Author Produced

Att upptäcka det Borrelia Spirochete, Borrelia Burgdorferi, i fästingar med nästlade PCR

Biology
JoVE Journal
Biology
AccessviaTrial
 

Summary

Nästlade PCR är en känslig, specifika och okomplicerad teknik som kan tillämpas att fästing DNA extrakt för att probe för Borrelia burgdorferi, vilka smittämnen av borrelia. Inledande PCR experimentet använder gen-specifika primers för att generera långa amplikoner, som sedan blivit mallar för en efterföljande reaktion använda interna primers.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K. B., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Borrelia är en allvarliga vektorburna infektioner som orsakas av Borrelia burgdorferi sensu lato familjen av spiroketer, som överförs till människan genom bett av infekterade Ixodes fästingar. Den primära etiologiska agenten i Nordamerika är Borrelia burgdorferi sensu stricto. Som geografiska risken regioner expandera, är det klokt att stödja robust övervakningsprogram som kan mäta fästing infektion priser och kommunicera resultat till kliniker, veterinärer och allmänheten. Molekylära tekniken med kapslade polymeras-kedjereaktion (nPCR) har länge använts för detta ändamål, och det är fortfarande en central, billig och robust metod för detektion av Borrelia i både fästingar och djurliv.

Denna artikel visar tillämpningen av nPCR kryssa DNA-extrakt för att identifiera smittade exemplar. Två oberoende B. burgdorferi mål, gener kodning Flagellin B (FlaB) och yttre yta protein A (OspA),, har använts i stor utsträckning med denna teknik. Protokollet innebär tick samling, DNA-extraktion och sedan den första omgången av PCR att upptäcka var och en av de två Borrelia-specifika loci. Efterföljande polymeraskedjereaktion (PCR) används produkten av den första reaktionen som en ny mall för att generera mindre, inre förstärkning fragment. Metoden med kapslade förbättrar både specificitet och känslighet av konventionella PCR. En fästing anses positivt för patogen vid inre amplikoner från båda Borrelia gener kan upptäckas av agaros gelelektrofores.

Introduction

Borrelia (LD) är den vanligaste vektorburna infektionen på norra halvklotet, och dess förekomst fortsätter att öka1. Detta försvagande sjukdom orsakas av spirocheteal patogener av de Lyme-borrelios (LB) komplex (vanligen kallad Borrelia burgdorferi sensu lato eller s.l.), som historiskt omfattar dominerande nordamerikanska patogener, B. burgdorferi sensu stricto (Svensson), förutom B. afzelii och B. garinii, som är utbredd i hela Europa och Asien, och arter av framväxande klinisk relevans2,3. Dessa bakterier överförs till människan genom bett av infekterade Ixodes fästingar2. Även om de största nordamerikanska vektorerna I. scapularis och I. pacificus, har flera arter inom detta släkte hittats till hamnen och överföra bakterien4. I människor, kan B. burgdorferi orsaka multisystem symtom som påverkar hud, leder, hjärta, nervsystemet, endokrina körtlar, mag-tarmkanalen, och inre organ5,6,7, 8,9,10. Center for Disease Control and Prevention uppskattar för närvarande över 300.000 nya mänskliga fall årligen i USA11,12. Prognosen är ofta gynnsam när sjukdomen diagnostiseras och behandlas i ett tidigt skede, har studier antytt att någonstans mellan 10% och 60% av patienterna som fick den rekommenderade antibiotika behandlingsregimen fortsatte att uppleva symtom efter behandling upphörande, kallas i ett fenomen Post behandling Borrelia syndrom (PTLDS)13,14,15. Förseningar i kliniska interventioner kan dessutom uppstå till följd av bristande medvetenhet av ett fästingbett, icke-specifik presentation av initiala sjukdomen, och den låg känsligheten av traditionella serologi-baserade diagnostik när den används vid uppkomsten av infektion. Underlåtenhet att behandla snabbt och på lämpligt sätt kan symptom progression som kan manifesteras i alltmer försvagande komplikationer16,17. Lyme disease prevention är därför en hörnsten i riskhantering. Strategier för att bekämpa detta växande hot inkluderar robusta övervakningsåtgärder för att indikera patogen prevalensen i fästingar, och identifiera geografiska regioner av oro.

Denna artikel visar nyttan av kapslade polymeras-kedjereaktion (nPCR) som en molekylär screeningmetod att identifiera smittade fästingar. För att öka specificiteten, används två Borrelia generna för parallell förstärkning. Flagellin B (FlaB) kodar ett större glödtråden protein av flagellen18och genen ligger på den enda linjära kromosomen, medan lipoprotein produkten av yttre yta protein A (OspA) förmedlar tick midgut kolonisering, och är plasmid-kodade19,20. Arbetsflödet består av tick insamling, DNA-extraktion och sedan den första omgången av PCR att upptäcka Borrelia-specifika loci. Efterföljande PCR använder produkten av den första reaktionen som en ny mall för att generera mindre, inre förstärkning fragment. En fästing anses vara positiva för Borrelia burgdorferi när inre amplikoner från båda Borrelia gener kan upptäckas av agaros gelelektrofores.

Både nPCR tekniken, och FlaB och OspA gen mål, har använts för ekologisk övervakning och klinisk upptäckt av den Borrelia spirochete sedan det tidiga 1990-talet21,22,23 ,24,25. Före utvecklingen av molekylär protokoll bedömdes fästingar genom att utsätta tarmen innehållet till anti -Borrelia immunofluorescens (om) färgning, mikrobiell kultur eller en kombination därav26. Dessa strategier lider inneboende begränsningar, inklusive långsam tillväxt och kräsen art av Borrelia27, antikropp prestandaproblem och kravet på levande fästingar för om bearbetning21. PCR antogs därefter för att ge snabb, känsliga och specifika identifiering av infekterade vektorer. Det erbjöd markanta förbättringar över den traditionella metoden, inklusive kultur-oberoende direkt tillämpning till olika provtyper, såsom döda och arkiverade fästingar som annars skulle vara olämpligt för testning21,22 . Kapslade experimentell design ytterligare förbättra den specificitet och känslighet av klassiskt PCR genom att anställa två olika uppsättningar av gen-specifika primers i två på varandra följande rundorna av förstärkning25,28.

Experimentell framgång är kritiskt beroende av strategiska gen urval och amplikon design. För att korrekt uppskatta förekomsten av Borrelia burgdorferi, bör primers identifiera de relevanta patogenerna utan korsreagerande med skovvis fever spiroketer också i släktet Borrelia . När det gäller FlaBuppnås denna specificitet genom att rikta en variabel inre region av genen, snarare än de relativt bevarade flankera sekvenser som delas av olika bakterier (figur 1)24,29 , 30.

Figure 1
Figur 1: begreppet nPCR, som illustreras med hjälp av Borrelia FlaB gen som måltavla. 5' och 3' termini av genen är gemensamma för organismer utöver Borrelia burgdorferi s.l., rendering dessa regioner olämpliga för specifik bedömning av Lyme-orsakar patogener. Använda mindre-bevarad interiör sekvenser som primer mål, utförs två rundor av PCR för att upptäcka en slutlig, inre amplikon. Klicka här för att se en större version av denna siffra.

I ett test av sin diskriminerande kapacitet, inre FlaB primers utvärderades med över 80 olika Borrelia isolat, och hittade för att identifiera endast de som förknippas med Borrelia24. Nedre gränsen för upptäckt av nPCR har dokumenterats på mellan sex24 och tio31 bakterier från ren kultur, även om känsligheten kan ytterligare förbättras genom södra blotting ospädd och korsa en radioaktivt märkt eller Kemiluminiscens sonden. Koppling tekniker minskar den påvisbara gränsen till en enda spirochete31. Genom direkt jämförelse konstaterades konventionella, unprobed single-runda PCR för att rapportera förekomsten av minst 104 spiroketer31. Det bör dock noteras att analysens känslighet blir lägre när du arbetar med komplexa miljö- och kliniska prover, på grund av den överväldigande förekomsten av orelaterade DNA och potentiella hämmande ämnen. Dessa utmaningar kan kringgås i hög grad genom användning av nPCR.

Trots framsteg inom molekylär teknik under de senaste decennierna förblir nPCR en krampa teknik i arbetet med modern övervakning. Om man är försiktig i utformningen och genomförandet av detta protokoll, är det en kraftfull, anpassningsbar och relativt enkla metoden för att fånga förekomsten av patogener i tick vektorer.

Protocol

1. DNA isolering från fästingar

  1. Förvärva fästingar via fältuppsättningen eller passiv övervakning från veterinärer och allmänheten. Fästingar bör vara dödade genom frysning, placeras i en förseglad påse och postas i rumstemperatur.
    1. Använder ett artikelformulär, samla information om datum och geografisk plats för möte, tick fastsättning status, värdart och senaste resa historia i mottagande.
    2. Eftersom nästlade PCR är potentiellt sårbara för kontaminering, se till att arbetsytan laboratorium är inställd att minimera cross-exponering av prover. Detta innebär att exekvera olika element i protokollet i separata, dedikerade utrymmen som är väl isolerade från varandra som grundligt rengörs och steriliseras, och att säkerställa att alla instrument är fritt från föroreningar.
    3. Vid mottagandet av preparatet, fotografera fästingen och bestämma arter, utvecklingsstadier, kön och mjölkstockning status i jämförelse till en identifiering nyckel32 .
    4. Under aseptiska förhållanden, Tudela fästingen med en steril rakblad eller skalpell och placera två tick fragment i separata mikrocentrifugrör.
  2. Extrahera totala DNA genom proceduren någon isolering som ger PCR-kompatibel mall. Detta protokoll visar en enkel kelering-baserat tillvägagångssätt.
    1. Börja genom att lägga till en lämplig volym (ofta mellan 50-200 µL) av en lytisk kelering reagens tick fragmentet. Det specifika beloppet beror på prov storlek och mjölkstockning status; riktlinjerna bör tillhandahållas av tillverkaren. Homogenisera med en mikrorör mortelstöt.
    2. Inkubera prover i ett vattenbad vid 60 ° C i 45 min och vortex kort.
    3. Centrifugera proverna för 4 min vid 16,276 x g (13,300 rpm) i en stationär mikrocentrifug.
    4. Överför supernatanten till en fräsch, märkt mikrorör innehållande 50 μl isopropanol, blanda genom inversion och åter Centrifugera som i (1.2.3).
    5. Dekantera supernatanten, och skölj DNA pelleten med 50 µL av 70% etanol.
    6. Avlägsna överflödigt etanol med en pipett, och låt pelleten lufttorka 15 min i rumstemperatur.
    7. Att resuspendera DNA, tillsätt 50 µL av 1 mM Tris pH 7,0 och inkubera prover i ett vattenbad för 1 h vid 60 ° C. DNA kan nu lagras vid-20 ° C för framtida molekylär analys.

2. nästlade PCR-detektion av Borrelia OspA och FlaB.

Obs: En översikt över allmänna PCR principer och rutiner ges av Lorenz, 201233.

  1. Syntetisera eller få Borrelia gen-specifika yttre och inre oligonukleotiden primers. Se tabell 1 för primer uppsättningar, deras respektive amplikon storlekar och smälttemperaturer.
Primer namn Gen mål Sekvens (5' - 3') Kopiestorlek Glödgning temperatur
FlaB ut Fw FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB ut husvagn FlaB tggggaacttgattagcctg
FlaB i Fw FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB i Rv FlaB tcattgccattgcagattgt
OspA ut Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA ut Rv OspA caactgctgacccctctaat
OspA i Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA i Rv OspA ttggtgccatttgagtcgta

Tabell 1: Inre och yttre primers för nPCR Borrelia burgdorferiFlaB och OspA.
I praktiken, upptäcka FlaB primers B. burgdorferi s.s. och andra närbesläktade Borrelia genospecies, medan OspA primers fånga endast B. burgdorferi s.s. förstärkning från både loci skulle indikera B. burgdorferi. s.s.

  1. Pre sterilisera en PCR-skåp med UV ljus och 70% etanol.
    Obs: För att minimera potentiella prov kontaminering, denna arbetsyta bör skiljer sig från platsen för tick dissektion, DNA-extraktion, och gel elektrofores.
    1. För den inledande PCR-springa, använda yttre primers i samband med mallen DNA återhämtat sig i steg 1.0 ovan, och ställa in reaktionsblandningen som beskrivs i tabell 2. Parallellt, utföra positiv kontroll körs bestående av verifierade Borrelia DNA, och negativ kontroll körs inklusive nr-mall reaktioner för att upptäcka reagens och aerosol kontaminering. Lägg till DNA i slutet för att minimera potentiella kontamination av reagenser. Se till att varje tub är stängd på alla tider när reagenser läggs inte och Stäng rör omedelbart efter DNA och innan andra rör öppnas.
    2. Programmera en termocykel enligt följande: 95 ° C i 5 min; 40 cykler av 95 ° C under 15 s, glödgning temperatur för 30 s, 72 ° C för 45 s; 72 ° C för 5 min; och håll vid 4 ° C.
  2. Utföra den andra omgången av PCR liknar den första reaktionen, utom använda inre grundfärger med 2 µL av den första PCR-produkten (produceras i 2.2.2).
    Obs: Reaktion volymer igen anges i tabell 2. Var noga med att undvika korskontaminering av amplikoner genom att säkerställa att mallen DNA läggs senast och att endast rör motsvarar ett prov är öppna samtidigt.
     
    Komponent PCR-# 1 volymer PCR-# 2 volymer
    Taq polymeras Master Mix 2 X 12.5 ΜL 12.5 ΜL
    Nuclease-gratis vatten 8,5 ΜL 8,5 ΜL
    10 µM framåt och bakåt grundfärger 1,0 µL yttre grundfärger 1,0 µL inre grundfärger
    DNA-mall 2.0 µL, från prov extraktionen (1.2.7) 2.0 µL, från omgång 1 av PCR (2.2.2)
    Tabell 2: PCR-reaktion blandningar för första och andra kompletteringar.
     
    1. Programmera termocykel som tidigare, men justera glödgning temperaturen för att rymma inre primers (se tabell 1).

3. agaros Gel elektrofores och Imaging

Obs: Grundläggande instruktioner om separera DNA genom elektrofores, se Lee et al., 201234.

  1. Bered en 1,2% agarosgel med 20 X SB buffert (0.2 M NaOH, 0,8 M borsyra pH 8), spädd till 1 X och tillsätt cirka 5 µL av en DNA-fläck, innan du häller, önskas före färgning av gelen.
  2. Ladda 10 µL av produkten från andra (inre) PCR-reaktionen från varje experimentell och kontrollprov, tillsammans med en 100 bp stege (5 µL).
    1. Electrophorese för 1 h 107 V (5V/cm).
  3. Visa och dokumentera gelen med en transilluminator och associerade kamera och programvara.

Representative Results

nPCR är en elegant metod för att öka specificiteten och känsligheten för upptäckt av patogen, särskilt när komplexa miljöprover är under utredning. Som avbildas i figur 1, kan två rundor av PCR inriktning en strategisk region av Borrelia FlaB locus (och OspA, ej på bilden) rapportera förekomsten av Borrelia burgdorferi bakterier genom generering av kort inre amplikoner. När löst med gelelektrofores, kan FlaB och OspA reaktionsprodukterna från varje tick vara visuellt gjorde och jämförde mot kontroller. I figur 2, unika exemplaret identifierare finns längst upp i varje gel, och nr-mall och aerosol kontroller finns representerade längst till vänster och höger, respektive anslutning till stegar.

Robust amplikon band syns tydligt i Välj experimentprover, och de är lätt urskiljas från överskott primers och kvarstående DNA (figur 2). Baserat på experimentell designprinciperna anges, anses en fästing positivt för Borrelia när parallella negativa kontroller visar ingen amplifiering, och inre amplikoner produceras från både FlaB och OspA primers. I detta fall träffade exemplar T907, T604 och T606 övervakning kriterier för Lyme patogenen (figur 2). By Contrast, T923 var bara positivt för OspA, ett resultat som det finns flera möjliga förklaringar: A) fästingen ursprung var negativ för Borrelia, men den yttre eller inre OspA PCR förberedelsen var förevändningar kontaminerat med mall DNA (Observera att systemisk kontamination av reagenser uteslöts via negativa kontroller), B) fästingen buret Borrelia Borrelia, men låg mall belopp eller experimentella fel förhindrade amplifiering av FlaB, eller C) en organism var närvarande som innehöll bevarade OspA sekvensen, men saknade Flagellin eller hade otillräcklig identitet i den berörda regionen FlaB att glödga till primers. Faktiskt, OspA sekvens likheter har noterats i olika organismer, inklusive växter och djur28. Converse situationen, förstärkning av mer bevarad Flagellin genen, men inte OspA genen, kan tyda på en tillhörande Borrelia -art. I praktiken ger detta protokoll mer OspA singel-positiva resultat än gör FlaB primers, tyder på att fallet 'A' är den minst sannolika förklaringen. Utan ytterligare experimentell analys av grälsjukt exemplaret, men går det inte att fastställa källan till singel-positiva resultatet. Öka antalet tekniska replikat utförs på tvetydiga prover kan hjälpa till att förena sin verkliga status, eftersom eventuella föroreningar som introducerades förevändningar till tidigare reaktioner inte skulle vara närvarande i arkiverade DNA. Om efterföljande reaktioner med dessa grundfärger misslyckas att ge entydiga resultat, kunde dock andra Borrelia loci undersökas med PCR. Amplikoner som genereras från dessa reaktioner kan också vara sekvenserade och jämfört bland isolat för att tilldela identitet och uppskatta graden av stam divergens. SAPI och kollegor ger ett exempel på detta arbetsflöde som använder mänskliga kliniska prover35.

Alla faktorer beaktas, kriterierna anges protokollet och tolkning har uppskattats för att ge falskt positiva och falskt negativa räntor på 0,17% och 0,0063%, respektive.

Figure 2
Figur 2 : Detektering av Borrelia burgdorferi i enskilda fästingar av nPCR av FlaB och OspA. Koder som tilldelats varje tick representeras över toppen av gelerna och identiteter justeras vertikalt för att rapportera upptäckt av OspA och FlaB i varje prov. Lanes rätt B till vänster i bilden representerar nr-mall kontroller, medan en (höger körfält) är aerosol kontroller att fånga föroreningar i laboratoriemiljö. Klicka här för att se en större version av denna siffra.

Discussion

Över årtionden av användning, PCR-baserade tekniker har konsekvent visat sitt värde i att upptäcka Borrelia från leddjur och däggdjur exemplar, om Borrelia kommer från miljömässiga eller kliniska ursprung. PCR erbjuder många förbättringar över befintliga metoder för övervakning. Särskilt, det är inte beroende av utvecklingen och resultatet av antikropp reagenser, och istället kan enkelt anpassas för att upptäcka nya mål av intresse helt enkelt genom att ändra primer sekvenser. PCR rymmer också utvärderingen av flera loci parallellt, antingen självständigt eller via en multiplex reaktion. Det kan tillämpas på olika exemplar ingångar, inklusive färska och arkiverade fästingar22, djur och människors kroppsvätskor opererande vävnad25. PCR ger också amplikoner som kan bearbetas vidare, till exempel av restriktionsenzym matsmältningen, sond hybridisering eller sekvensering, att ge ökad insikt i mikrobiell identitet21.

Som kliniska verktyg är PCR begreppsmässigt att föredra att den standard serologisk diagnostiken, eftersom det ger en direkt indikation på bakteriella närvaron, i stället för att förlita sig på värd immunsvar som en sekundär infektion. Lyme borrelios är dock associerade med en relativt blygsam mikrobiell belastning (< 50 organismer/mL urin eller plasma) och övergående spirochetemia, som kan ge upphov till falska negativa resultat25. Känsligheten hos denna teknik i kliniken varierar avsevärt beroende på vävnadstyp av, skede av infektionen och prov tillstånd, faller mellan 12,5% och 62% i befintliga studier av blod, ryggmärgsvätska och biopsier vävnad36. Molekylär känslighet begränsningar är inte en oro om PCR görs efter bakterieodling, men återvinning av livskraftiga spiroketer från kliniska prover har visat på liknande sätt utmanande. Först nyligen har protokoll optimerats för högre avkastning35. Samtidigt kan tarmen hos en infekterad vuxen fästing hamnen i genomsnitt någonstans från 2 000 till över 50.000 Borrelia37,38,39, som är stabilt inom detektionsområdet av nPCR. Protokollet är således väl lämpad att kryssa övervakning ansträngningar.

Trots dess många fördelar utgör nPCR vissa utmaningar och denna teknik förmåga att korrekt rapportera fästing infektion beror därför på strategiska val av gener och amplikoner, noggrann experimentella arbetsflöden som återställa kvalitet DNA från prover samtidigt minimera cross-exponering av prover och användning av lämpliga kontroller som kan rapportera föroreningar i laboratoriemiljö och reagenser. Innan någon experimenterande, bör omfattningen och intentionerna i utredningen tydligt definieras så att lämpliga genregioner och regioner däri, kan väljas. Om syftet är att ge en opartisk skärm för de Lyme-orsakar Borrelia burgdorferi s.l. komplexa, primers bör skapas för att upptäcka alla de associerade stammarna med liknande affinitet och förstärkning effektivitet, utan att fånga icke-närstående organismer25. Nya primers kan utformas och utvärderas i silico med programvaruverktyg som Primer-BLAST40, även om de bör också verifieras experimentellt mot standard referens isolerar innan tillämpas uncharacterized prover. Syftet med förfarandet för DNA-extraktion är att återställa intakt mikrobiell mall från en blandad miljö prov (tick Homogenatet). Ett valfritt steg innan du fortsätter med PCR är att utvärdera integriteten för den extraherade DNA. Dessutom kan parallella reaktioner ställas in att rikta en städning gen i fästingen. Den senare metoden kan också indikera förekomst av inhibitorer i reaktionsblandningen, som ger ökat förtroende att negativa Borrelia reaktioner är på grund av frånvaron av organismen, inte att närvaron av en hämmande föroreningar.

Ökad känslighet av den kapslade PCR-metoden sker på bekostnad av potentiella föroreningar som genererar falskt positiva resultat. Exogena mall kunde introduceras till ett prov under tick dissektion och DNA återhämtning, eller håller på att inrätta de yttre och inre förstärkning reaktionerna. Det är därför särskilt viktigt att följa bästa praxis protokoll för PCR att undvika mall eller amplikon korskontaminering. Dessa inkluderar användning av separata arbetsstationer med oberoende luftflöden, inneslutning i PCR och biologiska säkerhetsbänkar i förekommande fall, grundlig kemisk och fysisk rengöring och sterilisering av ytor och reagenser, och försiktig hantering av DNA 41. nr-mall kontroller är också viktigt att identifiera kontamination av lager reagenser. En särskild sårbarhet i nPCR är ospädd hantering som uppstår när du överför produkter från den första reaktionen i andra PCR-fartyget. Sedan målet DNA har redan genomgått exponentiell anrikning i positiva prover, det här steget är särskilt benägna att korskontaminering och en singel-tube nPCR protokollet har utvecklats för att kringgå denna begränsning. I detta synsätt läggs båda uppsättningarna av primers för en viss gen ihop till en reaktionsröret som är förseglad för båda omgångarna av PCR-31. Yttre och inre primer paren måste vara thermodynamically distinkta, sådan att det yttersta paret förstärker mall vid hög glödgning temperatur som är oöverkomliga för inre primers. I den andra omgången sänks glödgning temperaturen att rymma inre paret. Inte bara gör detta kringgå ett potentiellt störande steg, det tillåter även användning av ytterligare mot kontaminering mäter31,42. Denna ändring kan dock offra vissa analysens känslighet. Oavsett vilken metod hjälper öka antalet tekniska replikat utförs självständigt på ett prov till att identifiera falska kontaminering.

Molekylärbiologiska metoder har fortsatt att utvecklas sedan införandet av nPCR, och dessa nyare metoder erbjuda Välj fördelar jämfört med den ursprungliga mönster, om än på ökade finansiella kostnader. Som namnet antyder, kvantitativ PCR (qPCR eller verklig tid (RT)-PCR) möjliggör uppräkning av patogener i ett prov, medan konventionella tekniker är kvalitativ natur43. Känsligheten för qPCR är enligt uppgift liknar nPCR38, även om det kan variera beroende på primer egenskaper28. En variant av qPCR som använder molekylär fyrar (MB) i stället för konventionella TaqMan sonder har också visat lovande resultat i att upptäcka Borrelia i kliniska prover44,45,46. Tack vare deras unika sekundära struktur producera molekylär fyrar enligt uppgift lägre bakgrund fluorescens och högre legitima signaler, vilket ger överlägsen känslighet47. Prekliniska utvärderingar tyder på en potentiell upptäckt tröskel på mellan en och tio spiroketer44,45. Dessutom har tekniken tillämpats framgångsrikt i multiplex reaktioner att samtidigt upptäcka ett däggdjur värd gen44 och andra fästingburna patogener45, vilket inte är lika lätt kan uppnås med nPCR. Andra designändringar inkluderar droplet digital PCR (ddPCR)-teknik, som kan kvantifiera DNA utan användning av en standardkurva39,48. Nedre gränsen för upptäckt av denna teknik för Borrelia är jämväl omkring tio spiroketer/prov39. Jämfört med nPCR, har dessa metoder också fördelen med minskad risk för kontaminering, eftersom de bara kräver ett enda förstärkning protokoll.

Om syftet med övervakning är istället att profilera varierad bakteriella innehållet i en fästing, är 16S rRNA gjorts screening ett attraktivt alternativ49. Även om detta tillvägagångssätt är dyrare, kräver specialiserade DNA sequencers hittades inte i alla molekylärbiologiska laboratorier och kräver mer sofistikerade bioinformatik-baserade tolkning, kan det fånga ett brett spektrum av mikrober till mer exakt representera den patogen belastningen av vektorn.

QPCR och dess derivat är metoder för val av kvantitativa applikationer, och metagenomik skärmar ger bred inventeringar av den tickande microbiom, angå riktad övervakning ansträngningar ofta med binära rapportering av närvaro eller frånvaro av en eller ett fåtal patogener i en vektor. Under sådana omständigheter kan dessa nyare, mer genomarbetade metoder införa onödig komplexitet och ekonomisk börda i processen. Av dessa skäl har nPCR motstått tid som en avgörande teknik i tick testning.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Författarna vill tacka Kami Harris för primer design, Ashley McKibbon och Jessica Thomas-Engström för att filma, och John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck och Rosie hunden för förekommer i den video. A. M. K. stöddes av den kanadensiska Lyme Disease Research Foundation, och finansieringen tillhandahölls av de naturliga vetenskaperna och Engineering Research rådet av Kanada (NSERC). M. K. B. W. fick lön finansiering från New Brunswick Innovation Foundation (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics