Author Produced

Rilevare il malattia di Lyme Spirochete, Borrelia Burgdorferi, in segni di graduazione utilizzando la PCR annidata

Biology
 

Summary

Nested PCR è una tecnica sensibile, specifica e semplice che può essere applicata a tick che DNA estratti per sonda per Borrelia burgdorferi, l'agente eziologico della malattia di Lyme. L'esperimento PCR iniziale utilizza gli iniettori di gene-specific per generare ampliconi lunghi, che poi diventano modelli per una successiva reazione utilizzando primers interna.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wills, M. K., Kirby, A. M., Lloyd, V. K. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR. J. Vis. Exp. (132), e56471, doi:10.3791/56471 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Malattia di Lyme è una grave infezione trasmesse da vettori che è causata dalla Borrelia burgdorferi sensu lato famiglia delle spirochete, che vengono trasmessi all'uomo attraverso la puntura delle zecche Ixodes infette. L'agente eziologico primario in Nord America è Borrelia burgdorferi sensu stricto. Come espandono regioni rischio geografico, è prudente sostenere programmi di sorveglianza robusto che possono misurare i tassi di infezione tick e comunicare i risultati clinici, veterinari e il pubblico in generale. La tecnica molecolare della reazione a catena annidata della polimerasi (nPCR) lungo è stata utilizzata per questo scopo, e rimane un approccio centrale, economico e robusto nella rilevazione di Borrelia in segni di graduazione e la fauna selvatica.

Questo articolo viene illustrato l'applicazione del nPCR a spuntare gli estratti di DNA per identificare gli esemplari infetti. Due indipendente destinato a b. burgdorferi , geni codifica B flagellina (ciccia) e proteina di superficie esterno A (OspA), sono stati ampiamente utilizzati con questa tecnica. Il protocollo coinvolge tick raccolta, estrazione del DNA e poi un giro iniziale di PCR per rilevare tutte le due Borrelia-loci specifici. Successivi catena della polimerasi (PCR) utilizza il prodotto della prima reazione come un nuovo modello per generare frammenti di amplificazione interna, più piccola. L'approccio nidificato migliora la specificità e la sensibilità della PCR convenzionale. Un segno di spunta viene considerato positivo per l'agente patogeno quando interna ampliconi di entrambi i geni Borrelia possono essere rilevato tramite l'elettroforesi del gel dell'agarosi.

Introduction

Malattia di Lyme (LD) è l'infezione di vettore-sopportata più diffusa nell'emisfero settentrionale, e la sua incidenza continua ad aumentare di1. Questa malattia debilitante è causata da agenti patogeni spirocheteal della borreliosi di Lyme (LB) complesso (comunemente come lato di sensu di burgdorferi di Borrelia , o s.l.), che comprende storicamente predominante patogeno nordamericano, B. burgdorferi sensu stricto (s.s.), oltre a b. afzelii e b. garinii, che sono diffuse in tutta Europa e Asia e sono specie della emergente rilevanza clinica2,3. Questi batteri vengono trasmessi all'uomo attraverso il morso di infetti Ixodes battiti2. Anche se i principali vettori nordamericani sono scapularis I. e I. pacificus, specie multiple all'interno di questo genere sono stati trovati per harbor e trasmettere il batterio4. In esseri umani, b. burgdorferi può causare sintomi di sistema multiplo che interessa la pelle, articolazioni, cuore, sistema nervoso, ghiandole endocrine, tratto gastrointestinale e organi interni5,6,7, 8,9,10. Il Center for Disease Control and Prevention stima attualmente oltre 300.000 nuovi casi umani annualmente negli Stati Uniti11,12. Mentre la prognosi è spesso favorevole quando la malattia è diagnosticata e trattata nelle fasi iniziali, gli studi hanno suggerito che ovunque tra 10% e il 60% dei pazienti che hanno ricevuto i dosaggi raccomandati di antibiotico ha continuato ad avvertire i sintomi dopo la terapia cessazione, in un fenomeno definito Post trattamento malattia di Lyme sindrome (PTLDS)13,14,15. Inoltre, possono verificarsi ritardi nell'intervento clinico a causa della mancanza di consapevolezza di un morso del battito, la presentazione non specifica della malattia iniziale e la bassa sensibilità della tradizionale basato su sierologia diagnostica quando utilizzato all'inizio dell'infezione. Fallimento per trattare rapidamente e in modo appropriato consente la progressione di sintomo che può manifestarsi in sempre più debilitanti complicazioni16,17. Prevenzione della malattia di Lyme è pertanto un elemento fondamentale della gestione del rischio. Strategie per combattere questa minaccia crescente includono misure di sorveglianza robusto per indicare la prevalenza del patogeno in segni di graduazione e identificano regioni geografiche di preoccupazione.

Questo articolo dimostra l'utilità della reazione a catena annidata della polimerasi (nPCR) come strumento di screening molecolare da cui identificare zecche infette. Per aumentare la specificità, due geni di Borrelia sono utilizzati per l'amplificazione parallelo. B flagellina (ciccia) codifica per una proteina del filamento principale del flagello18, e il gene è localizzato sul cromosoma lineare singolo, mentre il prodotto della lipoproteina di proteina di superficie esterno A (OspA) media del midgut tick colonizzazione, è codificato in plasmide19,20. Il flusso di lavoro è costituito da tick raccolta, estrazione del DNA e poi un giro iniziale di PCR per rilevare Borrelia-loci specifici. PCR successive utilizza il prodotto della prima reazione come un nuovo modello per generare frammenti di amplificazione interna, più piccola. Un segno di spunta viene considerato positivo per Borrelia burgdorferi quando interna ampliconi di entrambi i geni Borrelia possono essere rilevato tramite l'elettroforesi del gel dell'agarosi.

Sia la tecnica nPCR e la ciccia e OspA geni bersaglio, è stati ampiamente usati per sorveglianza ecologica e rilevazione clinica dello spirochete Lyme dal primi anni 199021,22,23 ,24,25. Prima dello sviluppo di protocolli molecolari, le zecche sono state valutate sottoponendo la gut contenuto anti -Borrelia colorazione di immunofluorescenza (IF), coltura microbica o una loro combinazione26. Questi approcci soffrono di limitazioni inerenti, compreso la crescita lenta e la natura fastidiosa di Borrelia27, problemi di prestazioni dell'anticorpo e il requisito di segni di graduazione diretta per se elaborazione21. PCR è stata successivamente adottata per fornire l'identificazione veloce, sensibile e specifica di vettori infetti. Ha offerto miglioramenti notevoli sopra la metodologia tradizionale, compresa la coltura-indipendente diretta applicazione per tipi di campioni diversi, quali zecche morte e archiviati che altrimenti sarebbero inadatti per il test21,22 . Disegni sperimentali nidificati ulteriormente migliorano la specificità e la sensibilità della PCR classica impiegando due insiemi distinti di iniettori di gene-specific in due turni consecutivi di amplificazione25,28.

Sperimentale successo dipende criticamente dalla design di selezione e amplicon di gene strategico. Per stimare con precisione la presenza di Borrelia burgdorferi, primer dovrebbe rilevare gli agenti patogeni rilevanti senza grado di reagire con la spirocheta di febbre di ricaduta anche nel genere Borrelia . Nel caso di ciccia, questa specificità è ottenuta prendendo di mira una regione interna variabile del gene, piuttosto che le sequenze fiancheggianti relativamente conservate che sono condivisi da diversi batteri (Figura 1)24,29 , 30.

Figure 1
Figura 1: il concetto di nPCR, come illustrato utilizzando Borrelia ciccia gene come bersaglio. Stazione termini 5' e 3' del gene sono comuni per gli organismi di là di Borrelia burgdorferi s.l., rendering di queste regioni non idonei per la valutazione specifica degli agenti patogeni che causano Lyme. Utilizzando le sequenze interne conservati meno di target primer, due cicli di PCR vengono eseguiti per rilevare un amplicone finale, interno. Clicca qui per visualizzare una versione più grande di questa figura.

In una prova della loro capacità discriminatoria, interni FlaB primer sono stati valutati con più di 80 diversi isolati di Borrelia e trovato per identificare solo quelli associati con la malattia di Lyme24. Il limite inferiore di rilevamento del nPCR è stato documentato presso tra sei24 e dieci31 batteri da coltura pura, anche se la sensibilità può essere ulteriormente migliorata mediante Southern blotting amplicon e ibridando un radiomarcato o sonda a chemiluminescenza. Le tecniche di accoppiamento riduce la soglia di rilevamento a un singolo spirochete31. Tramite il confronto diretto, PCR con un unico arrotondamento convenzionale, inesplorata è stato trovato per segnalare la presenza di un minimo di 104 spirocheta31. Dovrebbe essere notato, tuttavia, che la sensibilità del test sarà inferiore quando si lavora con campioni ambientali e clinici complessi, a causa della presenza schiacciante di DNA estraneo e potenziali sostanze inibitorie. Queste sfide possono essere aggirate in gran parte dall'utilizzo di nPCR.

Malgrado gli avanzamenti nelle tecnologie molecolari negli ultimi decenni, nPCR rimane una tecnica fiocco in sforzi di sorveglianza moderna. Se la cura nella progettazione e nell'esecuzione del presente protocollo, è un approccio relativamente semplice, potente e adattabile per catturare la presenza di agenti patogeni in vettori di graduazione.

Protocol

1. DNA isolamento da zecche

  1. Acquisire le zecche via campo insieme o sorveglianza passiva da veterinari e membri del pubblico. Zecche dovrebbero essere ucciso da congelamento, inserite in un sacchetto sigillato e spedite a temperatura ambiente.
    1. Utilizzando un modulo di presentazione, raccogliere informazioni sulla data e la posizione geografica dell'incontro, lo stato di attaccamento tick, specie ospite e storia recente viaggio dell'host.
    2. Poiché la PCR annidata è intrinsecamente vulnerabile alla contaminazione, assicurarsi che l'area di lavoro di laboratorio è impostato per minimizzare la croce-esposizione dei campioni. Ciò comporta l'esecuzione di diversi elementi del protocollo in spazi separati, dedicati ben isolati da altro sono accuratamente puliti e sterilizzati, e garantire che tutti gli strumenti sono prive di sostanze contaminanti.
    3. Dopo aver ricevuto l'esemplare, fotografare il segno di spunta e determinare la specie, Stadio di sviluppo, sesso e stato di congestione in confronto a un'identificazione chiave32 .
    4. In condizioni asettiche, bisecare il segno di spunta utilizzando una lama di rasoio sterile o bisturi e inserire i frammenti di due segni di graduazione in microcentrifuga separato.
  2. Per estrarre il DNA totale, utilizzare qualsiasi procedura di isolamento che produce il modello di PCR-compatibile; Questo protocollo viene illustrato un semplice approccio basato su chelazione.
    1. Inizia aggiungendo un volume adeguato (spesso tra 50-200 µ l) di un reagente litico chelazione per il frammento di segni di graduazione. L'importo specifico dipenderà molto lo stato di dimensione e ingorgo esemplare; linee guida dovrebbero essere fornite dal produttore. Omogeneizzare con un pestello di Conetti.
    2. Incubare i campioni in un bagno di acqua a 60 ° C per 45 min e vortexare brevemente.
    3. Centrifugare i campioni per 4 min a 16.276 x g (13.300 giri/min) in una microcentrifuga desktop.
    4. Trasferire il surnatante in una fresca, con etichetta microprovetta contenente 50 µ l isopropanolo, mix di inversione e ri-Centrifugare come in (1.2.3).
    5. Decantare il supernatante e sciacquare la pallina di DNA con 50 µ l di etanolo al 70%.
    6. Eliminare l'etanolo in eccesso con una pipetta e lasciar asciugare all'aria per 15 min a temperatura ambiente il pellet.
    7. Risospendere il DNA, aggiungere 50 µ l di 1 mM a Tris pH 7.0 e incubare i campioni in un bagno di acqua per 1 h a 60 ° C. Ora, il DNA può essere conservato a-20 ° C per future analisi molecolari.

2. nested PCR Detection di OspA Borrelia e ciccia.

Nota: Una panoramica dei generali principi PCR e pratiche è fornita da Lorenz, 201233.

  1. Sintetizzare o ottenere iniettori del oligonucleotide di interni ed esterni di gene-specifico di Borrelia . Vedere la tabella 1 per set di primer, loro rispettivi amplicone dimensioni e temperature di fusione.
Nome di primer Gene bersaglio Sequenza (5' - 3') Dimensione del amplicon Temperatura di annealing
Ciccia su Fw Ciccia gcatcactttcagggtctca 503 bp 55° C
Ciccia su Rv Ciccia tggggaacttgattagcctg
Ciccia nel Fw Ciccia ctttaagagttcatgttggag 447 bp 58° C
Ciccia In Rv Ciccia tcattgccattgcagattgt
OspA Out Fw OspA cttgaagttttcaaagaagat 487 bp 55° C
OspA Out Rv OspA caactgctgacccctctaat
OspA nel Fw OspA acaagagcagacggaaccag 350 bp 58° C
OspA In Rv OspA ttggtgccatttgagtcgta

Tabella 1: Primer interno ed esterno per nPCR di Borrelia burgdorferiFlaB e OspA.
In pratica, i primer di ciccia rilevare B. burgdorferi s.s. e altri strettamente correlati Borrelia genospecies, mentre gli iniettori OspA catturano solo b. burgdorferi s.s. amplificazione da entrambi loci indicherebbe B. burgdorferi. s.s.

  1. Pre-sterilizzare un armadietto PCR con UV luce e 70% di etanolo.
    Nota: Per minimizzare la potenziale contaminazione del campione, questa area di lavoro deve essere distinta dalla posizione della dissezione di tick, estrazione del DNA ed elettroforesi del gel.
    1. Per l'esecuzione iniziale di PCR, è possibile utilizzare il primer esterno in combinazione con il modello DNA recuperato nel passaggio 1.0 sopra e impostata la miscela di reazione, come descritto nella tabella 2. In parallelo, eseguire positivo controllo esegue composto verificato Borrelia DNA e controllo negativo esegue incluse reazioni no-modello per rilevare la contaminazione del reagente e aerosol. Aggiungere del DNA al fine di minimizzare la potenziale contaminazione dei reagenti. Garantire che ogni tubo è chiuso a tutti i tempi quando i reagenti non vengono aggiunti e chiudere tubi immediatamente dopo l'aggiunta di DNA e prima di altri tubi sono aperti.
    2. Programma un termociclatore come segue: 95 ° C per 5 min; 40 cicli di 95 ° C per 15 s, ricottura temperatura per 30 s, 72 ° C per 45 s; 72 ° C per 5 min; e tenere a 4 ° C.
  2. Eseguire il secondo round della PCR simile alla prima reazione, tranne usare primer interno con 2 µ l del primo prodotto PCR (prodotto in 2.2.2).
    Nota: Volumi di reazione sono nuovamente disponibili in tabella 2. Deve prestare attenzione per evitare la contaminazione incrociata degli ampliconi assicurando che il DNA del modello viene aggiunto ultima e che soli tubi corrispondenti a un campione siano aperte alla volta.
     
    Componente Volumi PCR # 1 PCR # 2 volumi
    Taq polimerasi Master Mix 2 X 12,5 Μ l 12,5 Μ l
    Nuclease-free Water Μ l 8.5 Μ l 8.5
    10 µM primer forward e Reverse 1,0 µ l primer esterno 1,0 µ l primer interno
    Modello di DNA µ L 2.0, dall'estrazione del campione (1.2.7) µ L 2.0, dal 1 ° giro della PCR (2.2.2)
    Tabella 2: Miscele di reazione di PCR per amplificazioni di primi e secondo.
     
    1. Programmare il termociclatore come prima, ma regolare la temperatura di ricottura per ospitare i primer interni (Vedi tabella 1).

3. Imaging ed elettroforesi su Gel di agarosio al

Nota: Per le istruzioni di base sulla separazione del DNA tramite l'elettroforesi, vedere Lee et al., 201234.

  1. Preparare un gel di agarosio all'1.2% utilizzando 20 X SB buffer (0.2 M NaOH, 0,8 M acido borico pH 8), diluito a 1 X e aggiungere circa 5 µ l di una macchia di DNA, prima di versare, se pre-macchiatura del gel è desiderata.
  2. Caricare 10 µ l del prodotto dalla seconda reazione di PCR (interno) da ogni sperimentale e campione di controllo, insieme a una scala di 100 bp (5 µ l).
    1. Elettroforesi per 1 h a 107 V (5 v/cm).
  3. Visualizzare e documentare il gel utilizzando un transilluminatore e telecamera associata e software.

Representative Results

nPCR è un approccio elegante per aumentare la specificità e la sensibilità di rilevamento del patogeno, specialmente quando campioni ambientali complessi sono sotto inchiesta. Come descritto in Figura 1, due cicli di PCR destinazione è un'area strategica della Borrelia FlaB locus (e OspA, non nella foto) possono segnalare la presenza del batterio Borrelia burgdorferi attraverso la generazione di corte interna ampliconi. Quando risolto tramite l'elettroforesi del gel, i prodotti di reazione di ciccia e OspA da ogni segno di graduazione possono essere visivamente segnati e confrontati con controlli. Nella Figura 2, esemplare unico identificatori sono forniti nella parte superiore di ogni gel e controlli no-modello e aerosol sono rappresentati all'estrema sinistra e destra, rispettivamente, adiacente le scale.

Amplicon robusto bande sono chiaramente visibili nel selezionare campioni sperimentali, e si distinguono facilmente dagli iniettori surplus e residuo del DNA (Figura 2). Basato su principi di disegno sperimentale stabiliti, un segno di spunta viene considerato positivo per Borrelia quando parallelo controlli negativi non dimostrano amplificazione, e interni ampliconi sono prodotte da primer sia ciccia e OspA . In questo caso, gli esemplari T907, T604 e T606 incontrato i criteri di sorveglianza per l'agente patogeno di Lyme (Figura 2). Al contrario, T923 solo era positivo per OspA, un risultato per il quale esistono più spiegazioni possibili: A) il segno di spunta di origine era negativa per Borrelia, ma la preparazione di OspA PCR esterna o interna spurio è stata contaminata con modello DNA (si noti che sistematica contaminazione dei reagenti è stata esclusa tramite controlli negativi), B) il segno di spunta trasportato Lyme Borrelia, ma modello basso importi o errore sperimentale ha impedito l'amplificazione di ciccia, o C) un organismo era presente che conteneva la sequenza conservata di OspA , ma mancava la flagellina o avuto insufficiente identità della regione mirata della ciccia tempri gli iniettori. Infatti, OspA sequenza somiglianze sono state notate in una varietà di organismi, tra cui piante e animali28. La situazione di converse, amplificazione più conservato flagellina gene, ma non il gene OspA , potrebbe indicare una specie di Borrelia correlate. In pratica, questo protocollo produce più risultati di singolo-positivi di OspA di fanno gli iniettori di ciccia , suggerendo che scenario 'A' è la meno probabile spiegazione. Senza ulteriori analisi sperimentale dell'esemplare polemico, tuttavia, non è possibile determinare l'origine del singolo-positivo risultato. Aumentando il numero delle ripetizioni tecnici effettuati sui campioni di equivoci può aiutare a conciliare il loro status di vero, poiché eventuali contaminanti introdotti spurio per precedenti reazioni non sarebbero presenti nel DNA archiviato. Tuttavia, se le reazioni successive con questi iniettori non riescono a fornire risultati conclusivi, altri loci di Borrelia potrebbero essere studiati mediante PCR. Ampliconi generati da queste reazioni potrebbero anche essere sequenziato e rispetto tra gli isolati per assegnare identità e stimare il grado di divergenza di ceppo. SAPI e colleghi forniscono un esempio di questo flusso di lavoro utilizzando campioni clinici umani35.

Tutti i fattori considerati, i criteri delineati di protocollo e l'interpretazione sono stati stimati per produrre falsi positivi e falsi negativi tassi di 0,17% e 0.0063%, rispettivamente.

Figure 2
Figura 2 : Rilevazione di Borrelia burgdorferi nelle singole zecche di nPCR di Ciccia e OspA. Codici assegnati a ogni tick sono rappresentati nella parte superiore del gel e identità allineano verticalmente per segnalare l'individuazione di OspA e ciccia in ogni esemplare. Corsie intitolata B a sinistra dei controlli immagine rappresentano no-modello, mentre un (corsie di destra) sono controlli di aerosol per catturare la contaminazione dell'ambiente di laboratorio. Clicca qui per visualizzare una versione più grande di questa figura.

Discussion

In decenni di uso, tecniche basate sulla PCR hanno costantemente dimostrato il loro valore nella rilevazione di Borrelia da esemplari di mammiferi e artropodi, se Borrelia provengono da origini ambientali o clinici. PCR offre numerosi miglioramenti rispetto pre-esistenti approcci alla sorveglianza. In particolare, esso non si basa sullo sviluppo e le prestazioni dei reagenti dell'anticorpo e invece può essere facilmente adattato per rilevare nuovi target di interesse semplicemente modificando le sequenze dell'iniettore. PCR può ospitare anche la valutazione dei luoghi multipli in parallelo, in modo indipendente o tramite una reazione multiplex. Può essere applicato agli ingressi dei campioni diversi, tra cui zecche fresco e archiviati22, animale o umani fluidi corporei e tessuto resecato25. PCR produce anche ampliconi che possono essere ulteriormente elaborati, per esempio di digestione degli enzimi di restrizione, ibridazione della sonda o sequenziamento, di fornire una maggiore comprensione nella identità microbica21.

Come strumento clinico, PCR è concettualmente preferibile la diagnostica sierologica standard, in quanto fornisce un'indicazione diretta della presenza batterica, piuttosto che fare affidamento sulla risposta immunitaria ospite come misura secondaria di infezione. Tuttavia, la borreliosi di Lyme è associata con un relativamente modesto onere microbico (< 50 organismi/mL di urina o plasma) e spirochetemia transitoria, che può dar luogo a falsi negativi risultati25. La sensibilità di questa tecnica nella clinica varia considerevolmente a seconda del tipo di tessuto, fase dell'infezione e la condizione di campione, che cade tra il 12,5% e il 62% negli studi esistenti di sangue, liquido cerebrospinale e tessuto biopsiato36. Limitazioni di sensibilità molecolari non sono una preoccupazione se PCR è intrapresa a seguito di coltura batterica, tuttavia il recupero della spirocheta praticabile da campioni clinici ha dimostrato allo stesso modo stimolante. Solo recentemente i protocolli sono stati ottimizzati per maggiore resa35. Nel frattempo, l'intestino di una zecca infetta adulta può harbor mediamente ovunque da 2.000 a oltre 50.000 Borrelia37,38,39, che è solidamente all'interno della gamma di rilevazione di nPCR. Così, il protocollo è adatto agli sforzi di sorveglianza di segni di graduazione.

Nonostante i suoi molti vantaggi, nPCR pongono alcune sfide e la capacità di questa tecnica di segnalare con precisione infezione tick dipende quindi dalla scelta strategica di geni e sequenze amplificate, meticolose dei flussi di lavoro sperimentale che recuperare DNA di qualità da campioni, riducendo al minimo la croce-esposizione dei campioni e l'uso di adeguati controlli che può segnalare contaminanti nell'ambiente di laboratorio e reagenti. Prima di qualsiasi sperimentazione, l'ambito e le intenzioni dell'indagine opportuno definire chiaramente affinché appropriati loci genetici e regioni ivi, possono essere selezionati. Se l'obiettivo è quello di fornire uno schermo imparziale per la causa di Lyme Borrelia burgdorferi s.l. complessi, primer deve essere creato per rilevare tutti i ceppi associati con simile affinità ed efficienza di amplificazione, senza catturare indipendente organismi25. Nuovi primer può essere progettato e valutato in silico utilizzando strumenti software come Primer-BLAST40, anche se dovrebbe anche essere validati sperimentalmente contro standard di riferimento isola prima di essere applicate ai campioni atipici. L'obiettivo della procedura di estrazione del DNA è di recuperare modello microbica intatto da un campione ambientale misto (tick omogeneato). Un passaggio facoltativo prima di procedere con la PCR è di valutare l'integrità del DNA estratto. Inoltre, reazioni in parallelo potrebbero essere impostare come destinazione un gene housekeeping nel segno di spunta. Quest'ultimo metodo può anche indicare la presenza di inibitori nella miscela di reazione, fornendo una maggiore fiducia che le reazioni negative di Borrelia sono a causa dell'assenza dell'organismo e non alla presenza di un contaminante inibitorio.

La sensibilità aumentata dell'approccio PCR annidata a scapito di potenziale contaminazione che genera risultati falsi-positivi. Modello esogeno potrebbe essere introdotto in un campione durante la dissezione di segni di graduazione ed il recupero di DNA, o nel processo di creazione le reazioni di amplificazione esterna e interna. Pertanto è particolarmente importante seguire protocolli di pratica migliore per PCR evitare modello o amplicon contaminazione incrociata. Questi includono l'uso di stazioni di lavoro separata con flussi d'aria indipendente, contenimento in PCR e armadietti di sicurezza biologici eventualmente approfondita chimico e fisico pulizia e sterilizzazione delle superfici e dei reagenti e gestione prudente del DNA 41. No-modello controlli sono inoltre vitali nell'identificare la contaminazione dei reagenti stock. Una particolare vulnerabilità del nPCR è l'amplicone movimentazione che si verifica quando si trasferiscono i prodotti della reazione prima nel secondo recipiente di PCR. Poiché il DNA dell'obiettivo ha già subito l'arricchimento esponenziale in campioni positivi, questo passaggio è particolarmente soggetto a contaminazioni e un tubo singolo nPCR protocollo è stato sviluppato per aggirare questa limitazione. In questo approccio, entrambi i set di primer per un dato gene vengono aggiunti insieme ad un tubo di reazione che rimane sigillato per entrambi i turni di PCR31. Le coppie di primer esterno e quello interno devono essere termodinamicamente distinte, tale che la coppia esterna amplifica modello ad alta temperatura ricottura che è proibitiva per i primers interni. Nel secondo turno, si abbassa la temperatura di ricottura per ospitare l'accoppiamento interno. Non solo fa questo ignorare un passaggio potenzialmente di confusione, permette inoltre l'utilizzo di ulteriori misure anti-contaminazione31,42. Tuttavia, questa modifica può sacrificare alcune sensibilità. Indipendentemente dall'approccio, aumentando il numero delle ripetizioni tecniche eseguita in modo indipendente su un campione vi aiuterà a identificare spurie contaminazioni.

Tecniche molecolari hanno continuato ad evolversi dall'introduzione del nPCR, e questi approcci più recenti offrono vantaggi selezionare sopra i disegni originali, seppur a aumentato degli oneri finanziari. Come suggerisce il nome, PCR quantitativa (qPCR o real time (RT)-PCR) consente l'enumerazione dei patogeni in un campione, mentre le tecniche convenzionali sono di natura43qualitative. La sensibilità di qPCR è piuttosto simile a quella del nPCR38, anche se esso può oscillare a seconda del primer caratteristiche28. Una variazione di qPCR che utilizza molecular beacon (MB) al posto di sonde TaqMan tradizionali inoltre ha indicato la promessa nella rilevazione di Borrelia in campioni clinici44,45,46. Grazie alla loro struttura secondaria unica, molecular beacon riferito produrre fluorescenza di fondo inferiore e superiori segnali legittimi, fornendo in tal modo una sensibilità superiore47. Valutazioni pre-cliniche suggeriscono una potenziale soglia di rilevamento della tra uno e dieci le spirochete44,45. Inoltre, la tecnica è stata applicata correttamente in multiplex reazioni per rilevare contemporaneamente un mammifero ospite gene44 e altri agenti patogeni da zecche45, che non è così facilmente realizzabile con nPCR. Altre modifiche di progettazione includono gocciolina digitale tecnologia PCR (ddPCR), che può quantificare il DNA senza l'uso di una curva standard39,48. Il limite inferiore di rilevamento di questa tecnica per Borrelia è similarmente circa dieci spirocheta/campione39. Rispetto a nPCR, questi approcci hanno anche il vantaggio del ridotto potenziale per contaminazione, dato che richiedono solo un protocollo di amplificazione singola.

Se l'obiettivo della sorveglianza è invece per analizzare il contenuto batterico variato di un tick, 16S rRNA metagenomica screening è un' opzione attraente49. Sebbene questo approccio è più costoso, richiede specializzati Sequenziatori di DNA non trovati in tutti i laboratori di biologia molecolare e richiede più sofisticati basati su bioinformatica interpretazione, può catturare un vasto spettro di microbi più accuratamente rappresentano il carico agente patogeno del vettore.

Mentre qPCR e suoi derivati sono metodi di scelta per le applicazioni quantitative e metagenomica schermate forniscono ampi inventari del microbioma tick, sforzi di sorveglianza mirata sono spesso interessati con binario di segnalazione della presenza o dell'assenza di uno o più agenti patogeni in un vettore. In tali circostanze, questi approcci più recenti, più elaborati possono introdurre inutili complessità e onere finanziario nel processo. Per questi motivi, nPCR ha resistito alla prova del tempo come una tecnica fondamentale in graduazione del test.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Gli autori desiderano ringraziare Kami Harris per disegno dell'iniettore, Ashley McKibbon e Jessica Thomas-Ebbett per le riprese e John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck e Rosie il cane per essere apparso nella video. A. M. K. è stata sostenuta dalla Fondazione canadese per la ricerca malattia di Lyme, e finanziamento del progetto è stato fornito dalle scienze naturali e ingegneria ricerca Consiglio del Canada (NSERC). M. K. B. W. ha ricevuto un finanziamento di stipendio da New Brunswick Innovation Foundation (NBIF).

Materials

Name Company Catalog Number Comments
LabGard Class II, Type A2 biological safety cabinet Nuaire ES AIR NU-543 
Razor blades VWR 55411-050 0.22 mm thickness
Microfuge Tubes (Microtubes 1.5 mL) Axygen 311-08-051
AquaGenomic  MultiTarget Pharmaceuticals 2030 DNA extraction reagent
Microtube Pestle Diamed DIATEC610-1551 Designed for 1.5 ml tubes
Water bath - Isotemp 202 Fishse Scientific 15-462-2
Vortex Labnet S0100 CAN
Spectrafuge 24D Digital Microcentrifuge Labnet C2400
Isopropanol Sigma-Aldrich 190764
BIS-TRIS Sigma-Aldrich B9754
Primer Synthesis Sigma-Aldrich OLIGO
PCR Cabinet Misonix PCR6-482
PCR tube with attached flat caps 0.2mL VWR 20170-012
GoTaq Green Master Mix 2x Promega M7123
Nuclease-free water Promega M7123 The water comes with the GTG
Spectrafuge Mini Labnet C1301
SYBR Safe DNA Stain 10,000X Concentration EDVOTEK 608
Froggarose LE (Molecular Biology Grade Agarose) FroggaBio A87-500G
GD 100 bp DNA Ladder FroggaBio DM001-R500 
Electrophoresis power pack  VWR VWR 105 EC Apparatus Corporation
Fluor-S MultiImager  BioRad 170-7700 (Serial number 433B0154)
Quantity One 1-D Analysis Software (V. 4.5.2) BioRad 1709600

DOWNLOAD MATERIALS LIST

References

  1. Schotthoefer, A. M., Frost, H. M. Ecology and epidemiology of Lyme borreliosis. Clin. Lab. Med. 35, (4), 723-743 (2015).
  2. Franke, J., Hildebrandt, A., Dorn, W. Exploring gaps in our knowledge on Lyme borreliosis spirochaetes - Updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis. 4, (1-2), 11-25 (2013).
  3. Rudenko, N., Golovchenko, M., Vancova, M., Clark, K., Grubhoffer, L., Oliver, J. H. Jr Isolation of live Borrelia burgdorferi sensu lato spirochaetes from patients with undefined disorders and symptoms not typical for Lyme borreliosis. Clin. Microbiol. Infect. 22, (3), 267.e9-267.e15 (2016).
  4. Scott, J. D., Clark, K. L., Anderson, J. F., Foley, J. E., Young, M. R., Durden, L. A. Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, Detected in Multiple Tick Species at Species at Kenora, Ontario, Canada. J Bacteriol Parasitol. 08, (01), 1-10 (2017).
  5. Sperling, J., Middelveen, M., Klein, D., Sperling, F. Evolving perspectives on lyme borreliosis in Canada. Open Neurol J. 6, 94-103 (2012).
  6. Pachner, A. R. Early disseminated Lyme disease: Lyme meningitis. Am. J. Med. 98, (Supplement 1), 30S-43S (1995).
  7. Mikkilä, H. O., Seppälä, I. J., Viljanen, M. K., Peltomaa, M. P., Karma, A. The expanding clinical spectrum of ocular lyme borreliosis. Ophthalmology. 107, (3), 581-587 (2000).
  8. Mc Causland, F. R., Niedermaier, S., Bijol, V., Rennke, H. G., Choi, M. E., Forman, J. P. Lyme disease-associated glomerulonephritis. Nephrol. Dial. Transplant. 26, (9), 3054-3056 (2011).
  9. Tunev, S. S., Hastey, C. J., Hodzic, E., Feng, S., Barthold, S. W., Baumgarth, N. Lymphoadenopathy during Lyme Borreliosis Is Caused by Spirochete Migration-Induced Specific B Cell Activation. PLoS Pathog. 7, (5), e1002066-e1002014 (2011).
  10. Kostić, T., et al. Manifestations of Lyme carditis. Int. J. Cardiol. 232, 24-32 (2017).
  11. Hinckley, A. F., et al. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 59, (5), 676-681 (2014).
  12. Nelson, C. A., et al. Incidence of Clinician-Diagnosed Lyme Disease, United States 2005-2010. Emerg. Infect. Dis. 21, (9), 1625-1631 (2015).
  13. Aucott, J. N., Rebman, A. W., Crowder, L. A., Kortte, K. B. Post-treatment Lyme disease syndrome symptomatology and the impact on life functioning: is there something here? Qual Life Res. 22, (1), 75-84 (2012).
  14. Aucott, J. N., Crowder, L. A., Kortte, K. B. Development of a foundation for a case definition of post-treatment Lyme disease syndrome. Int. J. Infect. Dis. 17, (6), e443-e449 (2013).
  15. Adrion, E. R., Aucott, J., Lemke, K. W., Weiner, J. P. Health care costs, utilization and patterns of care following Lyme disease. PLoS ONE. (2015).
  16. Cameron, D. J. Consequences of treatment delay in Lyme disease. Journal of Evaluation in Clinical Practice. 13, (3), 470-472 (2007).
  17. Johnson, L., Aylward, A., Stricker, R. B. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health policy. 102, (1), 64-71 (2011).
  18. Motaleb, M. A., et al. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. U.S.A. 97, (20), 10899-10904 (2000).
  19. Rosa, P. A., Tilly, K., Stewart, P. E. The burgeoning molecular genetics of the Lyme disease spirochaete. Nat. Rev. Microbiol. 3, (2), 129-143 (2005).
  20. Kenedy, M. R., Lenhart, T. R., Akins, D. R. The role of Borrelia burgdorferi outer surface proteins. FEMS Immunol. Med. Microbiol. 66, (1), 1-19 (2012).
  21. Persing, D. H., Telford, S. R., Spielman, A., Barthold, S. W. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J. Clin. Microbiol. 28, (3), 566-572 (1990).
  22. Persing, D. H., et al. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science. 249, (4975), 1420-1423 (1990).
  23. Wise, D. J., Weaver, T. L. Detection of the Lyme disease bacterium, Borrelia burgdorferi, by using the polymerase chain reaction and a nonradioisotopic gene probe. J. Clin. Microbiol. 29, (7), 1523-1526 (1991).
  24. Johnson, B. J., Happ, C. M., Mayer, L. W., Piesman, J. Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. Am. J. Trop. Med. Hyg. 47, (6), 730-741 (1992).
  25. Schmidt, B. L. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev. 10, (1), 185-201 (1997).
  26. Ogden, N. H., et al. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, (3), 600-609 (2006).
  27. Doern, G. V. Detection of selected fastidious bacteria. Clin. Infect. Dis. 30, (1), 166-173 (2000).
  28. Nolte, O. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis - Lost in the Jungle of Methods, Targets, and Assays? Open Neurol J. 6, (1), 129-139 (2012).
  29. Wallich, R., Moter, S. E., Simon, M. M., Ebnet, K., Heiberger, A., Kramer, M. D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene. Infect. Immun. 58, (6), 1711-1719 (1990).
  30. Picken, R. N. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever. J. Clin. Microbiol. 30, (1), 99-114 (1992).
  31. Picken, M. M., Picken, R. N., Han, D., Cheng, Y., Strle, F. Single-tube nested polymerase chain reaction assay based on flagellin gene sequences for detection ofBorrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Infect. Dis. 15, (6), 489-498 (1996).
  32. Keirans, J. E., Litwak, T. R. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. Med. Entomol. 26, (5), 435-448 (1989).
  33. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  34. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp. (62), e3923 (2012).
  35. Sapi, E., Pabbati, N., Datar, A., Davies, E. M., Rattelle, A., Kuo, B. A. Improved culture conditions for the growth and detection of Borrelia from human serum. Int J Med Sci. 10, (4), 362-376 (2013).
  36. Waddell, L. A., Greig, J., Mascarenhas, M., Harding, S., Lindsay, R., Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, A Systematic Review and Meta-Analysis of North American Research. PLoS ONE. 11, (12), e0168613-e0168623 (2016).
  37. Brunet, L. R., Spielman, A., Telford, S. R. III Density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am. J. Trop. Med. Hyg. 53, (3), 300-302 (1995).
  38. Wang, G., et al. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl. Environ. Microbiol. 69, (8), 4561-4565 (2003).
  39. King, J. L., Smith, A. D., Mitchell, E. A., Allen, M. S. Validation of droplet digital PCR for the detection and absolute quantification of Borrelia DNA in Ixodes scapularis ticks. Parasitology. 144, (4), 359-367 (2017).
  40. Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  41. Kwok, S., Higuchi, R. Avoiding false positives with PCR. Nature. 339, (6221), 237-238 (1989).
  42. Rys, P. N., Persing, D. H. Preventing false positives: quantitative evaluation of three protocols for inactivation of polymerase chain reaction amplification products. J. Clin. Microbiol. 31, (9), 2356-2360 (1993).
  43. Pahl, A., Kühlbrandt, U., Brune, K., Röllinghoff, M., Gessner, A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J. Clin. Microbiol. 37, (6), 1958-1963 (1999).
  44. Saidac, D. S., Marras, S. A. E., Parveen, N. Detection and quantification of Lyme spirochetes using sensitive and specific molecular beacon probes. BMC Microbiol. 9, (1), 43 (2009).
  45. Chan, K., Marras, S. A. E., Parveen, N. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, (1), 295 (2013).
  46. Schlachter, S., Chan, K., Marras, S. A. E., Parveen, N. Detection and Differentiation of Lyme Spirochetes and Other Tick-Borne Pathogens from Blood Using Real-Time PCR with Molecular Beacons. Methods Mol. Biol. 1616, 155-170 (2017).
  47. Wang, L., Blasic, J. R. Jr, Holden, M. J., Pires, R. Sensitivity comparison of real-time PCR probe designs on a model DNA plasmid. Anal. Biochem. 344, (2), 257-265 (2005).
  48. Sze, M. A., Abbasi, M., Hogg, J. C., Sin, D. D. A Comparison between Droplet Digital and Quantitative PCR in the Analysis of Bacterial 16S Load in Lung Tissue Samples from Control and COPD GOLD 2. PLos ONE. 9, (10), e110351-e110356 (2014).
  49. Sperling, J. L., et al. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Ticks Tick Borne Dis. 1-9 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics