Prostat kanseri hücre modelleri Anti-Mitotik Ajan Docetaxel direnç üretimi

Cancer Research
JoVE Journal
Cancer Research
AccessviaTrial
 

Summary

Kanser tedavileri için direnç hastalık ilerleme ve ölüm katkıda bulunmaktadır. Direnci mekanik temelleri belirleme terapötik yanıt artırmak için önemlidir. Prostat kanseri (PC) yolları dissekan yardımcı olmak için taxane dayanıklı cep modelleri oluşturmak için protokol Docetaxel direnç PC hastalarda ilerleme dahil bu el yazması ayrıntılar.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mikrotubul hedefleme ajanları (MTAs) çok çeşitli tümör tedavisinde bir dayanak noktası vardır. Ancak, alınan kemoterapötik ilaçlara hastalık progresyon ortak bir mekanizma ve prognostik belirleyici özelliği Malign tümörlerin dirençtir. Prostat kanseri (PC), taxane Docetaxel gibi MTAs karşı direnç başarısız tedavi gibi bir kötü prognoz ve yüksek mortalite oranları tarafından tanımlanan hastalık ölümcül aşamaları doğru ilerleme belirler. Yıllardır okudu da, Edinsel direnç katkıda mekanizmaları dizi değil tamamen anlaşılır ve böylece bu aşamaları gelişmiş hastalarda faydalı olacağını yeni tedavi stratejilerinin geliştirilmesi için önemli bir sınırlama poz hastalık. Bu protokol için biz taklit son aşama prostat kanserinin öldürücü özellikleri ve bu nedenle mekanizmaları incelemek için kullanılan Docetaxel dayanıklı prostat kanseri hücre hatları nesil tarif tarafından alınan hangi chemoresistance doğar. Olası sınırlamalar içsel direnç özellikleri zamanla kaybı gibi bir hücre tabanlı modeline rağmen bu yöntemle üretilen Docetaxel dayanıklı hücre satırları başarıyla son çalışmalarda kullanılan ve ilerlemek için fırsat bizim öldürücü prostat Kanserinde Edinsel chemoresistance moleküler anlayışı.

Introduction

Hücre döngüsü kontrol kaybına neden nükleer silahların yayılmasına karşı bir artış oranı kanseri1bir özelliğidir. Bu işlev özellik kanser hücrelerinin sırasında S - ve M-hangi çeşitli hücre döngüsü DNA hasar veya Mitotik kusurları neden uyuşturucu perturbing gelişmesine yol açmıştır aşamaları, benzersiz hücre cycle'nın temel süreçleri sadakat bağımlı işler. Motor proteinler, ve Mitotik kinaz inhibitörleri gibi çok sayıda anti-Mitotik aracıları şu anda geliştirilmekte ve klinik olarak test edilmiş olmakla birlikte, eski Mikrotubul hedefleme ajanlar (MTAs) tek klinik olarak onaylanmış yaklaşım için olmaya devam mitoz kanser2,3,4hedefleme. MTAs ya istikrarsızlaştırmak (Vinblastine, Vincristine, Vinorelbine) veya (taxane elde edilen aracıları Paklitaksel, Docetaxel veya Cabazitaxel) mikrotübüller stabilize etmek ve böylece işleyen Mitotik iğ5,6oluşumunu önlemek. Bu ajanlar bir uzun süreli Mitotik tutuklama ve nihai hücre ölümü kültürlü hücreleri9,10 ve Mitotik ekranlarda bulunan tümörler11 iğ derleme denetim noktası7,8, tetik ,12 ve vardır bu nedenle prostat kanseri13kanserleri, aralarında büyük bir çeşitlilik tedavisinde yararlı.

Prostat kanseri tanısı en sık kanser ve kanser önde gelen nedenidir erkekler14ölümle ilgili. Docetaxel gibi antimitotic ajanlar prostat kanseri hastanın hayatta kalma geliştirmek ve bu hastalığı15,16,17tedavisinde bir dayanak noktası vardır. Ne yazık ki ilk tümör büzülme rağmen tümör hücreleri kez tedavisi sırasında ilaç direnci gelişir. Çeşitli Hücresel mekanizmalar deregülasyon apoptotik ve inflamatuar yollar veya harekete geçirmek/overexpression uyuşturucu sızma pompalar ATP-bağlayıcı kaset ışınlama gibi de dahil olmak üzere chemoresistance, gelişimi neden karıştığı olmuştur P-glikoprotein (P-gp/ABCB1), ikincisi olan hücreleri18,19dışına kemoterapötik ajanlar ihracat sonuçlanır. Taxanes direnç de tübülin isotypes veya ilaç ve onun hedef 20,21arasındaki etkileşimi önlemek tübülin mutasyonlar ifade değişiklikler gibi diğer nedenleri ile bağlantılı olmuştur. Ayrıca, direnç genom istikrarsızlık birikimi ve tümör heterojenite22,23ilgili olmuştur. Ancak, katkıda taxane direnç mekanizmaları tamamen, belirgin olduğu görünümünü önlemek tedavi stratejileri yokluğunda tarafından anlaşılır değil. Bu nedenle, bu mekanizmalar diseksiyon içinde yardımcı deneysel modelleri oluşturma ve bu ilaçların direnç gelişimini önlemek yeni tedavi yaklaşımları belirlemek için acil bir ihtiyaç vardır.

Bu makalede biz prostat kanseri hücreleri Docetaxel dayanıklı (DR) oluşturulmasını sağlayan bir yöntem açıklanmaktadır. Daha fazla koloni oluşumu deneyleri ve kantitatif RT-PCR kullanarak bu hücreler direnç durumunu doğrulamak nasıl anlatacağım. Bu yöntemle üretilen hücreler kamuya insan tümör örnek veritabanları üzerinde çok çeşitli deneysel deneyleri gerçekleştirmeye çok yönlülük sağlayan yararı ile bulunan moleküler özelliklerinin çoğunu recapitulating avantajı var. süre tümör örnekleri tarafından izin verilenden daha uzun süre. Bu kanser modelleri terapi direnç birçok hafta doku kültürü ve diğer yaklaşımlar arasında için genişletilmiş, genetik olarak manipüle, mikroskobu yöntemler tarafından görüntülenir ve gen ekspresyonu için analiz. Ayrıca, onlar daha fazla tümör oluşumu ve büyüme içinde vivoetkileri analiz farelerde xenotrasplanted olabilir. Şu anda, ilaç direnci prostat kanseri bağlamında incelemek için ana alternatif yöntem tümör örnekleri doğrudan analizidir. Bu örnekler gen ekspresyonu ve verilen tümörlerin mutational durumu hakkında bilgi toplamak için çok güçlü bir sistem mevcut iken, onlara erişim çok sınırlı olabilir ve onlar için başka işlemler ve deneysel analizi, sürdürmek zor olan kolayca bu protokolü24,25ile oluşturulan hücre hatları ile yapılabilir. Hastalardan doğrudan insan türetilmiş organoids nesil bir çok güçlü bir araç ve mevcut yöntemi26,27için alternatif olacaktır gibi önemlisi, gelecekte, alternatif yaklaşımlar. Ne bir tümör onun orijinal ortamında yapıldı bir 3D bağlamda özetlemek, organoids hücre satırları ve insan tümörler arasında mükemmel modeli olabilir. Henüz, bu protokol için açıklanan deneysel hücre modelleri hala daha korumak için uygun fiyatlı ve daha hızlı analiz için uygundur. Bu hücre satırları inceleyerek elde edilen sonuçlar için yaygınlaştırılması ve insan örnekleri ve 3D kültürlerde doğruladı. Bu nedenle, bu iletişim kuralı için bizim iletişim kuralı diğer uyuşturucu ve kanser türleri çalışmaya adapte edilebilir beri chemoresistance mekanizmaları herhangi bir hücre doğrultusunda çalışmaya araştırmacılar hücre modelleri Aradığınız ilgi olabilir. Burada açıklanan yöntemlerden herhangi bir laboratuvar, uygun fiyatlı uygulayın ve ilaç direnci moleküler ve hücresel mekanizmaların ön çalışmalar izin kolaydır.

Protocol

1. % 50 neden Docetaxel konsantrasyonu tayini azaltmak koloni oluşumu yeteneği (IC50)

Not: Bu protokol için koloni oluşumu kullanarak Docetaxel IC50 konsantrasyon değerlendirilmiştir yetenek. Hücre canlılığı (Yani, MTS deneyleri) değerlendirmek için kullanılan bir alternatif yöntem-ebilmek var olmak kullanılmış müfettişler üzerinde dayalı ' tercihleri.

  1. Büyümek DU145 veya 22Rv1 hücreleri bir 75 cm 2 şişesi ve 10 mM gelecek deneylerde kullanılmak üzere DMSO içinde seyreltilmiş Docetaxel yeterli stok hazırlayın.
  2. Hücre Docetaxel IC50 tespiti için plaka medya balonun kaldırmak dikkatle hücreleri 5 mL PBS ile yıkayın ve 2 mL %0,05 ile kuluçkaya tripsin-EDTA 3-5 dk 37 ° C'de hücreler şişesi yüzeyinden ayırmak için.
  3. 5 mL taze medya kullanarak balonun trypsinized hücreleri durulama ve hücre süspansiyon 15 mL tüp içinde toplamak. Santrifüjü (300 x g, 3 dk, oda sıcaklığında (RT)) tarafından hücreleri cips.
  4. Süpernatant kaldırmak, hücre Pelet 5 mL taze medya resuspend ve hücreleri saymak. 2-2,5 10 5 hücre/mL DU145 için x ve 4-4.5 x 10 5 hücre/mL 22Rv1 için hücre süspansiyon sulandırmak, mix de yukarı ve aşağı pipetting ve 2 mL süspansiyon iki 6-şey plakaların her iyi tohum.
  5. Sonra 24 h, hücreleri % 70-80 izdiham ne zaman eklemek Docetaxel konsantrasyonları doz tırmanan 1 nM, 2.5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM ve 1000 nM her şey için. Docetaxel ( şekil 2A) için kullanılan en yüksek ses seviyesinde denetim DMSO ile iyi tedavi.
  6. Sonra 72 h, ortamı içeren ilaç Aspire edin ve 2 mL taze medya ekleyin. Yaklaşık 4-5 gün içinde tabakları boyama için hazır olacak.
  7. Koloniler leke için onları hafifçe 2-3 mL PBS ile yıkamak ve bunları 2-3 mL kristal violet solüsyonu (% %0,1 10 formalin içinde w/v) doku kültürü hood veya bir duman başlık içinde 20 dk için kuluçkaya.
  8. H 2 O 2-3 mL ile boyama çözüm ve yıkama plakalar kaldırmak, H 2 O kaldırmak ve kurumasına plakaları.
  9. Hangisinde hücre canlılığı (IC50) % 50 oranında azalır Docetaxel konsantrasyonu belirlemek için kuyu görselleştirme tarafından sonuçları çözümleyebilirsiniz. El ile (iki kez aynı kolonilerin sayımı) önlemek için bir işaretleyici kalem yardımı ile kolonileri saymak ve hücre canlılığı grafik ( şekil 2A) yüzdesini temsil eder. Son olarak, şekil gösterimi için plakaların dijital görüntüler ( şekil 3A içinde gösterildiği gibi) tutar.

2. Docetaxel dayanıklı prostat kanser hücrelerinin üretimi

Not: hücre tedavileri IC50 ilaç konsantrasyonu tayini için kullanılan aynı Docetaxel çözüm hisse senedi kullanarak gerçekleştirmek (yeterli stok için şimdiden hazırlamak deneysel kullanın). Her zaman bir şey iyi çalışmaz diye küçük bir şişeye hücre önceki adımından tutun. Ebeveyn hücreleri paralel tüm prosedürü boyunca küçük bir şişe olarak yetiştirilen ve araç (DMSO) karşılık gelen cilt tedavi Docetaxel şişeler içinde kullanılan tutarlar taklit olarak maruz.

  1. 20 mL medya içeren 150 cm 2 şişeler plaka DU145 veya 22Rv1 hücrelerinde (3,5 x 10 DU145 ve 6,5 * 10 için 6 hücreler şişe 22Rv1 için şişe başına 6 hücre). 10-20 şişe hücre kullanımı Protokolü'nün sonunda yeterince hücre için önerilir.
  2. Hücreleri yaklaşık % 70-80 olduğunda 24 saat sonra izdiham ( şekil 2B, daha önce Docetaxel), 1. adımda Protokolü'nün tespit IC50 konsantrasyonu, Docetaxel Ekle (5 nM bu iletişim kuralında tanımlanan hücreler için).
  3. Sonra 72 h, ortamı içeren ilaç Aspire edin ve taze, Docetaxel-özgür medya ( şekil 2B, 72 h Docetaxel sonra) ekleyin. Medya her 3-4 gün değiştirin. Yaklaşık 1-2 hafta içinde dayanıklı klonlar ( şekil 2B, 7 ila 14 gün sonra Docetaxel) mikroskop altında belirgin görünecektir.
  4. Aspire medya, dikkatle 15 mL PBS hücrelerle yıkayın ve 4 mL %0,05 ile kuluçkaya tripsin-EDTA 3-5 dk 37 ° C'de hücreler şişesi yüzeyinden ayırmak için.
  5. Trypsinized 8 mL taze medya kullanarak şişeye hücrelerden resuspend. Tüm tedavi şişeler hücrelerden havuz. Cips hücreleri tarafından Santrifüjü (300 x g, 3 dk, RT).
  6. Süpernatant kaldırmak, hücre Pelet 20 mL taze medya resuspend ve 150 cm 2 şişeler hücrelerde plakası (3,5 x 10 DU145 ve 6,5 * 10 için 6 hücreler şişe 22Rv1 için şişe başına 6 hücre).
  7. Sonra 24 h hücre yaklaşık % 70-80 olduğunda, izdiham, 5 ekleyin nM Docetaxel (ilk IC50 konsantrasyonu) yeniden.
  8. 2.3-2.6 üzerinde gün 3 adımları yineleyin.
  9. Sonra 24 h hücre yaklaşık % 70-80 olduğunda, izdiham, 2 X IC50 Docetaxel konsantrasyon hücrelerle tedavi (10 nM bu iletişim kuralında tanımlanan hücreler için).
  10. Tekrar 2,3 2,8, Docetaxel konsantrasyonlarının artması doz takip adımlar (25 nM, 50 nM, 100 nM ve 250 nM), şişeler son en yoğun altında büyüyen hücreler istikrarlı bir nüfusa oluşturmak için. Daha yüksek konsantrasyonlarda için ilâ 6 ay 1.000 nM konsantrasyonu ( şekil 1A) ulaşılana kadar doz-yükseltme iletişim kuralı uygulanabilir.

3. Fonksiyonel karakterizasyonu elde Docetaxel direnç koloni oluşumu tahlil tarafından

Not: Bu protokol için chemoresistance koloni oluşumu deneyleri kullanılarak değerlendirilmiştir. Hücre canlılığı (Yani, MTS deneyleri) değerlendirmek için kullanılan bir alternatif yöntem-ebilmek var olmak kullanılmış müfettişler üzerinde dayalı ' tercihleri.

  1. Plaka 2000 hücreleri (DU145 veya 22Rv1, ebeveyn ve Docetaxel dayanıklı) 6-şey tabak kuyuda, medya 2 mL iyi kullanarak.
  2. Sonra 24 h, eklemek Docetaxel artan konsantrasyonları (ebeveyn hücreleri: 0,25, 0.5, 1, 2.5 ve 5 nM; DR hücreleri: 50, 125, 250, 500 ve 1000 nM). DU145 ve 22Rv1 hücre hatlarında. DMSO sadece bir şey için en yüksek Docetaxel doz için kullanılan aynı ses denetimi olarak eklemek.
  3. 72 h sonra Aspire ortamı içeren ilaç ve taze Docetaxel Ücretsiz medya ekleyin.
  4. 1-2 kolonileri mikroskop altında görünür hale gelene kadar hafta plakalar kuluçkaya.
  5. Koloniler leke için onları hafifçe 2-3 mL PBS ile yıkamak ve bunları 2-3 mL kristal violet solüsyonu (% %0,1 10 formalin içinde w/v) doku kültürü hood veya bir duman başlık içinde 20 dk için kuluçkaya.
  6. H 2 O 2-3 mL ile boyama çözüm ve yıkama plakalar kaldırmak, H 2 O kaldırmak ve kurumasına plakaları.
  7. Kuyu görselleştirme ve el ile (iki kez aynı kolonilerin sayımı) önlemek için bir işaretleyici kalem yardımı ile kolonilerin sayımı sonucu analiz ve hücre canlılığı grafikteki yüzdesini temsil eder. Plakaların rakam gösterimi ( şekil 3A) için dijital görüntü alabilir.

4. Fenotipik karakterizasyonu ve Docetaxel direnç elde fenotip qRT-PCR analiz yoluyla

Not: Docetaxel dayanıklı (DR) hücreleri sergilemek için onların ebeveyn hücre hatları ile karşılaştırıldığında farklı ifade profil 28 , 29. bu nedenle, seçim başarısı qRT-PCR tarafından doğrulanabilir için belirli işaretleri primerler kullanılarak (astar sıralarının başvurmak için malzeme kısım; ayrıntılı bilgi için sonuçlar bölümüne bakın). Bu seçimin üçüncü turdan sonra başlayan her turdan sonra yapılmalıdır. Alternatif olarak, Docetaxel dayanıklı fenotip Western Blot tarafından değerlendirilmesi de mümkündür.

  1. Ayıklamak RNA bir RNA ekstraksiyon kiti kullanarak ve aşağıdaki üretici ebeveyn ve Docetaxel dayanıklı hücrelerden ' s yönergeleri (Tablo malzemeleri ve Kimyasalları Ayrıntılar için bakınız). 1-2 x 10 6 hücreler en az kullanılması önerilir.
  2. Miktarını RNA 260 nm Absorbans, bir Spektrofotometre kullanarak. En iyi saflık için 260 nm/280 nm Absorbans oranları 2.0 yakın olmalıdır.
  3. PerfoRM ters transkripsiyon ters transkripsiyon seti kullanarak ve aşağıdaki üretici Tamamlayıcı DNA (cDNA) elde etmek için ' s yönergeleri (Tablo malzemeleri ve Ayrıntılar kimyasalları, RNA 1 µg 20 µL içinde bkz: kullanma) (cDNA daha yüksek bir miktarda, buna göre tepki karıştırmak ölçekli gerekiyorsa) tepki mix.
  4. Hazırlamak qPCR tepki nüsha olarak faiz her gen için aşağıdaki gibi:
    - 2 µL 10 µM ileri astar
    - 2 µL 10 µM ters astar
    - 10 µL SYBR yeşil PCR ana mix
    - 5 µL H 2 O
    -in 1 µL Yeni hazırlanan cDNA adım 4.3.
    Not: Bu protokol için kullanılan astar serileri için Malzemeler tablo bkz.
  5. Kümesi PCR programı aşağıdaki gibi:
    - 95 ° C 15 dakika
    - 94 ° C 30 s |
    -40 56 ° C s | 40 kere
    - 72 ° C 30 s |
  6. QPCR sonuçlarını analiz ve gen ekspresyonu arasında ebeveyn değişiklikleri belirlemek için
  7. ve DR örnekleri, her gen ilgi için döngüsü eşik (Ct) değerlerini nüsha belirlenir ve ortalama normalleştirilmiş yükleme denetimine (aktin onaylatılacak ortalama ) DR (Ct DR) ve ebeveyn hücreler (Ct ebeveyn) için. Ebeveyn hücrelerdeki değerleri 1 olarak normalleştirilmiş. ΔCt (Ct DR - Ct ebeveyn) son mRNA kat değişiklikleri almak için kararlı ve grafik olarak temsil etti. Bir artış > 2 veya bir azalma < 0,5 önemli kabul edilen ve Docetaxel kurulması iyi bir doğrulama dayanıklı fenotip ( şekil 3B) satın aldı.

Representative Results

Bu iletişim kuralı Docetaxel dayanıklı (DR) prostat kanseri hücrelerinin üretimi için yol açacaktır. Zaman çizelgesi tamamlanması için 4'ten 7 ay için şekil 1A ve şekil 1BProtokolü adımda şematik gösterimi özetlenen aralığı. Zaman yatırım seçtiğiniz hücre kültürünü ve ilaç konsantrasyonları iletişim kuralında taşıdıkları çeşitli bağlı olarak farklı olabilir. Önemlisi, her hücre kültürünü Docetaxel IC50 konsantrasyonu tayini iletişim kuralında seçim (şekil 2A) hücreler için kullanmak konsantrasyon aralığı artan ilaç tasarımı sağlar. Protokol başladıktan sonra DU145 ve 22Rv1 hücreleri üzerinde ilk Docetaxel etkileri Protokolü düzgün çalışıp çalışmadığını izlemek için mikroskop altında farklı zaman noktalarda görülebilir. Docetaxel tedavi sürecini izlemek için zaman Puan önerilir: Docetaxel maruz kalma (temel), 72 h, 7 gün ve 14 gün için Docetaxel maruz kaldıktan sonra önce. Sadece bir azınlık tümör hücrelerinin Docetaxel pozlama hayatta kalmak ve mikroskop (2B rakam) altında gözlenen klonlar oluşturmak unutmayın.

Temsilcisi koloni oluşumu deneyleri ve miktar grafikleri ebeveyn ve yeni oluşturulan Docetaxel dayanıklı (DR) hücre şekil 3Aiçinde gösterilir. Oluşturulan Docetaxel dayanıklı hücreleri ilaç konsantrasyonları daha ebeveyn hücre kadar 1000 kat daha fazla yüksek hayatta olabilir unutmayın.

Son olarak, Docetaxel dayanıklı fenotip qRT-PCR (şekil 3B) tarafından doğrulanabilir. Not Docetaxel dayanıklı hücreleri, ebeveyn hücrelere kıyasla, karakteristik up-düzenleme, ABCB1 ve GATA2 ve CK19 ve CDH1 aşağı-düzenlemesi görüntüler. Biz zaten deneysel olarak daha önce yayımlanmış çalışma GATA2 upregulation ve CK19 CDH1 ile birlikte downregülasyon her iki DR hücre modelleri28,29göstermiştir çünkü bu genlerin doğrulama için seçildi. ABCB1 gene aynı zamanda diğerleri sürekli ilaca dirençli hücreleri18,19upregulated olmak tarafından gösterilen bir elyaf gen olarak seçilmiştir. Ancak, diğer genler edebiyat göre ve hücre modelleri ve dayanıklı hücreleri üretmek için araştırmacı tarafından seçilen uyuşturucu bağlı olarak seçmiş olabilirsiniz unutmamak gerekir.

Figure 1
Şekil 1: Docetaxel dayanıklı prostat kanseri hücre modelleri üretimi için zaman çizelgesi. (A)Docetaxel dayanıklı cep modelleri nesil için protokol zaman çizelgesinin temsilcisi diyagramı. Resimde Docetaxel tedavi, doğrulama adımları ve her bölümü için gerekli zamanı gösteriyor. (B) fonksiyonel koloni oluşumu deneyleri için 72 h (kırmızı) içinde belirtilen Docetaxel konsantrasyonları ile tedavi ebeveyn ve Docetaxel dayanıklı hücrelerinin de dahil olmak üzere iletişim kuralı doğrulama adımları şematik gösterimi temsilcisi Koloni yüzde ve qRT-PCR fenotipik doğrulama için grafiği. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: Docetaxel dayanıklı prostat kanseri hücre modeli sistemleri nesil. Docetaxel IC50 DU145 ve 22Rv1 ebeveyn prostat kanseri hücre hatlarında belirlenmesi tasvir eden(a)diyagramı (Adım 1 iletişim kuralı). Hücre canlılığı ve dozu artan konsantrasyonları gerekli Docetaxel beklenen yüzdeleri dahil edilir. Temsilcisi DU145 ve 22Rv1 hücre canlılığı grafikleri gösteren 5 nM IC50 Docetaxel maruz kalma 72 h sonra dahil olarak. Deneyler triplicates ve veri DU145 ortalama ± SD (B) temsilcisi parlak alan mikroskobu görüntülerini temsil eder ve 22Rv1 hücreleri kez Docetaxel direnç (Adım 2 iletişim kuralı) oluşturma sırasında gösterilir. İletişim kuralı tamamlandıktan sonra Kırmızı oklar Docetaxel dayanıklı bir klon gösterir. Ölçek çubukları = 50 nm. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: Docetaxel dayanıklı cep modelleri fonksiyonel ve fenotipik karakterizasyonu. (A)temsilcisi koloni oluşumu deneyleri ebeveyn ve Docetaxel dayanıklı hücre her tedavi toplama dahil grafik olarak temsil edilir için 72 h. kolonileri yüzdesi için belirtilen Docetaxel konsantrasyonları ile tedavi. Deneyler triplicates ve veri temsil SD ölçek barlar ortalama ± 5 mm. (B) DR/ebeveyn göreli mRNA kat artış = sayısal qRT-PCR tarafından ABCB1, GATA2, CK19 ve CDH1 gösterilir. Tüm qPCR ham veri aktin için normalleştirilmiş (Ayrıntılar için Protokolü Bkz:). Deneyler triplicates ve veri temsil ortalama ± SD * p < 0,05. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Discussion

Bu makale, chemoresistance fenotip edinimi için katkıda mekanizmaları incelenmesi için izin veren Docetaxel dayanıklı prostat kanseri hücre modeli sistemleri oluşturmak için bir yöntem açıklanmaktadır. Bu yaklaşım son derece güvenilir ve tekrarlanabilir olmakla birlikte, potansiyel bazı kısıtlamalar dikkate alınmalıdır. Beri sadece hücre toplu nüfusun küçük bir kısmı chemoresistance28sergileyecek, tavsiye edilir hücrelerinin büyük nüfusuyla başlatmak için (genellikle yaklaşık 1.2 x 10 için hesap 20 şişe 150 cm2, plaka8 hücreleri). Protokolü'nün önemli adımlar yordamın başarılı olmasını sağlamak için düşünülmelidir. İlk olarak, taze için uzun vadeli kullanım (10 mM hisse senedi aliquots için yıllar düzgün-80 ° C'de depolanan kullanılabilir) hisse senedi hazırlanan aynı Docetaxel kullanmak çok önemlidir. Aliquot Docetaxel hafif değişiklikler IC50, hücre satırı zamanlama nesil sonuçlarını ve koloni oluşumu sonuçları etkileyebilir. İkinci olarak, varyasyonları hücre yeni bir toplu işlemi kullanarak oluşabilir bu yana her tek hücre doğrultusunda IC50 belirleme Protokolü başlatmak çok önemlidir. Üçüncü olarak, hücrelerin mikroskop altında hataları hızlı bir şekilde algılanabilir ve düzeltilmiş bu yüzden sık sık kontrol ederek uyuşturucu tedavisi etkilidir izlemek için önemlidir. Son olarak, her zaman bir hisse senedi kirlenme veya protokol ortasında hücrelerin canlılık etkileyebilecek beklenmedik sorunlar durumunda ara adımlardan tutmak için önerilir. Önemlisi, bizim iletişim kuralı amaçlayan Docetaxel yüksek dozda 72 h ilacın sürekli düşük konsantrasyonlarda yerine uzun iyileşme dönemleri tarafından bir girişim en iyi taklit etmek için takip için prostat kanser hücrelerinin açarak ilaç direnci modelleri oluşturmak için klinik Bu taxane Ajan15,16ile prostat kanseri tedavisi için senaryo bildirdi.

Ayrıca, bu ilaca dirençli hücreler zamanla Edinsel direnç özellikleri ilerici bir kaybına yol açabilecek bir yüksek plastisite sergi unutulmamalıdır. Bu nedenle, bu hücre kullanımı için 2-3 aydan fazla kültürde genişletme önerilmez. Kalıcı bir tedarik gerekiyorsa, sürekli olarak yeni toplu dayanıklı hücre oluşturmak için tavsiye edilir. Hücreleri toplu halde uzun süre kültürlü, ancak, koloni oluşumu deneyleri ve qPCR direnişleri yeniden değerlendirmek için kullanılabilir. Yüksek doz Docetaxel 72 h (500-1000 nM) için hücrelerle davranarak azalan direnci artırmak için başka bir alternatiftir. Bir iki hafta sonra bir iyileşme döneminde, fenotip qPCR ve koloni oluşumu ile yeniden sınanabilir deneyleri. Her ne kadar aliquots tedavi hücrelerinin sıvı azot (içinde FBS, % 10 DMSO) depolamak için tavsiye edilmez, mümkündür. Donma-çözülme döngüsü sonra chemoresistance fenotip her zaman yukarıda belirtilen yöntemlerle yeniden değerlendirilmesi gerekir olduğunu unutmayın.

Bu uyarılar rağmen biz28,29 ve diğerleri30,31,32,33 başarıyla anahtar roman hücresel tanımlamak için bu modeli sistemleri istihdam başardık ve Moleküler mekanizmalar önde gelen tümör başlatılıyor kapasite, hücre hayatta kalma ve saldırganlık Docetaxel dayanıklı hücrelerdeki yüksek. Bu kanser hücre modeli sistemleri kullanarak, biz bu hücreleri epitel ve prostat ile ilgili ayırt etme belirteçleri yokluğu ve overexpression targetable, gelişimsel ile karakterize bir farklılaşmamış fenotip sergilenmesi keşfetti (çentik ve Kirpi) sinyal yolları, kemoterapötik pozlama28hayatta. İkinci bir çalışmada, bu modeller ile birlikte kamuya hasta gen veri kümeleri24,25, kullanarak biz öncü transkripsiyon faktörü GATA2 son derece içinde metastatik kastrasyon dayanıklı overexpressed da ortaya çıkardı Kemoterapi dayanıklı prostat kanseri hücreleri. GATA2 doğrudan ağ29sinyal bir IGF2 bağlı aşağı akım kinaz aktive ederek hücre yaşama artırır. Özellikle, bu çalışmalar gelişmiş metastatik prostat kanseri saldırganlık34GATA2 roman anahtar rolleri tanımlamak için yardımcı oldu.

Diğer birçok türde bir yelpazeye kemoterapötik ilaçlar ile tedavi kanserler arasında yaygın olduğu gibi ilaç direnci gelişimi Docetaxel ve prostat kanseri, sınırlı değil bir sorundur. Nitekim, deneysel modeller kullanılabilirliği hakkında benzer kısıtlamalar geçerlidir ve bu bizim iletişim kuralı diğer kanser türleri ve onların anılan sıraya göre chemoresistance mekanizmaları çalışmaya adapte edilebilir akla yatkın.

Bu protokol için açıklandığı gibi Docetaxel dayanıklı hücre üretimi chemoresistance roman ilgili moleküler ve hücresel mekanizmaları tanımlamak için işlevsel bir araç kullanılabilir. Bu yeni hedefler, bunun üzerine son derece kötü huylu prostat kanseri için yeni tedavi gelişimi, bir kez daha bu hastalık hakkında ne biliyoruz ve nasıl onun hasta tedavi sınırları iterek ifade bulmak için kapıyı açar.

Disclosures

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Acknowledgments

V.R.-D. ABD Sağlık Bakanlığı fon alır & İnsan Hizmetleri, NIH, Ulusal Kanser Enstitüsü vermek 1 numaralı K22 CA207458-01 ve J.D.-ö. ABD Sağlık Bakanlığı fon alır & İnsan Hizmetleri, NIH, Ulusal Kanser Enstitüsü vermek 1 numaralı R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics