använda minst 1-2 x 10 6 celler rekommenderas.
  2. Kvantifiera RNA på 260 nm absorbans, använder en spektrofotometer. För bästa renhet, 260 nm/280 nm absorbansen kvoterna bör vara nära 2.0.
  3. PerfoRM omvänd Transkription att erhålla kompletterande DNA (cDNA) med hjälp av omvänd Transkription kit och efter tillverkaren ' anvisningar (se Tabell för material och reagenser för detaljer), använder 1 µg av RNA i en 20 µL reaktionsblandning (om det behövs en högre mängd av cDNA, skala upp reaktionsblandning följaktligen).
  4. Förbereda qPCR reaktionen i tre exemplar för varje gen av intresse enligt följande:
    - 2 µL 10 µM framåt primer
    - 2 µL 10 µM reverse primer
    - 10 µL SYBR Green PCR master mix
    - 5 µL H 2 O
    -1 µL den nyligen beredda cDNA från steg 4.3.
    Obs: Se Tabell av material för sekvenser av primers används i detta protokoll.
  5. Ange PCR-programmet följande:
    - 95 ° C i 15 min
    - 94 ° C i 30 s |
    -56 ° C i 40 s | 40 gånger
    - 72 ° C under 30 s |
  6. Att analysera qPCR resultat och fastställa förändringar i genuttryck mellan föräldraledighet och DR prover, cykel (Ct) tröskelvärdena för varje gen av intresse bestäms i tre exemplar och genomsnittligt normaliserade till kontrollen lastning (aktin tre exemplar genomsnitt ) för DR (Ct DR) och föräldrarnas celler (Ct föräldraledighet). Värden för föräldrarnas cellerna är normaliserad till 1. ΔCt (Ct DR - Ct föräldraledighet) bestäms att erhålla slutlig mRNA fold förändringar och representerade i en graf. En ökning med > 2 eller en minskning av < 0,5 anses vara betydande och en bra validering av etableringen av Docetaxel förvärvat resistenta fenotypen ( figur 3B).

Representative Results

Detta protokoll kommer att leda till generation av Docetaxel-resistenta (DR) prostatacancerceller. Tidslinjen för slutförande kan variera från 4 till 7 månader som sammanfattas i den schematiska framställningen av protokollstegen i figur 1A och figur 1B. Investeringen i tid kan variera beroende på cell fodra av val och spänna av läkemedelskoncentrationen används som beskrivs i protokollet. Ännu viktigare, tillåter bestämning av Docetaxel IC50 koncentrationen för varje cellinje utformningen av drogen eskalerande koncentrationsintervall för att använda i protokollet för cellerna i val (figur 2A). När protokollet är startat, kan inledande Docetaxel effekter på DU145 och 22Rv1 celler observeras vid olika tidpunkter under lupp att övervaka om protokollet fungerar korrekt. Tidpunkter att övervaka Docetaxel behandlingsprocessen är: före Docetaxel exponering (baslinje), efter Docetaxel exponering för 72 h, 7 dagar och 14 dagar. Observera att endast en minoritet av tumörceller överleva Docetaxel exponeringen och generera kloner, som kan observeras under mikroskopet (figur 2B).

Representativa kolonin bildandet analyser och kvantifiering grafer av föräldraledighet och nyligen genererade Docetaxel-resistenta (DR) cellerna visas i figur 3A. Observera att de genererade Docetaxel-resistenta cellerna kan överleva läkemedelskoncentrationen upp till 1.000-faldig högre än föräldrarnas cellerna.

Slutligen kan Docetaxel-resistenta fenotypen verifieras av qRT-PCR (figur 3B). Observera att Docetaxel-resistenta celler, jämfört med föräldrarnas cellerna, Visa karakteristiska Uppregleringen av ABCB1 och GATA2 och down-förordning CK19 och CDH1. Dessa gener valdes för validering eftersom vi har redan experimentellt visat i vår tidigare publicerade arbete GATA2 uppreglering och nedreglering av CK19 tillsammans med CDH1 i både DR cell modeller28,29. ABCB1 genen valdes också som en krampa gen som visats av andra vara konsekvent uppreglerad i resistenta celler18,19. Det är dock viktigt att notera att andra gener kan väljas enligt litteratur och beroende på cellmodeller och droger som forskaren har valt för att skapa resistenta celler.

Figure 1
Figur 1: tidslinjen för generering av Docetaxel-resistent prostatacancer cellmodeller. (A) representativa diagram över protokollet tidslinjen för generationen av Docetaxel-resistenta cellmodeller. Bilden skildrar den Docetaxel behandling, åtgärder för validering och tid som behövs för varje del. (B) Schematisk bild av åtgärder för validering av protokollet inklusive funktionella kolonin bildandet analyser av föräldraledighet och Docetaxel-resistenta celler behandlas med angivna Docetaxel halterna för 72 h (i rött), representant diagram över kolonin procentsats och qRT-PCR för fenotypisk validering. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Generation av Docetaxel-resistent prostatacancer cell modellsystem. (A) Diagram skildrar bestämning av Docetaxel IC50 i föräldrarnas prostatacancer cell fodrar DU145 och 22Rv1 (steg 1 i protokollet). Förväntade procentandelar av cellernas viabilitet och den Docetaxel dos-eskalerande koncentrationer behövs ingår. Representativ DU145 och 22Rv1 cell livskraft grafer som visar 5 nM som IC50 efter 72 h Docetaxel exponering ingår. Experimenten är exemplar och data representerar medelvärde ± SD. (B) representativa ljusa fält mikroskopi bilderna av DU145 och 22Rv1 celler på anges tider under generering av Docetaxel motstånd (steg 2 i protokollet). Röda pilarna visar en Docetaxel resistenta klon när protokollet har slutförts. Skala barer = 50 nm. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: funktionella och fenotypisk karakterisering av Docetaxel-resistenta cellmodeller. (A) representativa kolonin bildandet analyser av föräldraledighet och Docetaxel-resistenta celler behandlas med angivna Docetaxel halterna för 72 h. procentandel av kolonier för varje behandling koncentration representeras i figuren ingår. Experimenten är exemplar och data representerar det medelvärde ± SD. skala barer = 5 mm. (B) DR/föräldrarnas relativa mRNA faldig ökning kvantifieras av qRT-PCR av ABCB1, GATA2, CK19 och CDH1 visas. Alla qPCR rådata är normaliserad till aktin (se protokoll för detaljer). Experimenten är exemplar och data representerar det medelvärde ± SD. * p < 0,05. Klicka här för att se en större version av denna siffra.

Discussion

I detta manuskript beskriver vi en metod för att generera Docetaxel-resistent prostatacancer cell modellsystem som möjliggör för att studera mekanismer bidrar till förvärvet av chemoresistance fenotypen. Även om detta tillvägagångssätt är mycket tillförlitliga och reproducerbara, övervägas vissa potentiella begränsningar. Eftersom bara en bråkdel av celler bulk befolkning ställer ut chemoresistance28, det rekommenderas att börja med en stor population av celler (vi brukar plåt 20 kolvar 150 cm2, som står för cirka 1,2 x 108 celler). Viktiga steg i protokollet bör anses säkerställa framgång av förfarandet. Först, det är mycket viktigt att använda den samma Docetaxel nylagade lager för lång sikt användning (10 mM lager alikvoter kan användas för år då lagras korrekt i vid-80 ° C). Smärre förändringar i Docetaxel alikvotens kan påverka resultaten av IC50, generering av cell linje tidpunkten och kolonin bildandet resultaten. Det andra är det viktigt att starta protokollet att fastställa IC50 i varje enskild cell linje, eftersom variationer kan förekomma när du använder en ny sats av celler. För det tredje är det viktigt att övervaka att missbruksbehandling är effektivt genom att markera celler under mikroskopet ofta så att eventuella fel kan snabbt upptäckas och korrigeras. Slutligen rekommenderar vi att alltid hålla ett lager av mellanliggande steg vid kontaminering eller oväntade problem som kan påverka lönsamheten för cellerna i mitten av protokollet. Ännu viktigare, våra protokoll syftar till att skapa modeller av resistens genom att exponera prostatacancerceller för höga doser av Docetaxel för 72 h följt av långa återhämtningsperioder, snarare än lägre konstant koncentrationer av läkemedlet i ett försök att efterlikna bäst kliniska scenariot redovisade för prostatacancer behandling med denna taxan agent15,16.

Det bör dessutom noteras att resistenta celler uppvisar en hög plasticitet, vilket kan leda till en progressiv förlust av förvärvad resistens egenskaper över tiden. Därför rekommenderas det inte att utvidga användningen av dessa celler för mer än 2-3 månader i kultur. Om en permanent tillförsel behövs är det tillrådligt att kontinuerligt skapa nya partier av resistenta celler. Dock om partier av celler har varit odlade en längre tid, koloni bildandet analyser och qPCR kan användas att omvärdera deras motstånd. Ett annat alternativ är att öka avtagande motstånd genom att behandla cellerna med en hög dos av Docetaxel för 72 h (500-1000 nM). Efter en återställning av en till två veckor, fenotypen åter kan testas av qPCR och kolonin bildandet analyser. Det är också möjligt, rekommenderas inte att lagra alikvoter av behandlade cellerna i flytande kväve (i FBS, 10% DMSO). Observera att efter en frysning-tining cykel, chemoresistance fenotypen skall alltid omvärderas med ovan nämnda metoder.

Trots dessa varningar, vi28,29 och andra30,31,32,33 lyckades framgångsrikt anställa dessa modellsystem att identifiera nyckel-romanen cellulära och molekylära mekanismer leder till förhöjda tumör-inleda kapacitet, cellöverlevnad och aggressivitet i Docetaxel-resistenta celler. Använder dessa cancer cell modellsystem, upptäckte vi att celler uppvisar en odifferentierad fenotyp, kännetecknas av avsaknad av epitelial och prostata-relaterade differentiering markörer och överuttryck av targetable utvecklingstoxicitet (Notch och Igelkott) signalvägar, överleva kemoterapeutiska exponering28. I en andra studie, funnit med hjälp av dessa modeller tillsammans med offentligt tillgängliga patienten gen datauppsättningar24,25, vi att den banbrytande transkriptionsfaktor GATA2 är högt i ökad utsträckning i metastaserande kastrationsresistent kemoterapi-resistent prostatacancerceller. GATA2 ökar överlevnaden av celler genom att direkt aktivera en IGF2-beroende nedströms kinase signalering nätverk29. Bland annat dessa studier bidragit till att identifiera nya viktiga roller i GATA2 i avancerad metastaserande prostatacancer aggressivitet34.

Utvecklingen av resistens är ett problem som inte är begränsad till Docetaxel och prostatacancer, eftersom det är utbrett bland många andra typer av cancer som behandlas med en rad olika cellgifter. Faktiskt liknande restriktioner på tillgängligheten av experimentella modeller gäller, och det är tänkbart att våra protokoll kan anpassas att studera andra typer av cancer och deras respektive chemoresistance mekanismer.

Generering av Docetaxel-resistenta celler som beskrivs i detta protokoll kan användas som ett fungerande verktyg för att identifiera nya relevanta molekylära och cellulära mekanismer för chemoresistance. Detta öppnar dörren för att hitta nya mål, som utvecklingen av nya behandlingar för Högmaligna prostatacancer kan artikulera, en gång mer tänja på gränserna för vad vi vet om denna sjukdom och hur vi behandlar sina patienter.

Disclosures

Författarna förklarar att de har inga konkurrerande finansiella intressen.

Acknowledgments

V.R.-B. får finansiering från US Department of Health & mänskliga tjänster, NIH, National Cancer Institute bevilja nummer 1 K22 CA207458-01 och J.D.-D. får finansiering från US Department of Health & mänskliga tjänster, NIH, National Cancer Institute bevilja nummer 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics