Prostata-Krebs Zelle Modellgeneration des Widerstandes gegen die Anti-mitotische Agent Docetaxel

Cancer Research
 

Summary

Widerstand gegen Krebs-Therapien trägt zum Fortschreiten der Erkrankung und Tod. Bestimmung der mechanistischen Grundlagen des Widerstands ist entscheidend für die Verbesserung der therapeutischen Antwort. Dieses Manuskript Details des Protokolls Taxan-resistente Zellmodelle von Prostatakrebs (PC) zu helfen, sezieren die Wege erzeugen Progression zu Docetaxel Widerstand bei PC Patienten beteiligt.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mikrotubuli targeting Agents (MTAs) sind eine tragende Säule bei der Behandlung einer Vielzahl von Tumoren. Erworbener Resistenz gegen Chemotherapeutika ist jedoch ein gemeinsamer Mechanismus des Fortschreitens der Krankheit und eine prognostische Faktor-Funktion von bösartigen Tumoren. Bei Prostatakrebs (PC) diktiert Widerstand gegen die MTAs wie Taxan Docetaxel Therapieversagen sowie Entwicklung hin zu tödlichen Stadien der Krankheit, die durch eine schlechte Prognose und hohen Sterblichkeitsraten definiert sind. Obwohl seit Jahrzehnten erforscht, das Array von Mechanismen zur erworbene Resistenz nicht vollständig verstanden, und somit eine erhebliche Einschränkung für die Entwicklung neuer therapeutischer Strategien, die Patienten in diesen fortgeschrittenen Stadien der profitieren könnten Erkrankung. In diesem Protokoll beschreiben wir die Generation der Docetaxel-resistenten Prostatakrebs-Zelllinien, die tödliche Funktionen von fortgeschrittenen Prostatakrebs zu imitieren, und können daher verwendet werden, um die Mechanismen zu studieren durch die erworbenen Chemoresistenzen entsteht. Trotz möglicher Einschränkungen, die untrennbar mit einer zellbasierten Modell, z. B. den Verlust der Eigenschaften im Laufe der Zeit die Docetaxel-resistente Zelllinien durch diese Methode produziert haben in den letzten Studien erfolgreich eingesetzt und bieten die Möglichkeit, vorab unsere molekularen Verständnis der erworbenen Chemoresistenzen in tödlichen Prostatakrebs.

Introduction

Eine erhöhte Rate der Verbreitung verursacht durch den Verlust der Kontrolle des Zellzyklus ist ein Markenzeichen von Krebs1. Diese funktionale Eigenschaft macht Krebszellen eindeutig abhängig von der Treue der Zellzyklus Schlüsselprozesse während S - und M-Phase, was führte zur Entwicklung der verschiedenen Zellzyklus sind Medikamente, die DNA-Schädigung oder mitotische Mängel zu induzieren. Obwohl zahlreiche Anti-mitotische Agenten wie Inhibitoren der mitotischen Kinasen oder Motorproteinen, derzeit entwickelt und getestet in klinischen Studien sind, weiterhin ältere Mikrotubuli targeting Agents (MTAs) der einzige klinisch zugelassenen Ansatz für Ausrichtung auf die Mitose in Krebs2,3,4. MTAs entweder destabilisieren (Vinblastin, Vincristin, Vinorelbin) oder (Taxan-abgeleitete Agenten Paclitaxel, Docetaxel oder Cabazitaxel) Mikrotubuli zu stabilisieren und dadurch verhindern, dass die Bildung eines funktionierenden mitotischen Spindel5,6. Diese Agenten auslösen der Spindel Baugruppe Checkpoint7,8, die zu einer längeren mitotischen Verhaftung und späteren Zelltod in kultivierten Zellen9,10 und mitotischen Mängel in Tumoren11 führt ,12 und sind daher nützlich für die Behandlung von verschiedensten Krebsarten, darunter Prostatakrebs13.

Prostatakrebs ist die am häufigsten diagnostiziert Krebs und eine führende Ursache von Krebs verursachten Todesfälle bei Männern14. Antimitotic Mittel wie Docetaxel verbessert Prostatakrebs Patienten überleben und sind eine tragende Säule bei der Behandlung dieser Krankheit15,16,17. Leider, trotz anfänglichen Tumorschrumpfung Tumorzellen oft entwickeln Resistenzen während der Behandlung. Verschiedene zelluläre Mechanismen waren verwickelt, bei der Entstehung von der Entwicklung der Therapie, einschließlich Deregulierung der Apoptotic und entzündlichen Bahnen oder Aktivierung/Überexpression des Efflux Medikamentenpumpen wie der ATP-bindende Kassette transporter P-Glykoprotein (P-Gp/ABCB1), von denen die Letztere führt auf den Export von Chemotherapeutika aus Zellen18,19. Resistenz gegen Taxane ist auch verbunden worden mit anderen Ursachen, wie z. B. Veränderungen in der Expression von Tubulin Klassen oder Tubulin Mutationen, die Interaktion zwischen dem Medikament und seine Ziel 20,21zu verhindern. Darüber hinaus hat Widerstand Genom Instabilität Anhäufung und Tumor Heterogenität22,23verwandt worden. Allerdings sind die Mechanismen, die einen Beitrag zur Taxan Widerstand nicht vollständig verstanden die ist offensichtlich durch das Fehlen von Therapiestrategien, die sein Aussehen zu verhindern. Daher ist dringend notwendig, experimentelle Modelle, die helfen in der Dissektion dieser Mechanismen zu generieren und neue therapeutische Ansätze zu identifizieren, die die Entwicklung von Resistenzen gegen diese Medikamente zu verhindern.

In diesem Artikel beschreiben wir eine Methode, die die Generation der Docetaxel-resistente (DR) Prostata-Krebszellen ermöglicht. Gewusst wie: Überprüfen Sie den Status der Widerstand dieser Zellen mit Kolonie Bildung Assays und quantitative RT-PCR werden weiter beschrieben. Zellen, die durch diese Methode produziert haben den Vorteil der Rekapitulation viele von der molekularen Eigenschaften in öffentlich zugänglichen menschlichen Tumor Beispieldatenbanken mit dem zusätzlichen Vorteil der Bereitstellung der Vielseitigkeit um über eine Vielzahl von experimentellen Tests durchführen längere Zeit als von Tumorproben zulässig. Dieser Krebs-Modelle von Therapieresistenz können für viele Wochen in der Gewebekultur und unter anderem erweitert werden, genetisch manipuliert, durch Mikroskopieverfahren visualisiert und analysiert werden können Genexpression. Darüber hinaus können sie Xenotrasplanted bei Mäusen, weitere Auswirkungen im Tumor Bildung und das Wachstum in Vivozu analysieren sein. Derzeit ist die wichtigste alternative Methode Resistenzen in Zusammenhang mit Prostatakrebs zu studieren die direkte Analyse von Tumorproben. Während diese Proben ein sehr potentes System zum Sammeln von Informationen über Genexpression und des Status der bestimmten Tumoren vorhanden, Zugang zu ihnen kann sehr begrenzt und sie sind schwer zu halten für weitere Manipulationen und experimentelle Analyse, die kann leicht mit der Zell-Linien generiert mit diesem Protokoll24,25erfolgen. Wichtig ist, nähert sich in der Zukunft Alternative wie z. B. die Erzeugung von menschlichen abgeleiteten Organellen direkt vom Patienten wäre ein sehr mächtiges Werkzeug und Alternative zu den derzeit Methode26,27. Da sie in einem 3D Kontext rekapitulieren werden, was ein Tumor in seiner ursprünglichen Umgebung war, werden Organellen das perfekte Modell zwischen Zell-Linien und menschlichen Tumoren. In diesem Protokoll beschriebenen experimentellen Zelle Modelle sind jedoch immer noch erschwinglicher zu pflegen und für schnellere Analyse geeignet. Die Ergebnisse, die durch das Studium dieser Zelllinien können hochgerechnet auf und bestätigt in Humanproben und 3D Kulturen. Daher kann dieses Protokoll sein Interesse für Forscher suchen Zellmodelle Chemoresistenzen Mechanismen in jede Zelllinie zu studieren, da unser Protokoll an die Studie von anderen Drogen und Krebs-Typen angepasst werden kann. Die hier beschriebenen Methoden sind leicht zu tragen in jedem Labor, erschwinglich und lassen Vorstudien der molekularen und zellulären Mechanismen der Resistenz.

Protocol

1. Bestimmung der Docetaxel Konzentration verursacht 50 % Abnahme Kolonie Bildung Fähigkeit (IC50)

Hinweis: In diesem Protokoll Docetaxel IC50 Konzentration wurde bewertet mit Kolonie Bildung Fähigkeit. Alternative Methoden verwendet, um die Zellviabilität (d. h. MTS-Assays) bewerten können verwendet werden, basierend auf Ermittler ' Präferenzen.

  1. Wachsen DU145 oder 22Rv1 Zellen in einem 75 cm 2 Kolben und bereiten Sie genügend Vorrat von 10 mM Docetaxel verdünnt in DMSO in zukünftige Experimente verwendet werden.
  2. Platte Zellen zur Bestimmung der IC50 Docetaxel, Medien aus der Flasche zu entfernen, sorgfältig waschen Zellen mit 5 mL PBS und inkubieren Sie mit 2 mL 0,05 % Trypsin-EDTA für 3-5 min bei 37 ° C, Zellen von der Oberfläche der Küvette lösen.
  3. Spülen trypsiniert Zellen aus der Flasche mit 5 mL frischem Medien und sammeln die Zellsuspension in einer 15 mL Tube. Pellet-Zellen durch Zentrifugation (300 X g, 3 min, Raumtemperatur (RT)).
  4. Entfernen den Überstand, Aufschwemmen der Zelle Pellet in 5 mL frische Medien und die Zellen zu zählen. Verdünnen Sie die Zellsuspension auf 2-2,5 x 10 5 Zellen/mL für DU145 und 4-4.5 x 10 5 Zellen/mL für 22Rv1, mischen Sie gut durch Pipettieren rauf und runter und Saatgut 2 mL der Suspension in jede Vertiefung von zwei 6-Well-Platten.
  5. Nach 24 h, wenn die Zellen am Zusammenfluss von 70-80 %, sind hinzufügen Dosis-Eskalation Docetaxel Konzentrationen von 1 nM, 2,5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM und 1000 nM in jede Vertiefung. Die Steuerung gut mit DMSO zu behandeln, mit der höchsten Lautstärke verwendet für Docetaxel ( Abbildung 2A).
  6. Nach 72 h, Aspirieren Medikament mit Medien und 2 mL frische Medien. Innerhalb von ca. 4-5 Tagen werden die Platten bereit zum Beizen.
  7. Um die Kolonien zu färben, waschen Sie sie vorsichtig mit ca. 2-3 mL PBS und inkubieren sie mit ca. 2-3 mL Kristallviolett-Lösung (0,1 % w/V in 10 % Formalin) für 20 min in der Gewebekultur-Haube oder einer Dampfhaube.
  8. Sie das Färbung Lösung und waschen Platten mit ca. 2-3 mL H 2 O, H 2 O entfernen und an der Luft trocknen Platten.
  9. Analyse der Ergebnisse durch die Visualisierung der Brunnen um festzustellen, welches die Docetaxel-Konzentration hat, die Zellviabilität um 50 % (IC50) abnimmt. Manuell zählen Sie Kolonien mit Hilfe von einem Filzstift (um zu vermeiden, zweimal die gleichen Kolonien zählen) und geben Sie den Prozentsatz der Zellviabilität in einem Diagramm ( Abbildung 2A). Schließlich nehmen Sie digitale Bilder der Platten für die Darstellung der Abbildung (siehe Abbildung 3A).

2. Generation von Docetaxel-resistenten Krebszellen der Prostata

Hinweis: führen Sie Zelle Behandlungen unter Verwendung den gleichen Docetaxel Lösung bestand verwendet zur Bestimmung der IC50 Wirkstoffkonzentration (bereiten Sie genügend Bestand im Voraus für experimentelle Verwenden Sie). Halten Sie immer eine kleine Flasche mit Zellen aus dem vorherigen Schritt, für den Fall, dass etwas nicht gut funktioniert. Elterliche Zellen sollten parallel in einem kleinen Kolben während des gesamten Verfahrens gewachsen und ans Fahrzeug (DMSO) in entsprechenden Mengen imitiert die Beträge in der Docetaxel behandelt Fläschchen verwendet.

  1. Platte DU145 oder 22Rv1 Zellen in 150 cm 2 Fläschchen mit 20 mL Medien (3,5 x 10 6 Zellen pro Flasche für DU145 und 6,5 * 10 6 Zellen pro Flasche für 22Rv1). 10 bis 20 Fläschchen der Zellen wird empfohlen, genügend Zellen am Ende des Protokolls haben.
  2. Nach 24 h, wenn Zellen bei ca. 70-80 % sind Zusammenfluss ( Abb. 2 b, vor Docetaxel), fügen Sie Docetaxel bei der IC50-Konzentration in Schritt 1 des Protokolls ermittelt (5 nM für die Zellen, die in diesem Protokoll beschriebenen).
  3. Nach 72 h, Aspirieren Medikament mit Medien und frische, Docetaxel-freie Medien ( Abb. 2 b, 72 h nach Docetaxel) hinzufügen. Wechseln Sie das Medium alle 3-4 Tage. Innerhalb von ca. 1-2 Wochen, resistente Klone erscheint deutlich unter dem Mikroskop ( Abb. 2 b, 7 und 14 Tage nach Docetaxel).
  4. Aspirieren Sie Medien, Zellen mit 15 mL PBS sorgfältig waschen und mit 4 mL 0,05 % inkubieren Trypsin-EDTA für 3-5 min bei 37 ° C, Zellen von der Oberfläche der Küvette lösen.
  5. Aufschwemmen trypsiniert Zellen aus der Flasche mit 8 mL frische Medien. Zellen aus allen behandelten Kolben zu bündeln. Pellet-Zellen durch Zentrifugation (300 X g, 3 min, RT).
  6. Entfernen den Überstand, Aufschwemmen der Zelle-Pellets in 20 mL frische Medien und Platte Zellen in 150 cm 2 Fläschchen (3,5 x 10 6 Zellen pro Flasche für DU145 und 6,5 * 10 6 Zellen pro Flasche für 22Rv1).
  7. Nach 24 h, wenn Zellen bei ca. 70-80 % sind Zusammenströmen, fügen Sie 5 nM Docetaxel (IC50 Ausgangskonzentration) wieder.
  8. Wiederholen Sie die Schritte 2,3 bis 2,6 am Tag 3.
  9. Nach 24 h, wenn Zellen bei ca. 70-80 % sind Zusammenströmen, Genuss-Zellen mit 2 X IC50 Docetaxel Konzentration (10 nM für die Zellen, die in diesem Protokoll beschriebenen).
  10. Wiederholen Sie Schritte 2,3 bis 2,8, nach einer Dosissteigerung von Docetaxel Konzentrationen (25 nM, 50 nM, 100 nM und 250 nM), um eine stabile Population von Zellen wachsen in Ihrem Fläschchen unter die letzte höchste Konzentration zu generieren. Für höhere Konzentrationen der Dosiseskalation Protokoll umgesetzt werden kann, für bis zu 6 Monate, bis die 1.000 nM-Konzentration ( Abbildung 1A) erreicht ist.

3. Funktionelle Charakterisierung von erworben Docetaxel Widerstand durch Kolonie-Bildung-Assay

Hinweis: In diesem Protokoll Chemoresistenzen wurde bewertet mit Kolonie Bildung Assays. Alternative Methoden verwendet, um die Zellviabilität (d. h. MTS-Assays) bewerten können verwendet werden, basierend auf Ermittler ' Präferenzen.

  1. Platte 2.000 Zellen (DU145 oder 22Rv1, Eltern- und Docetaxel-resistente) pro Bohrloch in 6-Well Platten, Verwendung von 2 mL Medien pro Bohrloch.
  2. Fügen Sie
  3. nach 24 h, steigende Konzentrationen von Docetaxel (elterliche Zellen: 0.25, 0.5, 1, 2,5 und 5 nM; DR Zellen: 50, 125, 250, 500 und 1.000 nM). Für DU145 und 22Rv1 Zelllinien. Geben Sie DMSO nur in einem als ein Steuerelement mit der gleichen Lautstärke für die höchste Dosis von Docetaxel verwendet.
  4. Nach 72 h, Aspirieren Medikament mit Medien und frischen Docetaxel-freie Medien hinzufügen.
  5. Inkubieren Sie Platten für 1-2 Wochen, bis die Kolonien unter dem Mikroskop sichtbar sind.
  6. Um die Kolonien zu färben, waschen Sie sie vorsichtig mit ca. 2-3 mL PBS und inkubieren sie mit ca. 2-3 mL Kristallviolett-Lösung (0,1 % w/V in 10 % Formalin) für 20 min in der Gewebekultur-Haube oder einer Dampfhaube.
  7. Sie das Färbung Lösung und waschen Platten mit ca. 2-3 mL H 2 O, H 2 O entfernen und an der Luft trocknen Platten.
  8. Ergebnis zu analysieren, indem Sie visualisieren die Brunnen und manuell zählen Kolonien mit Hilfe von einem Filzstift (um zu vermeiden, zweimal die gleichen Kolonien zählen) und der Prozentsatz der Zellviabilität in einem Diagramm darstellen. Nehmen Sie digitale Bilder von Platten für Abbildung Darstellung ( Abb. 3A).

4. Phänotypische Charakterisierung von Docetaxel Widerstand erworbene Phänotyp über qRT-PCR-Analyse

Hinweis: Docetaxel-resistente (DR) Zellen zeigen einen anderen Ausdruck Profil im Vergleich zu ihrer elterlichen Zelllinien 28 , 29. daher der Erfolg der Auswahl von qRT-PCR überprüft werden kann mit Primer für spezifische Marker (Primer-Sequenzen finden Sie zum Abschnitt Materialien; für Details, siehe Abschnitt Ergebnisse). Dies sollte nach jeder Runde der Auswahl nach der dritten Runde ab. Bewertung der Docetaxel-resistenten Phänotyp durch westliche Beflecken ist alternativ auch möglich.

  1. Extrahieren RNA aus Eltern- und Docetaxel-resistenten Zellen mit einem RNA-Extraktion-Kit und Anschluss an die Hersteller ' s Anweisungen (siehe die Tabelle der Materialien und Reagenzien für Details). Mit einem Minimum von 1-2 x 10 6 Zellen ist empfehlenswert.
  2. Quantify RNA bei 260 nm Absorption, mit einem Spektralphotometer. Für beste Reinheit, die 260 nm/280 nm Absorption Verhältnisse sollte in der Nähe von 2.0.
  3. RM reverse Transkription, komplementäre DNA (cDNA) mit Hilfe der reversen Transkription-Kits und Anschluss an den Hersteller zu erhalten ' s Anweisungen (siehe die Tabelle der Materialien und Reagenzien für Details), mit 1 µg RNA in einem 20 µL Reaktion Mischung (ggf. ein höherer Betrag von cDNA ist die Reaktion Mischung entsprechend skalieren).
  4. Bereiten die qPCR-Reaktion in dreifacher Ausfertigung für jedes Gen des Interesses wie folgt:
    - 2 µL 10 µM forward Primer
    - 2 µL 10 µM-rückwärts-Primer
    - 10 µL SYBR Green PCR-master-Mix
    - 5 µL H 2 O
    -1 µL die neu vorzubereitenden cDNA aus Schritt 4.3.
    Hinweis: Siehe Tabelle der Materialien für die Sequenzen in diesem Protokoll verwendeten Primer.
  5. Stellen die PCR-Programm wie folgt:
    - 95 ° C für 15 min
    - 94 ° C für 30 s |
    -56 ° C für 40 s | 40 Mal
    - 72 ° C für 30 s |
  6. QPCR analysieren und ermitteln, Veränderungen in der Genexpression zwischen Eltern und DR Proben, die Zyklus (Ct) Grenzwerte für jedes Gen von Interesse sind in dreifacher Ausfertigung bestimmt und der Durchschnitt normiert auf das Steuerelement laden (Aktin dreifacher Durchschnitt ) für DR (Ct-DR) und elterliche Zellen (Ct elterliche). Werte für die elterliche Zellen sind auf 1 normiert. ΔCt (Ct DR - Ct elterliche) ist entschlossen, endgültige mRNA Falte Änderungen abrufen und in einem Diagramm dargestellt. Eine Erhöhung des > 2 oder eine Abnahme der < 0,5 gelten als bedeutende und eine gute Überprüfung der Errichtung der Docetaxel erworben resistenten Phänotyp ( Abb. 3 b).

Representative Results

Dieses Protokoll wird an die Generation Docetaxel-resistente (DR) von Krebszellen der Prostata führen. Der Zeitplan für die Fertigstellung kann von 4 bis 7 Monate reichen, wie in der schematischen Darstellung der Protokoll-Schritte in Abbildung 1A und 1 b Abbildungzusammengefasst. Der Zeitaufwand kann je nach Wahl der Zell-Linie und Drogen-Konzentrationen verwendet, wie im Protokoll beschrieben abweichen. Wichtig ist, erlaubt die Bestimmung der Konzentration Docetaxel IC50 für jede Zelllinie das Design des Medikaments Eskalation der Konzentrationsbereich, in das Protokoll für die Zellen der Wahl (Abb. 2A) zu verwenden. Sobald das Protokoll gestartet wird, können erste Docetaxel Auswirkungen auf DU145 und 22Rv1 Zellen beobachtet werden zu verschiedenen Zeitpunkten unter die Lupe genommen, wenn das Protokoll ordnungsgemäß zu überwachen. Vorgeschlagenen Zeitpunkten Docetaxel Behandlungsprozess überwachen: vor Docetaxel Belichtung (Baseline), nach Docetaxel Belichtung für 72 h, 7 Tage und 14 Tage. Beachten Sie, dass nur eine Minderheit der Tumorzellen überleben die Docetaxel-Exposition und generieren Klone, die unter dem Mikroskop (Abbildung 2 b) zu beobachten ist.

Repräsentative Kolonie Bildung Assays und Quantifizierung Abbildungen des Elternurlaubs und die neu erzeugten Docetaxel-resistente (DR) Zellen sind in Abbildung 3Agezeigt. Beachten Sie, dass die generierten Docetaxel-resistenten Zellen Medikament Konzentrationen bis zu 1,000-fold höher als die elterliche Zellen überleben können.

Zu guter Letzt kann der Docetaxel-resistenten Phänotyp durch qRT-PCR (Abb. 3 b) validiert werden. Beachten Sie, dass Docetaxel-resistenten Zellen, im Vergleich zu den elterlichen Zellen charakteristische Up-Regulierung des ABCB1 und GATA2 und Down-Regulierung von CK19 und CDH1 anzuzeigen. Diese Gene wurden für die Validierung ausgewählt, weil wir in unserer zuvor veröffentlichte Arbeit GATA2 Hochregulation und Downregulation des CK19 zusammen mit CDH1 in beiden DR Zelle Modelle28,29bereits experimentell gezeigt haben. Gens ABCB1 wurde auch als Grundnahrungsmittel gen ausgewählt, die andere konsequent sein hochreguliert resistente Zellen18,19nachgewiesen hat. Es ist jedoch wichtig zu beachten, dass andere Gene laut Literatur und je nach Handy-Modelle und die Medikamente, die zur Erzeugung von resistenten Zellen vom Forscher gewählt gewählt werden können.

Figure 1
Abbildung 1: Zeitplan für die Generation von Docetaxel-resistenten Prostatakrebs Zellmodellen. (A) repräsentative Abbildung des Schnittfensters Protokoll zur Erzeugung von Docetaxel-resistente Zellmodellen. Abbildung zeigt den Docetaxel Behandlung Validierungsschritte und Zeitaufwand für die einzelnen Teile. (B) schematische Darstellung der Validierungsschritte des Protokolls funktionale Kolonie Bildung Assays von Eltern- und Docetaxel-resistenten Zellen behandelt mit der angegebenen Docetaxel-Konzentrationen für 72 h (in rot), darunter Vertreter grafische Darstellung der Kolonie Prozentsatz und qRT-PCR für die phänotypische Validierung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Generation von Docetaxel-resistenten Prostatakrebs Modell Zellsysteme. (A) Diagramm zeigt die Entschlossenheit der Docetaxel IC50 in die elterliche Prostatakrebs-Zelllinien DU145 und 22Rv1 (Schritt 1 des Protokolls). Erwarteten Prozentsätze der Zellviabilität und der Docetaxel Dosis-Eskalation Konzentrationen erforderlich sind im Preis inbegriffen. Vertreter DU145 und 22Rv1 Zelle Lebensfähigkeit Graphen zeigt 5 nM als IC50 nach 72 h von Docetaxel Exposition sind im Preis inbegriffen. Die Experimente sind Triplicates und Daten stellt der Mittelwert ± SD (B) repräsentative Hellfeld Mikroskopieren Bilder von DU145 und 22Rv1 Zellen im angegebenen Zeiten bei der Erzeugung von Docetaxel Widerstand (Schritt2 des Protokolls). Rote Pfeile zeigen Docetaxel resistenten Klon, nachdem das Protokoll abgeschlossen ist. Skalieren von Balken = 50 nm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: phänotypische und funktionelle Charakterisierung von Docetaxel-resistente Zellmodellen. (A) repräsentative Kolonie Bildung Assays von Eltern- und Docetaxel-resistenten Zellen mit den angegebenen Docetaxel-Konzentrationen für 72 h Prozentsatz der Kolonien behandelt, für jede Behandlung-Konzentration im mitgelieferten Diagramm dargestellt wird. Die Experimente sind Triplicates und Daten stellt den Mittelwert ± SD Scale bars = 5 mm. (B) DR/elterliche relative mRNA fachen Anstieg durch qRT-PCR von ABCB1 quantifiziert, GATA2, CK19 und CDH1 werden angezeigt. Alle qPCR-Rohdaten auf Actin normiert ist (siehe Protokoll für Details). Die Experimente sind Triplicates und Daten stellen den Mittelwert ± SD. * p < 0,05. Bitte klicken Sie hier für eine größere Version dieser Figur.

Discussion

In diesem Manuskript beschreiben wir eine Methode um Docetaxel-resistenten Prostatakrebs Modell Zellsysteme zu generieren, die für die Untersuchung der Mechanismen, die zur Übernahme des Phänotyps Therapie ermöglicht. Während dieser Ansatz höchst zuverlässig und reproduzierbar ist, einige möglichen Einschränkungen zu berücksichtigen. Da nur ein Bruchteil der Masse Bevölkerung der Zellen Chemoresistenzen28ausstellen werden, es empfiehlt sich, mit einer großen Population von Zellen beginnen (wir Platte in der Regel 20 Fläschchen 150 cm2, die entfallen ca. 1,2 x 108 (Zellen). Wichtige Schritte des Protokolls für den Erfolg des Verfahrens zu berücksichtigen. Erstens ist es sehr wichtig, verwenden die gleichen Docetaxel Lager für lange Laufzeit Nutzung (10 mM Lager Aliquote können für verwendet werden, Jahre, wenn Sie ordnungsgemäß in bei-80 ° C gelagert) frisch zubereitet. Geringfügige Änderungen in der Docetaxel aliquoten können die Ergebnisse der IC50, Generierung von Zelle Zeile Timing und die Kolonie Bildung Ergebnisse auswirken. Zweitens ist es entscheidend, das Protokoll, die Bestimmung der IC50 in jeder einzelnen Zelle Zeile, da Variationen auftreten können, wenn Sie eine neue Charge von Zellen zu verwenden zu beginnen. Drittens: unbedingt darauf achten, dass die medikamentöse Behandlung wirksam ist durch Überprüfung Zellen unter dem Mikroskop häufig, so dass eventuelle Fehler schnell erkannt und korrigiert werden können. Zu guter Letzt empfehlen wir immer einen Vorrat an Zwischenschritte im Falle einer Verschmutzung oder unerwartete Probleme, die die Lebensfähigkeit der Zellen in der Mitte des Protokolls auswirken könnten. Wichtig ist, unser Protokoll Modelle von Resistenzen zu erzeugen, indem man Prostatakrebszellen zu hohe Dosen von Docetaxel für 72 h, gefolgt von langen Erholungsphasen, anstatt niedrigeren konstanten Konzentrationen des Medikaments in einem Versuch, das beste zu imitieren soll klinische Szenario für Prostatakrebs Behandlung mit diesem Taxan Agent15,16gemeldet.

Darüber hinaus ist darauf hinzuweisen, dass resistente Zellen zeigen eine hohe Plastizität, die im Laufe der Zeit zu einem fortschreitenden Verlust der erworbenen Resistenz Eigenschaften führen können. Erweiterung der Nutzung dieser Zellen länger als 2-3 Monate in der Kultur wird daher nicht empfohlen. Wenn eine permanente Versorgung benötigt wird ist es ratsam, ständig neue Chargen von resistenten Zellen generieren. Jedoch wenn Chargen von Zellen über einen längeren Zeitraum kultiviert wurden, können Kolonie Bildung Assays und qPCR verwendet werden, ihren Widerstand zu überdenken. Eine weitere Alternative ist die abnehmenden Widerstand Förderung durch die Behandlung der Zellen mit einer hohen Dosis von Docetaxel für 72 h (500-1.000 nM). Nach einer Erholungszeit von ein bis zwei Wochen kann der Phänotyp erneut durch qPCR und Kolonie Bildung getestet Assays. Es ist auch möglich, jedoch nicht empfohlen, Aliquote der behandelten Zellen in flüssigem Stickstoff (in FBS, 10 % DMSO) zu speichern. Bitte beachten Sie, dass nach einem Frost-Tau-Zyklus der Chemoresistenzen Phänotyp immer mit den vorgenannten Methoden neu bewertet werden sollte.

Trotz dieser Vorbehalte wir28,29 u.30,31,32,33 konnten erfolgreich einsetzen diese Modellsysteme, zelluläre Schlüssel Roman zu identifizieren und molekulare Mechanismen führen zu erhöhten Tumor-initiierenden Kapazität, Zelle überleben und Aggressivität in Docetaxel-resistenten Zellen. Mit diesen Krebs Zelle Modellsystemen entdeckten wir Zellen ausstellenden eine undifferenzierte Phänotyp, gekennzeichnet durch das Fehlen von epithelialen und Prostata-bezogene Differenzierung Marker und Überexpression von den Entwicklungsstörungen (Kerbe und Hedgehog) Signalwege, überleben chemotherapeutischen Exposition28. In einer zweiten Studie aufgedeckt mit diesen Modellen zusammen mit öffentlich zugänglichen Patienten gen Datensätze24,25, wir, dass Pioneer Transkriptionsfaktors GATA2 hoch in metastasiertem Kastration-resistente überexprimiert ist Chemotherapie-resistenten Prostatakrebs-Zellen. GATA2 erhöht das Überleben der Zellen durch eine IGF2-abhängige nachgeschalteten Kinase Signalisierung Netzwerk29direkt aktivieren. Vor allem, diese Studien dazu beigetragen, neuartige Schlüsselrollen von GATA2 in fortgeschrittenem metastasierendem Prostatakrebs Aggressivität34zu identifizieren.

Die Entwicklung von Resistenzen ist ein Problem, das nicht nur auf Docetaxel und Prostatakrebs, wie es unter vielen anderen Arten von Krebs mit einer Vielzahl von chemotherapeutischen Medikamenten behandelt. In der Tat gelten ähnliche Einschränkungen der Verfügbarkeit des experimentellen Modellen, und es ist denkbar, dass unser Protokoll an anderen Krebsarten und ihre jeweiligen Chemoresistenzen Mechanismen untersuchen angepasst werden kann.

Die Generation der Docetaxel-resistenten Zellen wie in diesem Protokoll beschrieben dient als ein funktionales Werkzeug, um neuartige relevanten molekulare und zelluläre Mechanismen der Chemoresistenzen zu identifizieren. Dies öffnet die Tür zu finden, neue Ziele, auf denen die Entwicklung neuer Therapien bei hochmalignen Prostatakrebs die Grenzen einmal mehr artikulieren könnte, was wir über diese Krankheit wissen und wie wir ihre Patienten behandeln.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessenkonflikte.

Acknowledgments

GERADE-B. erhält Mittel aus dem US Department of Health & Human Services, NIH, National Cancer Institute gewähren Nummer 1 K22 CA207458-01 und J.D-D. wird gefördert vom US Department of Health & Human Services, NIH, National Cancer Institute gewähren Nummer 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics