Author Produced

Opdage Lyme sygdom Spirochete, Borrelia Burgdorferi, i flåter bruge indlejrede PCR

Biology
 

Summary

Indlejrede PCR er en følsom, specifikke og enkel teknik, der kan anvendes på kryds DNA ekstrakter til at probe for Borrelia burgdorferi, det agens af Lyme sygdom. Den første PCR eksperiment bruger gen-specifikke primere til at generere lang amplikoner, som derved bliver skabeloner for en efterfølgende reaktion ved hjælp af interne primere.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lyme sygdom er en alvorlig vektor-bårne infektion, der er forårsaget af Borrelia burgdorferi sensu lato familie af spirokæter, der overføres til mennesker gennem bid af inficerede Ixodes flåter. Den primære ætiologiske agent i Nordamerika er Borrelia burgdorferi i snæver forstand. Som geografisk risiko regioner udvide, er det fornuftigt at støtte robust overvågning programmer, der kan måle kryds smittespredningen, og kommunikere resultaterne til klinikere, dyrlæger og den brede offentlighed. Den molekylære teknik af indlejrede polymerase kæde reaktion (nPCR) har længe været anvendt til dette formål, og det er fortsat en central, billig og robust tilgang i påvisning af Borrelia i både flåter og dyreliv.

I denne artikel demonstreres anvendelsen af nPCR til at krydse DNA ekstrakter til at identificere inficerede prøver. To uafhængige B. burgdorferi mål, gener kodning Flagellin B (FlaB) og ydre overflade protein A (OspA), har været brugt i udstrakt grad med denne teknik. Protokollen indebærer kryds indsamling, DNA-ekstraktion og derefter en indledende runde af PCR til at opdage hver af de to Borrelia-specifikke loci. Efterfølgende Polymerasekædereaktionen (PCR) bruger produktet af den første reaktion som en ny skabelon til at generere mindre, indre forstærkning fragmenter. Den indlejrede tilgang forbedrer både specificitet og sensitivitet af konventionelle PCR. Et kryds betragtes positivt for patogenet, når indre amplikoner fra både Borrelia gener kan påvises ved agarosegelelektroforese gelelektroforese.

Introduction

Lyme sygdom (LD) er den mest udbredte vektor-bårne infektion i den nordlige halvkugle, og dens forekomst fortsætter med at stige1. Denne invaliderende sygdom er forårsaget af spirocheteal patogener af det Lyme borreliose (LB) kompleks (ofte refereret til som Borrelia burgdorferi sensu lato eller s.l.), som historisk set omfatter de dominerende nordamerikanske patogen, B. burgdorferi i snæver forstand (rustfast), B. afzelii og B. garinii, som er udbredt i hele Europa og Asien, og arter af nye kliniske relevans2,3. Disse bakterier overføres til mennesker gennem bid af inficerede Ixodes flåter2. Selvom de vigtigste nordamerikanske vektorer I. scapularis og I. pacificus, har flere arter i denne slægt fundet til havnen og overføre bakterien4. Hos mennesker, kan B. burgdorferi forårsage multisystemisk symptomer, der påvirker huden, led, hjerte, nervesystemet, endokrine kirtler, mave-tarmkanalen og indre organer5,6,7, 8,9,10. Center for Disease Control og forebyggelse vurderer i øjeblikket over 300.000 nye tilfælde hvert år i USA11,12. Mens prognosen er ofte gunstige, når sygdommen er diagnosticeret og behandlet i de tidlige stadier, har undersøgelser antydet, at et sted mellem 10% og 60% af patienter, der modtog den anbefalede antibiotika regime fortsat med at opleve symptomer efter behandling ophør, betegnes i et fænomen indlæg behandling Lyme Disease syndrom (PTLDS)13,14,15. Derudover kan der opstå forsinkelser i klinisk intervention som følge af manglende bevidsthed om flåtbid, ikke-specifik præsentation af den oprindelige sygdom og lav følsomhed af traditionelle serologi-baseret diagnostik anvendes ved udbrud af infektion. Undladelse af at behandle hurtigt og korrekt gør det symptom progression, der kan manifestere sig i stigende grad invaliderende komplikationer16,17. Lyme sygdomsforebyggelse er derfor en af hjørnestenene i risikostyring. Strategier til at bekæmpe denne voksende trussel omfatter robust overvågningsforanstaltninger for at angive patogen udbredelsen i skovflåter og identificere geografiske regioner giver anledning til bekymring.

Denne artikel viser nytten af indlejrede polymerase kæde reaktion (nPCR) som en molekylær screeningsværktøj til at identificere inficerede flåter. For at øge specificitet, bruges to Borrelia gener for parallel forstærkning. Flagellin B (FlaB) koder en større glødetrådens protein fimrehår18, og genet er placeret på indre lineær kromosomet, mens lipoprotein produkt af ydre overflade protein A (OspA) medierer kryds midgut kolonisering, og er plasmid-kodede19,20. Arbejdsgangen består af kryds indsamling, DNA-ekstraktion og derefter en indledende runde af PCR til påvisning af Borrelia-specifikke loci. Efterfølgende PCR bruger produktet af den første reaktion som en ny skabelon til at generere mindre, indre forstærkning fragmenter. Et tick er betragtes som positive for Borrelia burgdorferi når indre amplikoner fra både Borrelia gener kan påvises ved agarosegelelektroforese gelelektroforese.

NPCR teknik, og FlaB - og OspA gen mål, har været meget anvendt til økologisk overvågning og kliniske påvisning af Lyme spirochete siden begyndelsen 1990s21,22,23 ,24,25. Forud for udviklingen af molekylære protokoller, blev flåter vurderet ved at underkaste gut indholdet anti -Borrelia immunofluorescens (IF) farvning, mikrobiel kultur, eller en kombination heraf26. Disse tilgange lider under iboende begrænsninger, herunder langsom vækst og kræsen karakter af Borrelia27, antistof ydelsesproblemer, og kravet om live flåter til hvis forarbejdning21. PCR blev efterfølgende vedtaget for at yde hurtig, følsom og specifik identifikation af inficerede vektorer. Det udbydes markante forbedringer i den traditionelle metode, herunder kultur-uafhængig direkte anvendelse til forskellige modellen typer, såsom døde og arkiverede flåter, der ellers ville være uegnet til at teste21,22 . Indlejrede eksperimentelle design yderligere forbedre specificiteten og følsomheden af klassisk PCR ved at ansætte to forskellige sæt af gen-specifikke primere i to på hinanden følgende runder af forstærkning25,28.

Eksperimentelle succes er helt afhængig af strategiske gen udvælgelse og amplikon design. Du kan præcist vurdere tilstedeværelsen af Borrelia burgdorferi, skal primere registrere de relevante patogener uden krydsreagerende med recidiverende feber spirokæter også i Borrelia slægten. I tilfælde af FlaBopnås denne specificitet ved at målrette en variabel interne region af genet, snarere end de relativt bevaret flankerende sekvenser, der deles af forskellige bakterier (figur 1)24,29 , 30.

Figure 1
Figur 1: begrebet nPCR, som illustreret ved hjælp af Borrelia FlaB gen som mål. 5' og 3' termini af genet er fælles for organismer uden for Borrelia burgdorferi s.l., rendering disse regioner uegnet til den konkrete vurdering af Lyme-forårsager patogener. Bruger de mindre-bevaret indvendige sekvenser som primer mål, er to runder af PCR udført for at opdage en endelige, interne amplikon. Venligst klik her for at se en større version af dette tal.

I en test af deres diskriminerende kapacitet, blev indvendige FlaB primere evalueret med over 80 forskellige Borrelia isolater, og fandt for at identificere kun dem der er forbundet med borreliose24. Lavere detektionsgrænse af nPCR er blevet dokumenteret på mellem seks24 og ti31 bakterier fra ren kultur, selv om følsomheden kan forbedres yderligere ved det sydlige blotting amplikonen og hybridizing en radioaktive eller kemiluminescens sonde. Kobling teknikker nedsætter påvisningsgrænsen til en enkelt spirochete31. Ved direkte sammenligning, blev konventionelle, unprobed single-runde PCR fundet til at rapportere tilstedeværelsen af et minimum af 104 spirokæter31. Det skal bemærkes, at analysen følsomhed bliver lavere, når du arbejder med komplekse miljø og kliniske prøver, på grund af den overvældende tilstedeværelse af uafhængige DNA og mulige hæmmende stoffer. Disse udfordringer kan i vid udstrækning omgås ved hjælp af nPCR.

Trods fremskridt inden for Molekylær teknologier i de seneste årtier, er nPCR stadig en korte teknik i moderne overvågning indsats. Hvis pleje er taget i design og udførelse af denne protokol, er det en kraftfuld, fleksible og forholdsvis ligetil tilgang til fange tilstedeværelsen af patogener i kryds vektorer.

Protocol

1. DNA isoleret fra flåter

  1. Erhverve flåter via feltsamlingen eller passiv overvågning fra dyrlæger og medlemmer af offentligheden. Flåter bør dræbt ved nedfrysning, anbringes i en forseglet pose, og sendt ved stuetemperatur.
    1. Ved hjælp af en Sendeformular, indsamle oplysninger om dato og geografisk placering af møde, kryds vedhæftet fil status, vært arter og rejse historik af værten.
    2. Da indlejrede PCR er i sagens natur sårbare over for forurening, sikre, at laboratoriet arbejdsområdet er indstillet til at minimere cross-eksponering af prøver. Dette indebærer udfører forskellige elementer i protokollen i separat, dedikeret rum godt isoleret fra hinanden, som er grundigt rengjort og steriliseret, og at sikre, at alle instrumenter er fri for forurenende stoffer.
    3. Efter modtagelse af prøven, fotografere kryds og bestemme arter, udviklingsstadiet, sex og overfyldning status ved sammenligning til en identifikation nøgle32 .
    4. Under aseptiske forhold, gennemskære kryds ved hjælp af en steril barberblad eller skalpel og placere to kryds fragmenter i separate microcentrifuge rør.
  2. For at udtrække samlede DNA, bruge enhver isolation procedure, der giver PCR-kompatibel skabelon; denne protokol viser en simpel Chelat-baseret tilgang.
    1. Begynder ved at tilføje et passende volumen (ofte mellem 50-200 µL) en lytisk kelation reagens til kryds fragment. Det specifikke beløb afhænger af modellen størrelse og overfyldning status; retningslinjer bør være leveret af producenten. Der homogeniseres ved hjælp af en microtube pistil.
    2. Inkuber prøver i et vandbad ved 60 ° C i 45 min, og vortex kort.
    3. Der centrifugeres prøver i 4 min på 16,276 x g (13,300 rpm) i en desktop microcentrifuge.
    4. Overføre supernatanten til en frisk, mærket microtube indeholdende 50 µL isopropanol, mix af inversion, og igen centrifugeres i (1.2.3).
    5. Den dekanteres, og skyl DNA pelleten med 50 µL af 70% ethanol.
    6. Fjern overskydende ethanol med en pipette, og tillade pellet blive tør til 15 min ved stuetemperatur.
    7. Resuspend DNA, tilsæt 50 µL af 1 mM Tris pH 7,0 og inkuberes prøver i et bad med vand i 1 timer ved 60 ° C. DNA kan nu opbevares ved-20 ° C for fremtidige Molekylær analyse.

2. indlejret PCR påvisning af Borrelia OspA og FlaB.

Bemærk: En oversigt over generelle PCR principper og praksis tilbydes af Lorenz, 201233.

  1. Syntetisere eller få Borrelia gen-specifikke ydre og indre oligonukleotid primere. Se tabel 1 for primer sæt, deres respektive amplikon størrelser og smeltende temperaturer.
Primer navn Gen mål Rækkefølge (5' - 3') Amplikon størrelse Udglødning temperatur
FlaB ud Fw FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB ud Rv FlaB tggggaacttgattagcctg
FlaB i Fw FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB i Rv FlaB tcattgccattgcagattgt
OspA Out Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA Out Rv OspA caactgctgacccctctaat
OspA i Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA i Rv OspA ttggtgccatttgagtcgta

Tabel 1: Indre og ydre primere for nPCR af Borrelia burgdorferiFlaB og OspA.
I praksis FlaB primere opdage B. burgdorferi s.s. og andre nært beslægtede Borrelia genospecies, mens OspA primere fange kun B. burgdorferi s.s. forstærkning fra begge loci tyder B. burgdorferi. s.s.

  1. Pre sterilisere en PCR kabinet med UV lys og 70% ethanol.
    Bemærk: For at minimere potentielle prøve forurening, dette arbejdsområde bør være adskilt fra placeringen af aksemærker dissektion, DNA-ekstraktion og gel elektroforese.
    1. For den første PCR køre, skal du bruge de ydre primere sammen med skabelonen DNA inddrives i trin 1,0 ovenfor, og konfigurere reaktionsblanding som beskrevet i tabel 2. Parallelt, udføre positiv kontrol løber bestående af verificerede Borrelia DNA, og negativ kontrol løber herunder no-skabelon reaktioner for at opdage reagens og aerosol forurening. Tilføje DNA i slutningen at minimere risikoen for kontaminering af reagenser. Sikre hver tube er lukket på alle tidspunkter, når reagenser ikke bliver tilføjet og lukke rør umiddelbart efter DNA, og før andre rør er åbnet.
    2. Programmere en termisk cycler som følger: 95 ° C i 5 min; 40 cyklusser af 95 ° C til 15 s, udglødning temperaturen til 30 s, 72 ° C i 45 s; 72 ° C i 5 min; og hold ved 4 ° C.
  2. Udføre den anden runde af PCR ligner den første reaktion, bortset fra at bruge indre primere med 2 µL af den første PCR produkt (produceret i 2.2.2).
    Bemærk: Reaktion mængder leveres igen i tabel 2. Skal sørges for at undgå krydskontaminering af amplikoner sikrer at template DNA er tilføjet sidst og at kun rør svarer til en stikprøve er åbne på en gang.
     
    Komponent PCR # 1 bind PCR # 2 bind
    Taq-Polymerase Master Mix 2 X 12,5 ΜL 12,5 ΜL
    Nukleasen-frit vand 8,5 ΜL 8,5 ΜL
    10 µM forward og Reverse primere 1,0 µL ydre primere 1,0 µL indre primere
    DNA-skabelon 2.0 µL af prøven udvinding (1.2.7) 2.0 µL, fra runde 1 af PCR (2.2.2)
    Tabel 2: PCR reaktion blandinger for første og anden forstærkninger.
     
    1. Programmere den termiske cycler som før, men tilpasse den udgloedning temperatur for at imødekomme de indre primere (se tabel 1).

3. agarosegel elektroforese og billedbehandling

Bemærk: Grundlæggende instruktioner på adskiller DNA ved elektroforese, se Lee mfl., 201234.

  1. Forberede en 1,2% agarosegel ved hjælp af 20 X SB buffer (0.2. M NaOH, 0,8 M borsyre pH 8) fortyndes til 1 X, og tilføje ca 5 µL af en DNA pletten, før hælde, hvis forudgående farvning af gelen ønskes.
  2. Indlæse 10 µL af produktet fra den anden (indre) PCR reaktion fra hver eksperimentelle og kontrolprøve, sammen med en 100 bp stige (5 µL).
    1. Electrophorese for 1 h på 107 V (5V/cm).
  3. Se og dokumentere gel ved hjælp af et transilluminator og tilknyttede kamera og software.

Representative Results

nPCR er en elegant metode til at øge specificiteten og følsomheden af påvisning af patogener, især når komplekse miljøprøver er omfattet af undersøgelsen. Afbilledet i figur 1, kan to runder af PCR rettet mod en strategisk region af Borrelia FlaB locus (og OspA, ikke afbilledet) rapportere tilstedeværelsen af Borrelia burgdorferi bakterier gennem generation af korte indre amplikoner. Når løst ved gelelektroforese, kan reaktionsprodukter FlaB og OspA fra hvert kryds visuelt scorede og sammenlignet med kontrol. I figur 2, unikke eksemplar identifikatorer leveres langs toppen af hver gel, og no-skabelon og aerosol kontrolelementer er repræsenteret længst til venstre og højre, henholdsvis, støder op til stiger.

Robust amplikon bands er klart synlig i Vælg eksperimentelle prøver, og de kan let skelnes fra overskydende primere og resterende DNA (figur 2). Baseret på de eksperimentelle designprincipper fastsat, betragtes en kryds som positive for Borrelia når parallelle negative kontroller viser ingen forstærkning, og indre amplikoner fremstillet af både FlaB og OspA primere. I dette tilfælde mødte enheder, T907, T604 og T606 overvågning kriterier for Lyme patogen (figur 2). By Contrast, T923 var kun positiv for OspA, et resultat, hvor der er flere mulige forklaringer: A) krydse af oprindelse var negativ for Borrelia, men den ydre eller indre OspA PCR forberedelse var spuriously forurenet med skabelon DNA (Bemærk, at systemisk kontaminering af reagenser var udelukket via negative kontroller), B) kryds båret Lyme Borrelia, men lave skabelon beløb eller eksperimentelle fejl forhindrede forstærkning af FlaB, eller C) en organisme var til stede der indeholdt de bevarede OspA sekvens, men manglede Flagellin eller havde utilstrækkelig identitet i regionen målrettede FlaB at anneal til primere. Faktisk, OspA sekvens ligheder er konstateret i en række forskellige organismer, herunder planter og dyr28. Converse situation, forstærkning af mere bevaret Flagellin gen, men ikke OspA -genet, kunne tyde en relaterede Borrelia arter. I praksis giver denne protokol mere OspA single-positive resultater end gør FlaB primere, tyder på, at scenario» A» er den mindst sandsynlige forklaring. Uden yderligere eksperimentel analyse af den omstridte modellen, men er det ikke muligt at fastslå kilden til single-positive resultat. Øge antallet af tekniske replikater udføres på tvetydige prøver kan bidrage til at forene deres sande status, da kontaminanter, der indførtes spuriously tidligere reaktioner ikke vil være til stede i den arkiverede DNA. Hvis efterfølgende reaktioner med disse primere undlader at give afgørende resultater, kunne andre Borrelia loci undersøges ved PCR. Amplikoner genereret fra disse reaktioner kunne også sekventeret og forhold mellem isolater til at tildele identitet og vurdere graden af stammen divergens. SAPI og kolleger giver et eksempel på denne arbejdsproces ved hjælp af humane kliniske prøver35.

Alle faktorer i betragtning, de skitserede protokol og fortolkning kriterier er blevet anslået til at give falsk positive og falsk negative vækstrater på 0,17% og 0.0063%, henholdsvis.

Figure 2
Figur 2 : Påvisning af Borrelia burgdorferi i enkelte flåter af nPCR af FlaB og OspA. Koder tildelt hvert kryds er repræsenteret på tværs af toppen af geler, og identiteter justeres lodret for at rapportere påvisning af OspA og FlaB i hver prøve. Baner ret B til venstre på billedet repræsenterer ingen-skabelon kontrol, mens en (højre hånd baner) er aerosol kontrolelementer til at fange kontaminering i laboratoriemiljø. Venligst klik her for at se en større version af dette tal.

Discussion

I årtier af brug, PCR-baserede teknikker har konsekvent bevist deres værdi i påvisning af Borrelia fra leddyr og pattedyr prøver, om Borrelia kommer fra miljøet eller kliniske oprindelse. PCR tilbyder mange forbedringer over eksisterende tilgange til overvågning. Især, det er ikke afhængige af udviklingen og udførelsen af antistof reagenser, og i stedet kan let tilpasses til at opdage nye mål af interesse blot ved at ændre primer sekvenser. PCR kan også rumme evaluering af flere loci parallelt, enten selvstændigt eller via en multiplex reaktion. Det kan anvendes til forskellige modellen indgange, herunder friske og arkiverede flåter22, dyr eller humane kropsvæsker og resektion væv25. PCR udbytter også amplikoner, der kan blive yderligere behandlet, for eksempel ved begrænsning enzym fordøjelse, sonde hybridisering eller rækkefølge, for at give øget indsigt i mikrobiel identitet21.

Som et klinisk værktøj er PCR begrebsmæssigt at foretrække frem for den standard serologiske diagnosticering, da det giver en direkte angivelse af bakteriel tilstedeværelse, snarere end at lægge på vært immunrespons som en sekundær foranstaltning af infektion. Men borreliose er forbundet med en relativt beskeden mikrobielle belastning (< 50 organismer/mL urin eller plasma) og forbigående spirochetemia, som kan give anledning til falsk negative resultater25. Følsomheden i denne teknik på klinikken varierer betydeligt afhængigt af vævstype, fase af infektion, og prøven betingelse, falder mellem 12,5% og 62% i eksisterende undersøgelser af blod, cerebrospinalvæske og biopsi væv36. Molekylær følsomhed begrænsninger er ikke en bekymring hvis PCR er foretaget efter bakteriekulturen, men inddrivelse af levedygtige spirokæter fra klinisk prøvemateriale har vist sig på samme måde udfordrende. Først for nylig har protokoller været optimeret til højere udbytte35. I mellemtiden, tarmen af en inficeret voksen kryds kan havnen i gennemsnit overalt fra 2.000 til over 50.000 Borrelia37,38,39, som er solidt inden for rækkevidden af nPCR. Således, at protokollen er velegnet til kryds overvågning indsats.

Trods sine mange fordele udgør nPCR visse udfordringer, og denne teknik evne til præcist rapportere kryds infektion afhænger derfor af strategiske udvalg af gener og amplikoner, omhyggelig eksperimentelle arbejdsprocesser, der gendanne kvalitet DNA fra prøver samtidig minimere cross-eksponering af prøver og anvendelse af passende kontrol, der kan rapportere forurenende stoffer i laboratoriemiljø og reagenser. Forud for enhver eksperimenter, bør anvendelsesområde og hensigter af undersøgelsen klart defineres, så relevante genetiske loci og regioner deri, kan vælges. Hvis målet er at give en uvildig skærmen for Lyme-forårsager Borrelia burgdorferi s.l. komplekse, primere skal oprettes for at opdage alle de tilknyttede stammer med lignende affinitet og forstærkning effektivitet, uden at indfange uafhængige organismer25. Nye primere kan udformes og vurderes i siliciummangan med softwareværktøjer som Primer-BLAST40, selv om de også skal valideres eksperimentelt mod standardreference isolerer før anvendes til uncharacterized prøver. Målet med ekstraktionsprocedure DNA er at inddrive intakt mikrobielle skabelon fra en blandet miljømæssige prøve (kryds homogenatet). Et valgfrit trin, før du fortsætter med PCR er at evaluere integriteten af det ekstraherede DNA. Derudover kan parallelle reaktioner sættes op til at målrette en husholdning gen i kryds. Sidstnævnte metode kan også indikere tilstedeværelsen af hæmmere i reaktionsblandingen, giver øget tillid til, negativ Borrelia reaktioner er på grund af mangel af organismen og ikke til tilstedeværelsen af en hæmmende forurenende.

Den øgede følsomhed indlejrede PCR-metodens kommer på bekostning af potentielle forurening, der genererer falsk-positive resultater. Eksogene skabelon kunne blive introduceret til en prøve under kryds dissektion og DNA opsving eller etableringen af ud- og indvendig forstærkning reaktioner. Det er derfor især vigtigt at følge bedste praksis protokoller for PCR at undgå skabelon eller amplikon krydskontaminering. Disse omfatter brug af separate arbejdsstationer med uafhængige luftmængder, indeslutning i PCR og biologiske sikkerhed kabinetter eventuelt grundig kemiske og fysiske rengøring og sterilisering af overflader og reagenser, og forsigtig håndtering af DNA 41. nej-skabelon kontrol er også afgørende at identificere kontaminering af stock reagenser. En særlig sårbarhed i nPCR er amplikon håndteringen, der opstår ved overførsel af varer fra den første reaktion i den anden PCR fartøj. Da målet DNA har allerede gennemgået eksponentielle berigelse i positive prøver, dette trin er især udsat for kontaminering, og en enkelt-tube nPCR protokol er blevet udviklet for at omgå denne begrænsning. I denne tilgang føjes begge sæt primere for et givent gen sammen til en reaktion-rør, der forbliver lukket for begge runder af PCR31. De ydre og indre primer par skal være termodynamisk forskellige, således at de ydre par forstærker skabelon ved høj udgloedning temperatur, der er uoverkommelige for de indre primere. I anden runde sænkes udglødning temperaturen til at rumme de interne par. Ikke alene betyder dette omgå et potentielt forstyrrende skridt, det også tillader brug af yderligere mod kontaminering måler31,42. Men denne ændring kan ofre nogle assay følsomhed. Uanset tilgang, vil øge antallet af tekniske replikater udføres uafhængigt på en prøve hjælpe med at identificere falske forurening.

Molekylære teknikker har fortsat med at udvikle sig siden indførelsen af nPCR, og disse nyere tilgange tilbyde vælge fordele i forhold til de oprindelige design, omend på øgede finansielle omkostninger. Som navnet antyder, kvantitativ PCR (qPCR eller real tid (RT)-PCR) giver mulighed for tælling af patogener i en prøve, mens konventionelle teknikker er kvalitativ karakter43. Følsomheden af qPCR er angiveligt svarer til nPCR38, selv om det kan variere afhængigt af primer egenskaber28. En variation af qPCR, der bruger molekylære beacons (MB) i stedet for konventionelle TaqMan sonder har også vist lovende i påvisning af Borrelia i kliniske prøver44,45,46. På grund af deres unikke sekundær struktur producere Molekylær beacons angiveligt lavere baggrund fluorescens og højere legitime signaler, hvilket giver overlegen følsomhed47. Prækliniske evalueringer tyder på en potentiel påvisningsgrænse af mellem et og ti spirokæter44,45. Teknikken har desuden været anvendt med succes i multiplex reaktioner på samtidig opdager et pattedyr vært gen44 og andre skovflåtbåren patogener45, der er ikke så let opnåelige med nPCR. Andre design ændringer omfatter droplet digital PCR (ddPCR) teknologi, der kan kvantificere DNA uden brug af en standardkurve39,48. Lavere detektionsgrænse af denne teknik for Borrelia er ligeledes omkring ti spirokæter/prøve39. I forhold til nPCR, har disse tilgange også fordel af reducerede risikoen for forurening, da de kræver kun en enkelt forstærkning protokol.

Hvis formålet med overvågningen er i stedet at profilere varieret bakteriel indholdet af en kryds, er 16S rRNA metagenomic screening en attraktiv mulighed49. Selv om denne tilgang er dyrere, kræver specialiseret DNA sequencere ikke fundet i alle molekylærbiologiske laboratorier og nødvendiggør mere sofistikerede Bioinformatik-baserede fortolkning, kan det fange et bredt spektrum af mikrober til mere præcist repræsentere patogen belastningen af vektoren.

Mens qPCR og derivater er metoder til valg af kvantitative applikationer, og metagenomics skærme giver brede fortegnelser over kryds microbiome, beskæftiger målrettet overvågning indsats ofte sig med binære rapportering af tilstedeværelse eller fravær af én eller et par patogener i en vektor. Under sådanne omstændigheder kan disse nyere, mere omfattende tilgange indfører unødvendig kompleksitet og finansielle byrde i processen. Af disse grunde, har nPCR modstået tidens som en afgørende teknik i kryds test.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Forfatterne vil gerne takke Kami Harris for primer design, Ashley McKibbon og Jessica Thomas-Ebbett til at filme, og John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck og Rosie hund for opført i den video. A. M. K. blev støttet af den canadiske Lyme Disease Research Foundation, og projektstøtte blev leveret af Natural Sciences and Engineering Research Rådet i Canada (NSERC). M. K. B. W. modtaget løn finansiering fra New Brunswick Innovation Foundation (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics