Author Produced

Opsporen van de ziekte van Lyme-spirocheet, Borrelia Burgdorferi, in teken met behulp van genestelde PCR

Biology
JoVE Journal
Biology
AccessviaTrial
 

Summary

Genestelde PCR is een eenvoudig, gevoelige en specifieke techniek die kan worden toegepast op de teek die DNA geëxtraheerd om sonde voor Borrelia burgdorferi, de verwekker van de ziekte van Lyme. De eerste PCR experiment maakt gebruik van gen-specifieke primers voor het genereren van lange waarbij, die vervolgens worden sjablonen voor een latere reactie met behulp van interne inleidingen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K. B., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ziekte van Lyme is een ernstige vectoren overgedragen infectie die wordt veroorzaakt door de Borrelia burgdorferi sensu lato familie van spirocheten, die worden overgebracht via de beet van de geïnfecteerde Ixodes -teken op de mens. Het primaire etiologische agens in Noord-Amerika wordt Borrelia burgdorferi sensu stricto. Als geografische risico gebieden uit te breiden, is het verstandig om ondersteuning van robuuste toezicht-programma's die kunnen meten teek infectie tarieven, en bevindingen communiceren clinici, dierenartsen en het grote publiek. De moleculaire techniek van geneste polymerase-kettingreactie (nPCR) heeft lange tijd gebruikt voor dit doel, en het blijft een centraal, goedkope en robuuste aanpak in het opsporen van Borrelia in zowel de teken en de natuur.

Dit artikel demonstreert de toepassing van nPCR op Vink DNA fragmenten te identificeren van besmette exemplaren. Twee onafhankelijke B. burgdorferi getarget, genen coderen Flagellin B (FlaB) en Outer surface EiwitA (OspA), zijn uitgebreid gebruikt met deze techniek. Het protocol omvat teek collectie, het DNA-extractie en vervolgens een eerste ronde van PCR te sporen elk van de twee Borrelia-specifieke loci. Latere polymerase-kettingreactie (PCR) maakt gebruik van het product van de eerste reactie als een nieuwe sjabloon voor het genereren van kleinere, interne versterking fragmenten. De geneste benadering verbetert zowel de gevoeligheid en specificiteit van conventionele PCR. Een teek wordt beschouwd als positief voor het pathogene agens oplevert wanneer innerlijke waarbij van beide genen Borrelia kan worden gedetecteerd door agarose gelelektroforese.

Introduction

Ziekte van Lyme (LD) is de meest voorkomende vectoren overgedragen infectie op het noordelijk halfrond, en de frequentie blijft toenemen van1. Deze slopende ziekte wordt veroorzaakt door spirocheteal pathogenen van de Lyme borreliose (LB) complexe (kortweg Borrelia burgdorferi sensu lato, of s.l.), die historisch gezien het overheersende Noordamerikaanse pathogene agens, B. omvat burgdorferi sensu stricto (s.s), naast B. afzelii en B. garinii, die algemeen verspreid in Europa en Azië, en soorten klinische relevantie2,3in opkomst zijn. Deze bacteriën worden overgedragen op de mens door de beet van de geïnfecteerde Ixodes teken2. Hoewel de belangrijkste Noord-Amerikaanse vectoren I. scapularis en I. pacificus, meerdere soorten binnen dit geslacht gevonden voor haven en doorgeven van de bacterie-4. Bij de mens kan de B. burgdorferi Multisysteem symptomen op het gebied van de huid, gewrichten, hart, zenuwstelsel, endocriene klieren, gastro-intestinale tractus en inwendige organen5,6,7, 8,9,10. Het Center for Disease Control and Prevention schat momenteel meer dan 300.000 nieuwe gevallen bij de mens jaarlijks in de Verenigde Staten11,12. Terwijl de prognose is vaak gunstig wanneer de ziekte is gediagnostiseerd en behandeld in de vroege stadia, hebben studies gesuggereerd dat ergens tussen 10% en 60% van de patiënten die ontvangen de aanbevolen antibiotische regime blijven symptomen na therapie beëindiging, in een verschijnsel genoemd Post behandeling ziekte van Lyme syndroom (PTLDS)13,14,15. Bovendien, vertragingen in klinische interventie kunnen ontstaan als gevolg van gebrek aan bewustzijn van de beet van een teek, niet-specifieke presentatie van de eerste ziekte, en de lage gevoeligheid van traditionele serologie gebaseerde diagnostiek wanneer gebruikt aan het begin van de infectie. Falen om snel en adequaat te behandelen kan symptoom progressie die manifesteren kan in toenemende mate invaliderende complicaties16,17. Preventie van de ziekte van Lyme is dus een hoeksteen van het risicobeheer. Strategieën ter bestrijding van deze groeiende dreiging robuuste toezichtmaatregelen om aan te geven van de prevalentie van het pathogene agens in teken bevatten en identificeren van de geografische regio's van belang.

Dit artikel demonstreert het nut van geneste polymerase-kettingreactie (nPCR) als een moleculaire screening tool voor het identificeren van besmette teken. Het vergroten van specificiteit, worden twee Borrelia genen gebruikt voor parallelle versterking. Flagellin B (FlaB) codeert een grote gloeidraad proteïne van het flagellum18, en het gen ligt op het enkele lineaire chromosoom, terwijl het lipoproteïne product van de buitenste oppervlakte EiwitA (OspA) teek middendarm bemiddelt kolonisatie, en is van de plasmide-gecodeerde19,20. De werkstroom bestaat uit de collectie van de teek, DNA-extractie, waarna een eerste ronde van PCR te detecteren van Borrelia-specifieke loci. Latere PCR maakt gebruik van het product van de eerste reactie als een nieuwe sjabloon voor het genereren van kleinere, interne versterking fragmenten. Een teek wordt als positief beschouwd voor Borrelia burgdorferi wanneer innerlijke waarbij van beide genen Borrelia kan worden gedetecteerd door agarose gelelektroforese.

Zowel de nPCR techniek, en de FlaB en OspA gene doelen, zijn grote schaal gebruikt voor de ecologische bewaking en klinische opsporing van de Lyme-spirocheet sinds de vroege jaren 199021,22,23 ,24,25. Voorafgaand aan de ontwikkeling van moleculaire protocollen, werden teken onderzocht door gut inhoud te onderwerpen aan anti -Borrelia immunofluorescentie (IF) kleuring, microbiële cultuur of een combinatie daarvan26. Deze benaderingen lijden aan inherente beperkingen, met inbegrip van de trage groei en kieskeurig aard van Borrelia27antilichaam prestatieproblemen en de eis van levende teken voor als verwerking21. PCR werd vervolgens aangenomen om snelle, gevoelige en specifieke identificatie van besmette vectoren. Het aangeboden duidelijke verbeteringen over de traditionele methode, met inbegrip van de directe toepassing van de cultuur-zelfstandige op uiteenlopende specimen typen, zoals dode en gearchiveerde teken dat anders ongeschikt zijn zou voor het testen van21,22 . Geneste experimentele designs verder verbeteren door gebruik te maken van twee verschillende sets van gen-specifieke primers in twee opeenvolgende ronden van versterking25,28op de specificiteit en de gevoeligheid van klassieke PCR.

Experimentele succes is kritisch afhankelijk van strategische gene selectie en amplicon ontwerp. Voor het nauwkeurig inschatten van de aanwezigheid van Borrelia burgdorferi, zouden de inleidingen de desbetreffende ziekteverwekkers detecteren zonder cross-reacting met relapsing fever spirocheten ook in het geslacht Borrelia . In het geval van FlaB, wordt deze specificiteit bereikt door zich te richten een variabele interne regio van het gen, in plaats van de relatief geconserveerde flankeren de opeenvolgingen die worden gedeeld door diverse bacteriën (Figuur 1)24,29 , 30.

Figure 1
Figuur 1: het concept van nPCR, zoals geïllustreerd met behulp van Borrelia FlaB gen als een doelwit. De 5' en 3' termini van het gen gelden voor organismen dan Borrelia burgdorferi s.l., waardoor deze regio's niet geschikt zijn voor de specifieke beoordeling van Lyme-veroorzakende ziekteverwekkers. Met behulp van de minder-geconserveerd interieur sequenties als primer doelen, worden twee rondes van PCR uitgevoerd om te detecteren een finale, interne amplicon. Klik hier voor een grotere versie van dit cijfer.

In een test van hun discriminerende capaciteit, werden interieur FlaB inleidingen geëvalueerd met meer dan 80 verschillende Borrelia -isolaten, en gevonden om te identificeren alleen die verband houden met de ziekte van Lyme24. De onderste detectiegrens van nPCR is gedocumenteerd op zes24 à tien31 bacteriën uit reincultuur, hoewel de gevoeligheid kan verder worden verbeterd door Southern blotting van de amplicon en kwekers een radioactief gelabelde of chemiluminescentie sonde. Koppeling van de technieken reduceert de drempel detectie tot een enkele spirocheet31. Door directe vergelijking, werd conventionele, unprobed single-ronde PCR gevonden voor het melden van de aanwezigheid van een minimum van 104 spirocheten31. Opgemerkt moet worden, echter dat assay gevoeligheid lager zijn zal bij het werken met complexe milieumonsters en klinische monsters, als gevolg van de overweldigende aanwezigheid van niet-verwante DNA en potentiële remmende stoffen. Deze uitdagingen kunnen grotendeels worden omzeild door het gebruik van nPCR.

Ondanks de vooruitgang in moleculaire technologieën in de afgelopen decennia blijft nPCR een nietje techniek in modern toezicht inspanningen. Als zorg is genomen in het ontwerp en de uitvoering van dit protocol, is het een relatief eenvoudig, krachtige en flexibele benadering te vangen van de aanwezigheid van ziekteverwekkers in teek vectoren.

Protocol

1. DNA isolatie van teken

  1. Teken via veld-collectie of passieve bewaking van dierenartsen en leden van het publiek te verwerven. Teken moeten worden gedood door bevriezing, geplaatst in een verzegelde zak en gemaild bij kamertemperatuur.
    1. Met behulp van een verzendformulier, verzamelen informatie over de datum en de geografische locatie van de ontmoeting, status van de bijlage van de teek, host soorten en recente geschiedenis van de reizen van de host.
    2. Aangezien genestelde PCR inherent kwetsbaar voor besmetting is, er voor zorgen dat de laboratorium-werkruimte is ingesteld om te minimaliseren van de Kruis-blootstelling van monsters. Dit omvat het uitvoeren van de verschillende elementen van het protocol in aparte, specifieke ruimten goed geïsoleerd van elkaar, die grondig zijn gereinigd en gesteriliseerd, en ervoor te zorgen dat alle instrumenten zijn vrij van verontreinigingen.
    3. Na ontvangst van het model, de teek fotograferen en bepalen van de soorten, ontwikkelingsstadium, seks en de status van de congestie in vergelijking tot een identificatie sleutel32 .
    4. De teek met een steriele scheermesje of scalpel bisect onder aseptische condities, en plaats de twee teek fragmenten in aparte microcentrifuge buizen.
  2. Om totale DNA, gebruikt elke isolatie-procedure dat de opbrengst van de PCR-compatibele sjabloon; Dit protocol toont een eenvoudige chelatie gebaseerde benadering.
    1. Beginnen met het toevoegen van een passende omvang (vaak tussen de 50-200 µL) van een reagens lytische chelatie naar het fragment van de teek. Het specifieke bedrag zal afhangen van de specimen grootte en congestie status; richtsnoeren moeten worden verstrekt door de fabrikant. Meng met behulp van een stamper microtube.
    2. Incubeer monsters in een waterbad bij 60 ° C voor 45 min, en vortex kort.
    3. Centrifugeer steekproeven voor 4 min 16,276 x g (13,300 rpm) in een desktop microcentrifuge.
    4. Supernatant overbrengen in een frisse, gelabelde microtube met 50 µL isopropanol, Meng door inversie, en opnieuw Centrifugeer zoals (1.2.3).
    5. De bovendrijvende vloeistof decanteren, en spoel de DNA-pellet met 50 µL van 70% ethanol.
    6. Verwijderen van de overtollige ethanol met een pipet, en laat de pellet te drogen gedurende 15 minuten bij kamertemperatuur.
    7. Resuspendeer DNA, voeg 50 µL van 1 mM Tris pH 7.0 en incubeer monsters in een waterbad gedurende 1 uur bij 60 ° C. Het DNA kan nu worden opgeslagen bij-20 ° C voor toekomstige moleculaire analyse.

2. genestelde PCR detectie van Borrelia OspA en FlaB.

Opmerking: Een overzicht van de algemene principes van PCR en praktijken worden verstrekt door Lorenz, 201233.

  1. Synthetiseren of Borrelia gen-specifieke uiterlijke en innerlijke oligonucleotide inleidingen te verkrijgen. Zie tabel 1 voor primer sets, hun respectieve amplicon maten en smeltende temperaturen.
De naam van de primer Gene Target Volgorde (5' - 3') Amplicon grootte Onthardende temperatuur
FlaB uit Fw FlaB gcatcactttcagggtctca 503 bp 55° C
FlaB uit Rv FlaB tggggaacttgattagcctg
FlaB In Fw FlaB ctttaagagttcatgttggag 447 bp 58° C
FlaB In Rv FlaB tcattgccattgcagattgt
OspA Out Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA Out Rv OspA caactgctgacccctctaat
OspA In Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA In Rv OspA ttggtgccatttgagtcgta

Tabel 1: Binnenste en buitenste inleidingen voor nPCR van Borrelia burgdorferiFlaB en OspA.
In de praktijk de FlaB inleidingen detecteren B. burgdorferi s.s. en andere nauw aanverwante Borrelia -genospecies, terwijl OspA inleidingen alleen B. burgdorferi s.s. vangen versterking van beide loci wijzen op B. burgdorferi. s.s.

  1. Vooraf steriliseren een PCR-kast met UV licht en 70% ethanol.
    Opmerking: Om te minimaliseren van potentiële verontreiniging van de steekproef, deze werkruimte moet worden onderscheiden van de locatie van de teek dissectie, DNA-extractie, en gel elektroforese.
    1. Voor de eerste PCR uitvoeren, door de buitenste inleidingen te gebruiken in combinatie met de sjabloon DNA hersteld in stap 1.0 hierboven, en het opzetten van het reactiemengsel zoals beschreven in tabel 2. In parallel, uitgevoerd door positieve controle uitgevoerd bestaande uit gecontroleerde Borrelia DNA, en negatieve controle wordt uitgevoerd met inbegrip van neen-template reacties op te sporen van besmetting reagens en spuitbussen. DNA toevoegen aan het eind om te minimaliseren van de potentiële verontreiniging van reagentia. Controleer dat elke buis is helemaal gesloten tijden wanneer reagentia worden niet toegevoegd en sluit buizen onmiddellijk na toevoeging van DNA en voordat andere buizen worden geopend.
    2. Een thermische cycler als volgt programmeren: 95 ° C gedurende 5 minuten; 40 cycli van 95 ° C voor 15 s, onthardende temperatuur voor 30 s, 72 ° C gedurende 45 s; 72 ° C gedurende 5 minuten; Houd bij 4 ° C.
  2. Het uitvoeren van de tweede ronde van PCR vergelijkbaar met de eerste reactie, behalve inner inleidingen gebruiken met 2 µL van het eerste PCR product (geproduceerd in punt 2.2.2).
    Opmerking: Reactie volumes opnieuw vindt u in tabel 2. Zorg moet worden genomen om te voorkomen van kruisbesmetting van waarbij door ervoor te zorgen dat sjabloon DNA toegevoegd laatste en enige buizen die betrekking hebben op een steekproef zijn open op een moment.
     
    Component PCR # 1 Volumes PCR # 2 Volumes
    Taq Polymerase Master Mix 2 X 12.5 ΜL 12.5 ΜL
    Nuclease-gratis Water 8,5 ΜL 8,5 ΜL
    10 µM forward en Reverse inleidingen 1,0 µL buitenste Primers 1,0 µL innerlijke Primers
    DNA-sjabloon 2.0 µL, bij voorbeeld winning (1.2.7) 2.0 µL, van ronde 1 van PCR (2.2.2)
    Tabel 2: PCR reactie mengsels voor eerste en tweede amplifications.
     
    1. Programma van de thermische cycler als voorheen, maar passen de onthardende temperatuur zodat de binnenste inleidingen (zie tabel 1).

3. Agarose Gel elektroforese en beeldvorming

Opmerking: Zie voor basisinstructies DNA scheiden door elektroforese, Lee et al.., 201234.

  1. Bereiden een 1,2% agarose gel met 20 X SB buffer (0,2 M NaOH, pH van 0,8 M-boorzuur 8), verdund tot 1 X, en voeg ongeveer 5 µL van een DNA-vlek, vóór het gieten, desgewenst vooraf kleuring van de gel is.
  2. 10 µL van het product van de tweede (binnenste) PCR reactie van elk experimenteel en controlemonster, naast een 100 bp ladder (5 µL) laden.
    1. Electrophorese gedurende 1 uur bij 107 V (5V/cm).
  3. Bekijken en vastleggen van de gel met een transilluminator en de bijbehorende camera en de software.

Representative Results

nPCR is een elegante aanpak te verhogen de specificiteit en de gevoeligheid van de detectie van de ziekteverwekker, met name wanneer complexe milieu monsters onderzocht worden. Zoals afgebeeld in Figuur 1, kunnen twee rondes van PCR gericht op een strategische regio van de Borrelia FlaB locus (en OspA, niet afgebeeld) de aanwezigheid van de bacterie Borrelia burgdorferi door middel van het genereren van korte inner melden waarbij. Wanneer opgelost door elektroforese van het gel, kunnen de FlaB en OspA reactieproducten van elke teek visueel scoorde en vergeleken met de besturingselementen. In Figuur 2, unieke exemplaar-id vindt u langs de bovenkant van elke gel, en neen-template en aërosol besturingselementen zijn vertegenwoordigd helemaal links en rechts, respectievelijk, grenzend aan de ladders.

Robuuste amplicon bands zijn duidelijk zichtbaar in select experimentele monsters, en ze zijn gemakkelijk onderscheiden van overtollige primers en resterende DNA (Figuur 2). Gebaseerd op de beginselen van de proefopzet uiteengezet, een teek wordt als positief beschouwd voor Borrelia wanneer parallelle negatieve controles tonen geen versterking, en innerlijke waarbij zijn vervaardigd uit zowel FlaB en OspA inleidingen. In dit geval voldaan exemplaren T907, T604 en T606 aan toezicht criteria voor het Lyme-pathogeen (Figuur 2). By contrast, T923 was alleen positief voor OspA, een uitkomst waarvoor er meerdere mogelijke verklaringen zijn: A) de teek van oorsprong was negatief voor Borrelia, maar de buitenste of binnenste OspA PCR voorbereiding onecht besmet was met sjabloon DNA (merk op dat systemische besmetting van reagentia werd uitgesloten via negatieve controles), B) de teek die Lyme Borrelia, maar lage sjabloon bedragen of experimentele fout voorkwam versterking van FlaB, of C) een organisme aanwezig was die bevatte de geconserveerde OspA -reeks, maar miste Flagellin of onvoldoende identiteit in het gerichte gebied van FlaB te ontharden aan de inleidingen had. Inderdaad, OspA reeks overeenkomsten hebben opgemerkt in een verscheidenheid van organismen, met inbegrip van planten en dieren28. De omgekeerde situatie, versterking van de meer bewaard Flagellin gen, maar niet het OspA -gen, kan duiden op een Borrelia soorten. In de praktijk levert dit protocol meer OspA single-positieve resultaten dan de FlaB primers, suggereert dat scenario 'A' de minst waarschijnlijke verklaring is. Zonder verdere experimentele analyse van het omstreden model, echter is het niet mogelijk om de bron van het single-positieve resultaat te bepalen. Verhoging van het aantal technische replicatieonderzoeken uitgevoerd op monsters die zijn dubbelzinnig kan helpen met elkaar te verzoenen hun werkelijke status, omdat eventuele verontreinigingen die onecht werden ingevoerd om de vorige reacties zou niet in de gearchiveerde DNA aanwezig. Echter als volgende reacties met deze inleidingen niet afdoende resultaten opleveren, kunnen andere loci Borrelia door PCR worden onderzocht. Waarbij gegenereerd op basis van deze reacties kunnen ook worden sequenced en vergeleken tussen isolaten bij het toewijzen van identiteit, en de raming van de mate van divergentie van de stam. SAPI en collega's bieden een voorbeeld van deze workflow met menselijke klinische monsters35.

Alle factoren rekening gehouden, de geschetste protocol en interpretatie criteria zijn geraamd aan opbrengst van valse positieve en valse negatieve tarieven van 0,17% en 0.0063%, respectievelijk.

Figure 2
Figuur 2 : Detectie van Borrelia burgdorferi in individuele teken door nPCR van FlaB en OspA. Codes die zijn toegewezen aan elke teek worden weergegeven aan de bovenkant van de gels en identiteiten om te melden het opsporen van OspA en FlaB in elk monster verticaal uitlijnen. Rijstroken recht B aan de linkerkant van de besturingselementen voor afbeeldingen vertegenwoordigen neen-template, terwijl een (rechterhand rijstroken) aërosol besturingselementen te vangen van de besmetting van de labo-omgeving. Klik hier voor een grotere versie van dit cijfer.

Discussion

Tientallen jaren van gebruik, PCR-gebaseerde technieken hebben consequent bewezen hun waarde in de opsporing van Borrelia van geleedpotigen en zoogdieren specimens, of Borrelia milieu- of klinische oorsprong vandaan. PCR biedt vele verbeteringen over reeds bestaande benaderingen van toezicht. Met name, het is niet afhankelijk van de ontwikkeling en prestaties van antilichaam reagentia, en in plaats daarvan kan gemakkelijk worden aangepast om op te sporen nieuwe doelstellingen van belang gewoon door aanpassing van de primer sequenties. PCR herbergt ook de evaluatie van meerdere loci parallel, zelfstandig of via een multiplex-reactie. Het kan worden toegepast op diverse specimen ingangen, met inbegrip van vers en gearchiveerde teken22, dier of mens lichaamsvloeistoffen en weefsel gereseceerd25. PCR levert ook waarbij dat verder kan worden verwerkt, bijvoorbeeld door restrictie-enzym spijsvertering, sonde hybridisatie of sequencing, toegenomen inzicht in microbiële identiteit21.

Als een klinische hulpmiddel is PCR conceptueel beter dan de standaard serologische diagnostiek, want het biedt een directe indicatie van bacteriële aanwezigheid, in plaats van te vertrouwen op de immuunrespons van de gastheer als een secundaire maatregel van infectie. Lyme Borreliose is echter geassocieerd met een relatief bescheiden microbiële lasten (< 50 organismen/mL urine of plasma) en tijdelijke spirochetemia, die aanleiding tot vals-negatieve geven kan resultaten25. De gevoeligheid van deze techniek in de kliniek varieert afhankelijk van het weefseltype, fase van de infectie en monster voorwaarde, valt, ergens tussen 12,5% en 62% in bestaande studies van bloed, cerebrospinale vloeistof en biopsied weefsel36. Moleculaire gevoeligheid beperkingen zijn niet een bron van zorg als PCR wordt uitgevoerd na de bacteriële cultuur, maar herstel van levensvatbare spirocheten uit klinische monsters ook uitdagende heeft bewezen. Pas onlangs protocollen zijn geoptimaliseerd voor hogere opbrengst35. Ondertussen, de darm van een geïnfecteerde volwassen teek kan haven gemiddeld overal vanaf 2.000 naar meer dan 50.000 Borrelia37,38,39, die stevig binnen het detectiebereik van nPCR. Het protocol is dus zeer geschikt voor teek toezicht inspanningen.

Ondanks de vele voordelen levert nPCR bepaalde uitdagingen, en het vermogen van deze techniek om nauwkeurig verslag teek besmetting is daarom afhankelijk van strategische selectie van genen en waarbij, nauwgezette experimentele werkstromen die kwaliteit DNA herstellen van specimens terwijl het minimaliseren van de Kruis-blootstelling van monsters, en het gebruik van passende besturingselementen die verontreinigingen in de testomgeving en reagentia kunt melden. Voorafgaand aan elke experimenten, moeten de reikwijdte en de bedoelingen van het onderzoek duidelijk worden omschreven zodat passende genetische loci, en regio's kunnen daarin, worden geselecteerd. Als het doel is om een onbevooroordeelde scherm voor de complexe veroorzaakt door Lyme Borrelia burgdorferi -s.l., inleidingen moeten worden gemaakt om alle van de bijbehorende spanningen met soortgelijke affiniteit gedetecteerd en versterking efficiëntie, zonder vastleggen die geen verband houden organismen25. Nieuwe inleidingen kunnen worden ontworpen en beoordeeld in silico met behulp van softwaretools zoals Primer-BLAST40, hoewel zij ook experimenteel moeten worden gevalideerd tegen standaard referentie isoleert voordat het wordt toegepast op de genfunctieonderzoek monsters. Het doel van de DNA-extractiemethode is te herstellen intact microbiële sjabloon van een gemengd milieu monster (teek homogenaat). Een optionele stap voordat u verdergaat met PCR is het evalueren van de integriteit van het geëxtraheerde DNA. Bovendien kunnen parallelle reacties worden ingesteld te richten een huishouden-gen in de teek. Deze laatste methode kan ook wijzen op de aanwezigheid van remmers in het reactiemengsel, bieden meer vertrouwen wordt gesteld dat negatieve reacties van de Borrelia te wijten aan de afwezigheid van het organisme, en niet op de aanwezigheid van een remmende verontreinigingen zijn.

De verhoogde gevoeligheid van de geneste PCR aanpak gaat ten koste van potentiële verontreiniging die vals-positieve resultaten oplevert. Exogene sjabloon kan worden ingevoerd om een steekproef tijdens teek dissectie en DNA herstel, of bij de oprichting van de uiterlijke en innerlijke amplificatie reacties. Daarom is het vooral belangrijk te volgen beste praktijken protocollen voor PCR om te voorkomen dat de sjabloon of amplicon kruisbesmetting. Voorbeelden hiervan zijn het gebruik van aparte werkplekken met onafhankelijke luchtstromen, insluiting in PCR en biologische veiligheid kasten in voorkomend geval, grondige chemische en fysieke reiniging en sterilisatie van oppervlakken en reagentia, en voorzichtige behandeling van DNA 41. No-template besturingselementen zijn ook essentieel bij het identificeren van de besmetting van de voorraad reagentia. Een bijzondere kwetsbaarheid van nPCR is de amplicon behandeling die optreedt bij het overbrengen van de producten van de eerste reactie in het tweede schip van de PCR. Aangezien de doelDNA heeft al ondergaan exponentiële verrijking in positieve monsters, deze stap is met name gevoelig voor kruisbesmetting en een single-buis nPCR protocol is ontwikkeld om het omzeilen van deze beperking. In deze benadering worden beide reeksen inleidingen voor een bepaald gen samen aan een reactiebuis die gesloten voor beide rondes van PCR31 blijfttoegevoegd. De uiterlijke en innerlijke primerparen moet thermodynamisch distinct, zodanig dat de buitenste paar versterkt sjabloon bij een hoge onthardende temperatuur dat is onbetaalbaar voor de innerlijke inleidingen. In de tweede ronde, wordt de onthardende temperatuur verminderd aan de interne paar. Niet alleen is dit een potentieel storende stap overslaan, het maakt ook het gebruik van extra anti-besmetting maatregelen31,42. Deze wijziging kan echter de gevoeligheid van sommige assay offeren. Ongeacht de benadering, zal verhoging van het aantal technische replicatieonderzoeken onafhankelijk van elkaar uitgevoerd op een monster bijdragen tot het identificeren van valse besmetting.

Moleculaire technieken zijn verder ontwikkeld sinds de invoering van nPCR en deze nieuwere benaderingen select voordelen ten opzichte van de originele ontwerpen, bieden zij bij verhoogde financiële lasten. Zoals de naam al suggereert, kwantitatieve PCR (qPCR of real time (RT)-PCR) voorziet in de opsomming van ziekteverwekkers in een steekproef, terwijl conventionele technieken kwalitatief van aard,43 zijn. De gevoeligheid van qPCR is naar verluidt vergelijkbaar met die van nPCR38, hoewel het afhankelijk van de primer kenmerken28kan fluctueren. Een variatie van qPCR die gebruikmaakt van moleculaire beacons (MB) in plaats van conventionele TaqMan sondes heeft ook aangetoond belofte in het opsporen van Borrelia in klinische monsters44,45,46. Vanwege hun unieke secundaire structuur produceren moleculaire bakens naar verluidt lagere achtergrond fluorescentie en hogere legitieme signalen, waardoor superieure gevoeligheid47. Pre-klinische evaluaties suggereren een mogelijke drempel van de detectie van tussen één en tien spirocheten44,45. Bovendien is de techniek met succes toegepast in multiplex reacties op gelijktijdig detecteren een zoogdieren host gene44 en andere Frühsommer meningo ziekteverwekkers45, die is niet zo gemakkelijk haalbaar met nPCR. Andere ontwerp wijzigingen omvatten droplet digitale PCR (ddPCR) technologie, die DNA zonder het gebruik van een standaard curve39,48 kwantificeren kan. De onderste detectiegrens van deze techniek voor Borrelia is eveneens ongeveer tien spirocheten/monster39. Vergeleken met nPCR, hebben deze benaderingen ook het voordeel van verminderde mogelijkheden voor besmetting, zoals zij alleen een interne versterking-protocol vereisen.

Als het doel van toezicht in plaats daarvan is te profileren van de gevarieerde bacteriële inhoud van een teek, is 16S rRNA metagenomic screening een aantrekkelijke optie49. Hoewel deze benadering duurder is, gespecialiseerde DNA sequencers niet gevonden in alle laboratoria van de moleculaire biologie vereist en verfijnder bioinformatics gebaseerde interpretatie vergt, kan het een breed spectrum van microben meer nauwkeurig vangen vertegenwoordigen de pathogen belasting van de vector.

Terwijl qPCR en derivaten daarvan methoden van keuze voor kwantitatieve toepassingen zijn en metagenomics schermen grote voorraden van de microbiome van de teek leveren, gerichte bewaking inspanningen gaat vaak met binaire rapportage van de aanwezigheid of afwezigheid van een of een paar ziekteverwekkers in een vector. Onder dergelijke omstandigheden kunnen deze nieuwere, meer uitgebreide benaderingen onnodige complexiteit en financiële lasten indienen in het proces. Om deze redenen heeft nPCR doorstaan de tand des tijds als een centrale techniek in de teek testen.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs bedank Kami Harris voor primer design, Ashley McKibbon en Jessica Thomas-Ebbett voor het filmen, en John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck en Rosie de hond voor het verschijnen het video. A. M. K. werd gesteund door de Canadese Lyme Disease Research Foundation, en projectfinanciering werd verstrekt door de Natural Sciences and Engineering Research Raad van Canada (NSERC). M. K. B. W. ontvangen salaris financiering uit de New Brunswick innovatie Foundation (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics