Author Produced

Gıda kaynaklı patojen tespit etmek için bir elektrokimyasal DNA biyoalgılayıcı gelişimi

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vibrio parahaemolyticus algılamak için polylactic asit-sağlamlık, altın nano tanecikleri değiştirilme tarihi, Serigrafi karbon elektrot oluşan bir elektrokimyasal DNA biyoalgılayıcı geliştirilmesi için bir protokol sunulmuştur.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nordin, N., Yusof, N. A., Radu, S., Hushiarian, R. Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen. J. Vis. Exp. (136), e56585, doi:10.3791/56585 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vibrio parahaemolyticus (V. parahaemolyticus) insan mortalite ve morbidite oranı önemli ölçüde etkileyen küresel olarak, halk sağlığı sorunları büyük bir oranda katkıda ortak bir gıda kaynaklı patojen var. Parahaemolyticus tespiti kültür tabanlı yöntemleri, immünolojik deneyleri ve moleküler tabanlı yöntemleri gibi geleneksel yöntemlerle karmaşık örnek işlem gerektirir ve zaman alıcı, sıkıcı ve pahalı. Son zamanlarda, biyosensörler umut verici ve kapsamlı algılama yöntemi ile hızlı algılama, maliyet-etkililik ve pratiklik avantajları olduğu kanıtlanmıştır. Bu araştırma parahaemolyticus V. yüksek seçicilik ve DNA hibridizasyon kullanılmasının duyarlılık ile algılama hızlı bir yöntem geliştirmeye odaklanmaktadır. Çalışma, sentezlenmiş polylactic asit-sağlamlık altın nano tanecikleri (PLA-AuNPs) karakterizasyonu kullanarak x-ışını kırınım (XRD), ultraviyole görünür spektroskopisi (UV-VIS), transmisyon elektron mikroskobu (TEM), alan emisyon elde edildi Elektron mikroskobu (FESEM) ve çevrimsel Voltammetry (CV) tarama. Biz de daha fazla istikrar, hassasiyet ve tekrarlanabilirlik PLA-AuNPs in test dışarı taşıdı. PLA AuNPs sulu çözüm ses yapısını stabilize nano tanecikleri kurdu bulduk. Biz de duyarlılık daha küçük bir ücret transferi direnç (Rct) değer ve aktif yüzey alanı (0,41 cm2) artış sonucunda geliştirilmiş gözlenen. Bizim DNA biyoalgılayıcı gelişimi PLA-AuNPs ve redoks göstergesi olarak metilen mavisi (MB) kullanarak bir Serigrafi karbon elektrot (SPCE) değişiklik dayanıyordu. İmmobilizasyon ve hibridizasyon olayları fark nabız voltammetry (DPV) tarafından değerlendirildi. Tamamlayıcı, tamamlayıcı bulduk ve uyumsuz oligonucleotides özellikle tarafından uydurma biyoalgılayıcı ayırt edildi. Ayrıca çeşitli gıda kaynaklı patojenlere karşı olan çalışmalar ve parahaemolyticus V. kimlik taze istiridye içinde güvenilir bir şekilde duyarlı algılama gösterdi.

Introduction

Son yıllarda genel ve bilimsel tartışmaların önemli bir konu, gıda zehirlenmesi 3 aracıları ile ilişkili: mikroorganizmaların1, kimyasal madde2ve parazitler3. Kontamine gıda ciddi sağlık sonuçları insanlar, özellikle zayıf bağışıklık sistemi, yaşlı, hamile kadınlar, bebekler ve küçük çocuklar4olanların daha yüksek risk grubundaki neden olabilir. İle daha--dan bir milyon yılda Afrika, Asya ve Latin Amerika 5 yaşın altındaki çocuklarda meydana gelen akut ishal durumlarında, gıda zehirlenmesi büyük küresel hastalık5,6 ve Dünya Sağlık Örgütü kurdu mikroorganizmaların en önemli katkıda bulunan7olarak. Vibrio parahaemolyticus en çok tanınan öldürücü suşları arasında öne çıkmaktadır. Genellikle, nehir ağzı, kıyı ve deniz ortamlarının8' bulundu, hangi yüksek tuz ortamlarda aktif hale gelir ve yetersiz mishandled pişmiş veya çiğ deniz yenen ciddi bir insan gastroenterit tipine neden bir Ayagin Gram-negatif bakteri olduğunu ürünleri9. Ayrıca, mevcut tıbbi durumlar bazı kişilerde yara enfeksiyonu, septisemi veya kulak enfeksiyonu V. parahaemolyticus10' dan doğan eğilimli onları. Parahaemolyticus V. hemolysins virülans faktörleri hastalık patogenezinde katkıda iki türlere ayrılmıştır: tdh genler tarafından kodlanmış opsonins doğrudan hemolysin (TDH) ve trh genler11tarafından kodlanmış TDH ile ilgili hemolysin. V. parahaemolyticus virülans işaretleri (tdh ile trh gen) çoğunlukla Klinik numune yerine çevre örnekler bulunur.

Parahaemolyticus koşullar, geniş bir dizi altında hayatta yeteneği hızla yanıt çevresel değişiklikler12' ye sahip olur. Onun toksisite hücre kitle13ile paralel olarak arttıkça onun yayılmasını önleme mekanizması tehlike potansiyeli dozu artarken. Daha da kötüsü, iklim değişikliği onların hücre nüfus büyüme14hızlandırmak için yeterli koşulları ile bu bakterilerin sağlamaktadır. Yüksek frekansı nedeniyle, bilhassa ticaret ve bu ürünler büyük miktarlarda15,16 ' nerede bulunurlar olduğundan deniz ürünleri imalatı gıda tedarik zinciri boyunca izlenmesi V. parahaemolyticus ihtiyacı Dünya çapında. Şu anda bakteri tespit ve izole bir dizi biyokimyasal testleri, zenginleştirme ve seçmeli medya17, immunomagnetic jelleştirici enzim bağlı gibi yöntemleri kullanarak assay (ELISA)18, darbe alan jel elektroforez (PFGE) 19, lateks aglutinasyon test ve polimeraz zincir reaksiyonu (PCR) testleri20. Bu yöntemler genellikle kalifiye personel, sofistike aletleri ve kirlenme hakkında bilgileri hemen vermeyin zahmetli teknikler gerektirir. Bu ciddi bir şekilde derhal zararlı kirlenmesine ve bünyesinde uygulamalar algılama olasılığını kısıtlar. Hızlı algılama araçları olağanüstü bir meydan kalır.

Bir zaman tasarrufu, düşük maliyetli, pratik ve gerçek zamanlı analiz yöntemi21,22,23,24 sunduğundan Biosensing gıda kaynaklı patojenler tespiti için umut verici bir seçenek olarak ortaya çıkıyor . Ancak, birçok olumlu sonuçlar analit algılama çivili örnekleri ve standart çözüm biyosensörler kullanarak rağmen hala var. sulu karışımları veya organik özler25gerçek örnekler için uygulanan araştırma eksikliği Son zamanlarda, elektrokimyasal biyosensörler doğrudan ve/veya dolaylı Deoksiribonükleik asit (DNA) algılama kullanarak tamamlayıcı hedef hibridizasyon olay26 üzerinden onların özel algılama nedeniyle bilim adamları arasında artan ilgi almış , 27 , 28 , 29. bu benzersiz yaklaşımları ile karşılaştırıldığında böylece küçültme ve ticari kullanım için gelecek vaat eden bir teknoloji sunan biyosensörler, enzim tabanlı daha stabildir. İşte parahaemolyticus V. yüksek seçicilik, duyarlılık ve pratiklik, hibridizasyon sırasında DNA dizisi özgüllük dayalı algılayabilir hızlı bir araç oluşturmak için hedef çalışma bildirdi. Kimlik stratejileri polylactic asit-sağlamlık altın nano tanecikleri (PLA-AuNPs)30 ve serigrafi karbon elektrotlar (SPCEs) ile birlikte hibridizasyon göstergesi varlığında, metilen mavisi (MB) içerir. Gelişmiş algılama yapı potansiyelini daha fazla bakteri DNA lysate ve taze cockle örnekleri kullanarak keşfedilmeden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Not: kullanılan tüm kimyasal ve biyokimyasal reaktifleri analitik nitelikte olmalıdır ve daha fazla arıtma kullanılır. Tüm çözümler steril deiyonize su kullanarak hazırlayın. Otoklav sterilizasyon öncesinde tüm cam.

Dikkat: Lütfen denetimleri (duman hood, torpidoda) mühendislik kullanımı da dahil olmak üzere laboratuvar faaliyetleri gerçekleştirirken tüm uygun güvenlik yöntemleri kullanın ve kişisel koruyucu donanımları (koruyucu gözlük, eldiven, önlük, tam uzunlukta pantolon, Kapalı-ayak parmağı Ayakkabı).

1. imalat ve karakterizasyonu, değişikliğin PLA-AuNPs kullanarak elektrot

  1. Hazırlanması ve karakterizasyonu PLA-AuNPs
    1. Hızlı bir şekilde 10 mL sodyum nitrat çözeltisi (38.8 mM) kaynar sulu chloroauric asit solüsyonu (1 mM) 100 mL için eklemek ve aşağı ortam sıcaklığına kadar sakin ol. Renk olan sarı, siyahımsı değişiklikler olarak başlar ve sonunda biter koyu yakut kırmızı hazırlanan AuNPs çözümünde değişiklikleri gözlemlemek.
    2. PLA granül eritme işleminin bir paslanmaz çelik kalıp yerleştirin ve onları acil yordamını izleyin 10 dakika süreyle 190 ° C sıcaklıkta onceden: PLA sayfası hazırlık kapsamında 1 dk. için 2,2 MPa basınç altında koymak onları. PLA sayfası 3 h için soğutma sonra kullanıma hazır olacak.
    3. Şiddetle karıştırma, kloroform, oda sıcaklığında 5 ml PLA sayfaların 0,68 mg geçiyoruz. Çözünmüş PLA 10 mL önceden hazırlanmış AuNPs çözeltisi ile karıştırın ve homojen oda sıcaklığında karıştırın. Homojen karışımlar ve UV-Vis, XRD, TEM ve FESEM ile EDX ile karakterize sonra PLA-AuNPs gösterilir olabilir.
  2. Hazırlık ve değiştirilmiş Serigrafi karbon elektrot karakterizasyonu
    Not: Bu çalışmada kullanılan SPCE üç elektrot sistemi oluşur: bir sayaç elektrot, karbon çalışma elektrot ve bir Ag/AgCl referans elektrot.
    1. Hızlı bir şekilde pipet 25 µL PLA-AuNPs SPCE ve daha sonra hava üzerine homojen çözüm kuru 24 kullanılmadan önce s.
    2. Mamüllerinin değiştirilmiş elektrotlar karakterize içinde potasyum ferro siyanür, SPCE/PLA-AuNPs (K3[Fe(CN)6]3 -/4 -) aktif yüzey alanı, elektrokimyasal empedans spektroskopisi, tekrarlanabilirlik, ölçmek için tekrarlanabilirlik ve istikrar30.

2. elektrokimyasal DNA biyoalgılayıcı gelişimi

  1. Sonda hazırlık
    Not: SsDNA sonda ve tamamlayıcı DNA dizileri dayalı bilgi biyoteknoloji bilgi (NCBI) veritabanı için Milli Merkezi olarak seçilmiştir.
    1. Sentetik oligonucleotides (20-mer ssDNA sonda, 20-mer tamamlayıcı DNA, 20-mer eşleşmeyen DNA ve 21-mer tamamlayıcı DNA) liyofilize toz ticari laboratuvarları, aşağıdaki dizileri dayalı olarak satın alın:
      thiolated ssDNA sonda: 5 ' - / 5ThioMC6-D/CGGATTATGCAGAAGCACTG - 3 '
      tamamlayıcı DNA: 5 ' - CAGTGCTTCTGCATAATCCG - 3 '
      bir Bankası eşleşmeyen DNA: 5 ' - CAGTGCTTCTGC ṪTAATCCG - 3 '
      Üç-base eşleşmeyen DNA: 5 ' - CAGTGCTTCT Ċ ṪṪTAATCCG - 3 '
      tamamlayıcı DNA: 5 ' - CGCACAAGGCTCGACGGCTGA - 3 '
    2. Tüm oligonucleotides (100 µM) hisse senedi çözümler analitik bölümlerini içine bölünmüş bir steril TE çözüm (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) kullanarak hazırlayın. Bu-4 ° C'de tutmak ve uygun dilutions kullanmak için sadece önceden yapın.
  2. İmmobilizasyon ve hibridizasyon duruma getirilmesi
    Not: Bu çalışma için kullanılan PLA-AuNPs SPCE/PLA-AuNPs gösterilir, modifiye bir SPCE ve bir damla döküm yöntemi DNA immobilizasyon ve hibridizasyon için kullanıldı.
    1. İlk olarak, thiolated ssDNA sonda SPCE/PLA-AuNPs üzerinde 25 µL hareketsiz ve sonra hava kuru bu oda sıcaklığında 24 h için sonra bu sonunda SPCE/PLA-AuNPs/ssDNA gösterilir. Üç faktör kullanarak optimizasyon immobilizasyon durumun belirleyin: ssDNA (0.2 1.4 µM arasında), saat (210 dakika 30 arasında) ve sıcaklık (75 ° C-25 arasında değişen) konsantrasyon.
    2. SPCE/PLA-AuNPs/ssDNA-sonra o nihayet SPCE/PLA-AuNPs/dsDNA gösterilir hibridizasyon olay gerçekleştirmek için yüzey için tamamlayıcı DNA'ın 25 µL pipet. En iyi duruma getirme (5 ila 30 dakika arasında) zaman ve sıcaklık (75 ° C-25 arasında değişen) iki faktör üzerinden hibridizasyon durumu belirlemek.
    3. İmmobilize bırakın ve 20 µM MB 30 dakika süreyle melezleşmiştir elektrotlar 0,5 M ABS ile yıkayarak olmayan özellikle adsorbe DNA ve aşırı MB kaldırmak/deiyonize su ile durulama ve 20 mM NaCl (pH 4.5). MB azaltma DPV tekniği kullanarak en yüksek akım ölçüsü. 0.1 M PBS (pH 7) kullanarak DPV ölçüm yürütmek hiçbir gösterge içeren.
  3. Fabrikasyon DNA biyoalgılayıcı karakterizasyonu
    1. SPCE/PLA-AuNPs 20 µM MB 30 dk içinde bırakın, yıkama 0.5 M ABS/20 mM NaCl (pH 4.5) ve o zaman ölçme önce deiyonize su ile durulayın. Sonda DNA, tamamlayıcı DNA, eşleşmeyen DNA ve tamamlayıcı DNA örnekleri de dahil olmak üzere tüm etkileşimler için benzer bir yordamı izleyin.
    2. Elektrokimyasal azaltma ölçmek.
      Not: Ticari olarak imal edilmiş bir Autolab arabirimi yazılım programıyla DPV şiddetindeydi.
      0,005 V, Modülasyon genlik 0,05 V ve 7.73 mVs-1 0.1 M PBS (pH 7), tarama hızı, potansiyel bir adımla V, 0,25 -0,5 V değişen bir potansiyel gerçekleştirilen MB elektrokimyasal azaltma DPV ölçümleri hiçbir gösterge içeren. Seçicilik, hassasiyet, tekrarlanabilirlik ve ısı dayanımı fabrikasyon DNA biyoalgılayıcı, daha da incelenmiştir. Bildirilen sonuçlar olarak ortalama değer ölçüleri içinde üç çoğaltır sunuldu.

3. gerçek örnekleri kullanarak fabrikasyon DNA biyoalgılayıcı doğrulama

  1. Bakteri suşları hazırlanması
    1. Deniz ürünleri31,32 onların önemli kirlilik dayalı bakteriyel örnekleri seçin.
      Not: V. parahaemolyticus olarak başvuru suşları ve 8 diğer bakteri suşları (Campylobacter jejuni, Listeria Monositogenez, Salmonella typhimurium, Salmonella enterit, Klebsiella pnömoni, Escherichia coli O157: H7, Bacillus cereusve Vibrio alginolyticus) ortak gıda kaynaklı patojen istihdam elektrokimyasal DNA biyoalgılayıcı doğrulama Bu çalışma için.
    2. Rutin bir alt kültür onların anılan sıraya göre agar bakteri suşlarının iki haftada canlılığı korumak, Tablo 1 kültür koşulları için başvurmak için kuralları.
    3. Onları dondurma işlemi sırasında zarar verebilir buz kristalleri oluşumunu engelleyerek bakteri gliserol korur gibi %20 (v/v) gliserol-80 ° C'de içeren onların anılan sıraya göre artan et suları içinde bakteri suşlarının uzun vadeli koruma korumak. Ardından, gliserol stokları korunmuş bakteriyel hücre kültüründe bir döngü ilgili broths aşılamak. Et suları ilgili büyüme zaman ve sıcaklık göre bakteri canlandırmak gerek zaman kuluçkaya.
    4. Dilutions bir dizi elde edilen mikroorganizmalar numaralandırmak için bir forma plaka tekniği33, bir standart ve iyi bilinen bir yöntemi kullanarak parahaemolyticus V. hücre sayısını belirle.
      1. Kültür parahaemolyticus V. Trypticase soya suyu (TSB + % 3 NaCl) 140-rpm sallayarak koşuldaki 37 ° C'de. O zaman, bakteri hücre kültürü 1 mL TSB + % 3 9 mL transferi NaCl 10-1 seyreltme faktörü elde etmek için.
    5. Bu dokuz kez en çok 10-10 seyreltme faktörü tam bir dizi elde etmek için tekrarlayın. Ardından, her seyreltme faktörü (10-10için 10-1 ' den başlayarak) 0.1 mL bir Vibrio'nın seçici agar plaka sayma, sırasıyla koloni için yayıldı. Plakayı 24 h 37 ° C'de inkübe kuluçkaya.
    6. Bir koloni sayaç bireysel kolonileri saymak ve sonra geri-(sayısı x seyreltme faktörü CFU/pipetted tutar) mililitre yoğunluğu (CFU mL-1) koloni oluşturan birim almak için hesaplamak için kullanın. Bakteri hücre süspansiyonlar CFU mL-1 absorbans karşı kalibrasyon komplo birimleri (CFUs) oluşturan colony konsantrasyonu türetmek.
  2. PCR tahlil hazırlanması
    1. Genomik DNA değiştirilmiş bir takip lizis yordamı34haşlanmış ayıklayın. Bireysel bir bakteriyel agar medyada süzün ve suyu medya, kendi göreli büyüme durumunu 140 bir koşul sallayarak rpm kuluçka tarafından takip aşılamak ilk, çizgi.
    2. Et suyu 1 mL kültürünün bir mikro santrifüj tüpüne pipette. Bu 4830 x g ve granül elde etmek için 1 dakika için 4 ° C, santrifüj kapasitesi. Steril TE arabelleği yaklaşık 500 µL re-süspansiyon ile Pelet için kullanın. Elde edilen süspansiyon için 10 dak hold 98 ± 2 ° C Isıtma blok ve hemen hücreleri parçalayıcı ve DNA'yı serbest bırakmak 10 min için-18 ° C'de chill.
    3. Genomik DNA 4830 x g ve açık bir süspansiyon elde etmek ve daha fazla kullanmak için-20 ° C'de süpernatant tutmak için 3 dakika için 4 ° C, santrifüj kapasitesi. Biophotometer ölçüm 260 bir dalga boyu, UV emme ile kullanmak nm (nükleik asitler dalgaboyu ışık emici) olarak ve aynı zamanda bir dalga boyu 280 nm (ışığın dalga boyu emici proteinler) olarak konsantrasyon ve ayıklanan saflığı belirlemek için genomik DNA ve standart biyokimyasal deneyleri35 kullanarak ve onları 16S rRNA gen sıralama36tarafından doğrulama tüm suşların tanımlamak. Son olarak, 92 ° c için 2 dk genomik DNA tabiatını ve hızla buz su biyoalgılayıcı için uygulamadan önce sakin ol.
    4. Daha fazla varlığı parahaemolyticus onaylamak toxR gen hedeflemek için PCR kullanarak. Bir thermocycler bir astar çift (5'-GTCTTCTGACGCAATCGTTG-3' ve 5'-ATACGAGTGGTTGCTGTCATG-3') kullanarak bu yordamı gerçekleştirin. PCR güçlendirme 25 µL steril su (15,5 µL), arabellek (5 µL), astar (1 µL, 10 µM), dNTP mix (1 µL), DNA şablonu (2 µL) ve Taq DNA polimeraz (0.2 µL, 10 x) oluşan toplam reaksiyon hacmi içinde en iyi duruma getirme.
    5. Bileşenleri karıştırın ve amplifikasyon 30 döngüleri için programlanmış bir thermocycler hedef sırada PCR amplifikasyon düzenlemek. Bizim çalışmada, her döngüsü üç adım reaksiyonlar i.eoluşuyordu., ilk denatürasyon (94 ° C, 3 dk) denatürasyon (94 ° C, 1 dk.), tavlama (63 ° C, 1,5 dk) ve son uzantısı (72 ° C, 7 dk) tarafından takip uzantısı (72 ° C, 1,5 dk), 30 döngüleri izledi.
    6. Güçlendirilmiş ürünler ve % 1.5 özel jel elektroforez ile boyutlarını belirleyin. Ticari olarak üretilen jel dokümantasyon sistemi ile jel çekim.
  3. Cockle örnekleri hazırlanması
    1. Taze örneklerini almak.
      Not: Bizim taze istiridye (Anadara granosa) Serdang, İstanbul, ıslak pazarda elde edilen ve hızlı bir şekilde bir buz soğutucusu kutusunda analiz için laboratuvara getirdi. Örnekleri 2 Grup, yani tedavi ve tedavi edilmezse grup daraltan düzgün soğuk hava deposu yerleştirerek kadar hasat başından itibaren hasat edildi varsayarak bölün.
    2. Tarak tedavi grubunda 24 h, 4 h önce DNA ekstraksiyon için 20 ° C'de UV ışığa maruz kalma ardından için-20 ° C'de depolayarak önceden tedavi.
      Not: Donma sıcaklığı ve kontrollü için kullanılan UV Işınlarına maruz kalma grup öldürür ya da en azından daraltan içinde doğal olarak biriken parahaemolyticus V. sınırlar. Taze daraltan gerçek durumunu taklit etmek için bu çalışmada kontrollü durumda amacı olduğu gibi 70 ° C daha yüksek bir pastörizasyon rejim geçerli değildir. Bu arada, laboratuvarda geldikleri gibi öncesi herhangi bir tedavi tedavi edilmezse grubundan doğrudan örnekleri analiz.
    3. Alt kültür parahaemolyticus V. ATCC 17802 TSB içinde bir tür (% 3 NaCl). Tekerlekli sandalye basketbolu uygun dilutions kaplama ile inoculum içinde hücrelerin düzeyini belirlemek (% 3 NaCl) 104 CFU mL-1 V. parahaemolyticus, bir inoculum elde etmek için CA'da. Her cockle distile suda yıkayın ve steril forseps laminar akış kabine dokular kabuğu'kaldırmak için kullanmadan önce kir ücretsiz fırçalayın.
    4. Bir homogenizer 90 ml steril TSB ile yaklaşık 10 g cockle doku örnekleri homojenize (% 3 NaCl) için 60 s. Ekle parahaemolyticus V. bilinen bir miktar homojenize örnek suyu için çivili örnekleri 9 ml. Unspiked örnekleri bir negatif kontrol kullanır. Cockle örnekleri için CA'da örneklerinin 0.1 mL kaplama tarafından çivili parahaemolyticus V. hücre sayısı tahmin etmek ve daha sonra emme biyoalgılayıcı ve PCR tahlil kullanılmak üzere, örnek 1 mL örnek microcentrifuge tüp içine DNA örneği almak için pipetting.
    5. Parahaemolyticus genomik DNA değiştirilmiş bir takip çivili ve unspiked örnekleri lizis yordamı36haşlanmış ayıklayın. Son olarak, DNA konsantrasyon ve UV emilimini 260 ile bir dalga boyu, biyo fotometre ölçüm kullanarak saflık belirlemek nm (nükleik asitler dalgaboyu ışık emici) olarak ve aynı zamanda bir dalga boyu 280 nm (olarak ışığın dalga boyu emici proteinler).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

AuNPs oluşumu ile sodyum sitrat mevcut sulu çözüm renk değişikliği ile ortaya çıktı. Bu rengi açık sarı bir derin yakut kırmızı değiştirmek için neden oldu. PLA-AuNPs nesil yüzey plasmon rezonans (SPR) en yüksek büyüme bulunduğu yaklaşık 540 UV-vis spectra (Şekil 1) üzerinden teyit edildi nm. Oluşumu ve PLA-AuNPs varlığını parçacık boyutu37bağlı olarak 500-600 nm dalga boyu aralıkları belirtilen. AuNPs ve PLA-AuNPs XRD şekillerinin Şekil 2' de gösterilmiştir. Tüm crystallite doruklarına 31.7, 38.2 44.4 64.7 ve 77,7 ° 2θ tespit edildi. Onlar en (100) (111) (200) (220), atfedilmiştir ve kübik-FCC (yüz merkezli kübik) altın (311) crystallographic uçaklar (metal) taşınımı (JCPDS dosya No-00-004-0783). PLA-AuNPs crystallite en yüksek yoğunluklarda da daha geniş bir kırınım tepe 31,7 AuNPs PLA içinde gömülü ima ve polifazik altın nanoyapıların38oluşumu düşündüren ° ortalanmış olarak arttı. Ayrıca, PLA-AuNPs üzerinde gösterilen tüm AuNP difraksiyon doruklarına AuNPs istikrarlı bir yapı olduğunu belirtti. PLA-AuNPs ortalama boyutunu Scherrer'ın denklem kullanılarak hesaplanır (L = kλ/βcosθ), (100) Bragg'in yansıma genişliğini malzemelerini. FWHM ve d-aralığı (Tablo 2), PLA-AuNPs crystallite boyutunu 27 hesaplanmıştır nm.

PLA-AuNPs ve morfolojisi boyutları daha fazla TEM kullanarak soruşturma. TEM partikül dağıtım eğri ve PLA-AuNPs görüntülerini altın nano tanecikleri (Şekil 3) şeklinde neredeyse küresel görüldü. Nano tanecikleri boyutunu yaklaşık 37 aralığında oldu nm, polikristalin doğa olarak sentezlenmiş nano tanecikleri39düşündüren Scherrer'ın formülden elde edilen daha biraz büyük. Daha küçük boyutlu XRD TEM aksine kaynaklanan önceki araştırmada, parçacık yapısı daha küçük (alt parçacıklar)40 crystallites önemli miktarda nedeniyle doğada polikristalin olduğundan büyük olasılıkla da gözlenmiştir . Şekil 4 SPCE hazırlanan PLA-AuNPs FESEM görüntüsünü gösterir. FESEM fotoğraf ve SPCE/PLA-AuNPs altın, en büyük yoğunluğu en yüksek ağırlık yüzdesi ve en büyük yüzey nanopartikül kapsama vardı EDX spectra belirgindir. Ayrıca, özellikle, Şekil 4(bir) çıplak bir SPCE FESEM görüntüsünü gösterir dikkat. Şekil 4(b) FESEM görüntüde iyi dağıtılmış PLA-AuNPs gösterir. Sentezlenmiş PLA-AuNPs kimyasal bileşimi teyit için EDX olarak üretilen PLA-AuNPs, Şekil 4(bir)ve 4(b) göre kimyasal bileşimi araştırmak için istihdam edildi. EDX spektrum olarak üretilen PLA-AuNPs altın (Au) sadece oluşan ve karbon (C) ve oksijen (O) karşılık gelen en yüksek dışında hiçbir öğe görüntülenir doğruladı. C en yüksek varlığı hangi üstünde-e doğru damla döküm örnek oldu karbon elektrot nedeniyle idi.

EDX spektrum da O film havaya maruz çünkü oksijen karbon elektrot üzerinde adsorbe belirten varlığını gösterdi. Bu hava uzun süre41için maruz Eğer oksijen karbon nanotüpler üzerinde adsorbe onaylar. Havada çeşitli gaz molekülleri olmasına rağmen oksijen tarihinde hava günese maruz kalan karbon nanotüpler42, muhtemelen daha hızlı onun adsorpsiyon ile diğer molekülleri43karşılaştırıldığında nedeniyle ana adsorbate olduğuna inanılan. Bu oksijen karbon elektrot üzerinde ana adsorbate numune hazırlama gece hava pozlama sırasında oldu ve PLA-AuNPs Kimyasal saflığı takviyeli bulmaya dayanıyordu. Anodik ve katodik pik oranı (benpa/ipc) tarama oranı artan44sürekli en yüksek potansiyel verdi hemen hemen 1, yapıldı. Ayrıca, anodik ve katodik pik potansiyeli en yüksek ayırma (Şekil 5) dayalı elektrokimyasal reaksiyon tersinir olduğunu mu ima farklı tarama oranları45 tutarlı edildi. Modifiye elektrot aktif yüzey alanı Randles-Sevick denklemi kullanılarak hesaplanmıştır (benpc = (2,69 × 105) n3/2 reklam1/2 Cv1/2. Arsa eğimi üzerinden benpc v1/2 Şekil 5(bir) karşı ve ()b), elektrotlar Yüzölçümü 0,26 cm2 ve 0,41 cm2 hesaplanmıştır çıplak SPCE ve PLA-AuNPs, anılan sıraya göre. Bu sonuç PLA-AuNPs aktif yüzey alanı üzerinde tarafından tanınan geliştirme nispeten daha ile çıplak SPCE göre doğruladı. Türetilmiş sonuç polimer gömülü altın karşılaştırılabilir yüksek aktif yüzey alanı süreci Gelişmiş ortaya (β-CD-EDAS(N-[3-(trimethoxysilyl)propyl]ethylene-diamine matris kapsüllenmiş altın nano tanecikleri) nano tanecikleri, Elektron transferi ve bu nedenle içinde sonuçlandı daha iyi duyarlılık46.

Değiştirilmiş SPCE elektrokimyasal reaksiyon kontrollü difüzyon, tarafından bir azalma K3[Fe(CN)6]3 -gösterilen bir süreçte / sırayla4 - maksimum akım, dayanıyordu geçerli tarama hızı kare kökü (v 1/2). Modifiye elektrot özellikleri daha iyi bir görünümünü elde etmek için CV ölçümleri açısından sunulan modifiye elektrot performansı ile ilişkilendirmek için bir elektrokimyasal empedans spektroskopisi (EIS) çalışma gerçekleştirildi. Yüksek frekanslarda görülen yarım daire bölüm EIS Elektron transferi sınırlayan işlem ile ilişkili. Ücret transferi direnç (Rct) doğrudan yarım daire çapı ölçüldü. Rct 1932 Ω olduğu ve nereye SPCE/PLA-AuNPs modifikasyonu 1444 Ω (Şekil 6) düşmüştür çıplak SPCE değeri ile bu sonucu talebiyle. Rct değer azalma SPCE/PLA-AuNPs yerel dielektrik düşmesiyle sonuçlanan ve/veya elektrikli çift kalınlığı artışı katman47ki K3[Fe(CN)6] düşündüren,3 - /4 - işlev adsorpsiyon metal/çözüm arayüz tarafından. Bu çıktıların CV (Şekil 7) ölçümleri türetilmiş olanlar karşılanmış. En yüksek akımlar aşamalı olarak daha yüksek bir hassasiyet düşük Rct48tersini gösterdi PLA-AuNPs kullanarak SPCEs değişiklik ile arttı. Böylece, CV modifiye elektrot değer artış ve Rct değerleri azalma (su moleküllerinin 27.19 Å3birimdir) su molekülleri kademeli değiştirilmesi yüzünden3 K adsorpsiyon tarafından olabilir [Fe(CN)6] 3 -/4 - çözünme tepki49ölçüde azalan metal yüzeyi.

Tablo 3 tekrarlanabilirlik ve tekrarlanabilirlik modifiye elektrot göreli standart sapma (RSD) gösterir. K3[Fe(CN)6]3 -rutin CV kayıt /4 - modifiye elektrot tekrarlanabilirlik araştırmak altı ardışık kümeleri için yapılır. MSB, SPCE/PLA-AuNPs %4,26 türetilmiştir. Elektrot PLA-AuNPs değişiklik ile daha iyi RSD sonra çeşitli ölçümler verdi. Ayrıca, aynı yordam kullanılarak, altı değiştirilmiş elektrotlar bağımsız olarak, hangi %4.05 RSD değerlerini elektrot üretim PLA-AuNPs için daha iyi tekrarlanabilirlik gösteren SPCE/PLA-AuNPs için verdi fabrikasyon. Değiştirilmiş substrat PLA-AuNPs bağlı olarak 37 ° C'de için uzun bir süre tutuldu. Ayrıca kayıt 20 döngüleri ve sinyal kalitesi %18 bir düşüş için kullanılmıştır. İle birlikte biyoalgılayıcı, immobilizasyon süresi, sıcaklık, çıkış maksimum ulaşmak için ssDNA konsantrasyon ve hibridizasyon için ölçüt incelendi. Onlar DPV en yüksek akımı etkisi gibi optimize edilmiş olması, bu koşullar gerekli. SsDNA toplama en iyi duruma getirmek için SPCE/PLA-AuNPs ile farklı konsantrasyon pipetted (0.2 0.4 0.6, 0.8, 1.0, 1.2 ve 1.4 µM) ssDNA 60 dk, böylece ssDNA optimum konsantrasyonu tespit edildi. Daha yüksek DNA konsantrasyonları kullanıldı gibi Şekil 8tarihinde dayanarak, DPV maksimum akım arttı. Çalışma ayrıca DNA'ın en iyi duruma getirilmiş konsantrasyon 1.2 µM ssDNA olduğunu fark etti.

SPCE/PLA-AuNPs tek iplikçikli DNA'da içeren immobilizasyon dönemi en iyi duruma getirmek için ssDNA (1.2 µM) 25 µL test edildi üzerinde farklı zamanlarda (30, 60, 90, 120, 150, 180 ve 210 dk). Şekil 9' da bulgular immobilizasyon dönemi DPV maksimum akım sürekli artış kaynaklanan bir artış göstermektedir. Böylece, ssDNA optimum immobilizasyon saati 180 dk seçildi. İmmobilizasyon sıcaklık en iyi duruma getirmek için SPCE/PLA-AuNPs ile ssDNA (1.2 µM) çeşitli sıcaklıklarda pipetted (75, 65, 55, 45, 35 ve 25 ° C) 180 dk için. Sonraki amortisman (Şekil 10); ardından bulduk DPV tepe akım başlangıçta immobilizasyon sıcaklığı 55 ° C için yükseltilmiştir zaman ilerledi Böylece, 55 ° C sonraki deneylerde kullanılmak üzere en iyi duruma getirilmiş immobilizasyon sıcaklık seçildi. Elektrot ve hibridizasyon sakatlık yüzeyler arasında hareketsiz olduğunu ssDNA ayrılması yüksek sıcaklıklarda tarafından neden oldu. Benzer sonuçlar50ile diğer rapor edilmiştir. Daha hızlı bölme ve DNA dejenerasyonu altın nano tanecikleri yüzeylerden daha yüksek sıcaklıklar51, oluştu. Araştırma yapılan son zamanlarda bildirilen altın ve thiol arasındaki bağı oksitlenir hızla düşer ve sadece ortam, bir durumda örneğin suya maruz zaman, hava ve ışık52,53,54. Hibridizasyon zaman etkisini de bu çalışmada araştırılmıştır.

Fabrikasyon SPCE/PLA-AuNPs/ssDNA damla-döküm bir çözüm hedef DNA ile (0.2 µM) (5, 10, 15, 20, 25 ve 30 dk) kez farklı hibridizasyon. DPV yanıt belli ki, zaman, kuluçka (5 10 dk)'dan 5-dak artış ile gül (Şekil 11). Bu değer elde sonra hibridizasyon istenen süre 10 dk seçildi bu yüzden bir 10-30 dk aşağıya doğru desen gözlendi. Hibridizasyon etkinliğini artış sıcaklık 25 ° C ila 35 ° C (Şekil 12) artmış. 35 ° C'nin daha yüksek bir sıcaklıkta yavaş yavaş azaltmak için yüksek akım görüldü Bunun nedeni algılama sinyali azaltarak sandviç yapı denatürasyon neden olduğu bildirildi. Bu nedenle, seçilmiş en uygun hibridizasyon sıcaklık 35 ° c oldu Parahaemolyticus V. AuNPs için çalışma elektrodu, yüzey modifikasyonu ve karmaşık, redoks arabuluculuk PLA MB, aktif yüzey alanını geliştirmek için oluşan saptanmasında kullanılan işlem LB için azaltılmış. Bu oksidasyon işlemi sonucu ssDNA ve MB55arasında daha iyi bir yakınlık olduğunu. Geçerli DPV ekli MB molekülleri daha düşük sayıda nedeniyle tamamlayıcı, sıra ile ssDNA hibridizasyon sırasında azalma.

Biz daha fazla gelişmiş biyoalgılayıcı performansını soruşturma yürütülen. Şekil 13 DPV sonuçlarında seçici algılama etiket56, sonda DNA, tamamlayıcı DNA, bir Bankası eşleşmeyen DNA, üç-base eşleşmeyen DNA ve tamamlayıcı DNA MB huzurunda ayırt etmek mümkün olduğunu göstermek 57. en düşük maksimum akım (0,73 µA) yavaş yavaş artan bir Bankası eşleşmeyen DNA tarafından tamamlayıcı DNA tarafından sergilendi (0,94 µA), üç üsleri eşleşmeyen DNA (1,05 µA), Sigara-tamamlayıcı DNA (3.25 µA) ve DNA prob (4.79 µA). Geçerli hedef DNA hassas ve özellikle oligonükleotid dizileri arasında ayırımcılık bizim biyoalgılayıcı izin oligonükleotid sıralarının tüm akımları en küçüğü idi. MB güçlü immobilize sonda bir büyük DPV maksimum akım üreten DNA ssDNA ile bağlı. SPCE/PLA-AuNPs/sigara-tamamlayıcı DNA immobilize sonda DNA geçerli neredeyse yarısı SPCE/PLA-AuNPs/dsDNA yüzeye monte MB sadece küçük bir miktar kadar düşülmesi. Bu MB ve guanin arasındaki ulaşılmaz etkileşimler nedeniyle üsleri olması muhtemeldir. Etkileşim modları DNA ve MB Bu deneysel koşullar pH, sıcaklık, DNA toplama, iyonik gücü ve arabellek58,59türü olarak kuvvetle bağlı. MB sık dsDNA için groove ve intercalative modları, tarafından MB birikimi dsDNA yüzey60tarihinde sonuçlanan bağlar. Bizim yakalama sonda DNA maruz kalma bir Bankası eşleşmeyen DNA ile üç-base eşleşmeyen sürekli DPV en yüksek akımlar azaltılmış ve tamamlayıcı hedef DNA bu eğilim devam etti. Tablo 4 MB zirve için seçicilik oranı yüzdesi geçerli gösterir. Bizim genel bulma inşa DNA biyoalgılayıcı hibridizasyon immobilize sonda DNA SPCE/PLA-AuNPs yüzeyi üzerinden çok seçici idi.

Gelişmiş DNA biyoalgılayıcı duyarlılığı daha fazla tamamlayıcı hedef oligonükleotid çeşitli konsantrasyonları ile araştırılmıştır. Şekil 14 DPV tepe akım MB SPCE/PLA-AuNPs üzerinde yavaş yavaş tükenmesi arttı tamamlayıcı DNA toplama olarak gösteriyor. Şekil 15 azaltılmış MB maksimum akım günlük ve birkaç hedef DNA (0.2 pM 0,02 mm) konsantrasyon günlük arasında oluşturan 0,96 doğrusal regresyon katsayısı sergiler. Bir grafiğin tepe geçerli değişiklikleri (ΔP) 3σ/m formülü (olmak boş çözüm ve doğrusal eğrinin eğimini olmak m standart sapması σ) kullanarak çizildi61,62,63. Fabrikasyon DNA biyoalgılayıcı algılama sınırı 4.43 aslında bizim en küçük büyük olan pM olmak örnek ölçülen hesaplanır. Bu sonucu 0 pM 2 ve 2 de gerçeği ile anlaşma o ΔP idi (2.65 × 10-6 A ve 2,81 × 10-6 A) 1.19 × 10 standart sapması ile-7 A ve 1,06 × 10-7 A, sırasıyla, üst üste.

Fabrikasyon DNA biyoalgılayıcı için LOQ hesaplamak için biz 10σ/m formül içinde kullanılan (σ boş çözüm standart sapma ve m doğrusal eğrinin eğimini) ve 14 pM 8 bir kazanç olarak sonuç bulundu. Tekrarlanan denatürasyon tamamlayıcı DNA'ın DNA biyoalgılayıcı yenilenme kapasitesi açısından değerlendirmek için gerçekleştirildi. Biz hızlı bir buz banyosu denatüre tek iplikçikli DNA64korumak için soğutma tarafından takip çift iplikçikli DNA'yı denatüre için 0.2 µM tamamlayıcı DNA modifiye elektrot sıcak su için 8 dk. 86 ° C'de kuluçka bunu.

Hibridizasyon etkinliğini onun ilk yanıt % 91'i sonra yeniden oluşturma işlemi, 8 çabaları devam edildi (n = 5, MSB %4.05 =). DNA prob immobilizasyon SPCE/PLA-AuNPs açmak için SAM yöntemine dayalı DNA biyoalgılayıcı içinde tekrarlanan denatürasyon işlemlerden sonraki silme işleminin tamamlayıcı DNA hafiye iyi bir yanıt elde son derece kararlı. Bizim DNA biyoalgılayıcı ısı ile ilgili kararlılığını daha da incelenmiştir. Bunu yapmak için biz 4 ° C, 25 ° C ve 45 ° C sıcaklıkta PLA-AuNPs/SPCE/ssDNA elektrot silika jel içeren bir kapalı alüminyum çanta içinde saklı. 6 ay sonunda, biz tamamlayıcı DNA değerlendirildi ve sinyal üretim kurtarma yüzdesi tahmini. Şekil 16 sonda SPCE/PLA-AuNPs/ssDNA sonra 6 ay depolama ilk sinyallerini hala kurtarılabilir fazla % 80 ile son derece kararlı olduğunu gösteriyor. Güçlü tepki PLA-AuNPs ve ssDNA arasında bir sıcaklık 45 ° c altında uzun vadeli istikrar için bulundu

Dokuz farklı bakteri türleri (B. cereus, L. Monositogenez, C. jejuni, E. coli O157: H7, alginolyticus V., S. typhimurium, S. enterit, K. pnömoni ve V. parahaemolyticus) tarafından PCR algılamayı gösterildi. PCR güçlendirme ürünleri parahaemolyticus V. species-specific tespiti ile bakteri kültür Şekil 17' de gösterilen. Parahaemolyticus V. toxR gen parahaemolyticus V. kimlik patojenik yalıtır varlığını nedeniyle için PCR astar olarak kullanılmıştır. PCR analizinden parahaemolyticus V. V. parahaemolyticusdoğru toxR gen PCR astar özgüllüğü nedeniyle olumlu sonuçlar gösterdi. Diğer bakteri suşları yok PCR ürünleri tespit edildi. Parahaemolyticus çok açık tespiti ile karşılaştırıldığında diğer bakteri türler olan değerlendirme gösterdikten sonra Şekil 18' tasvir elde DPV maksimum akım. Baz çifti artış DPV sinyal probları için bağlı MB molekülleri daha büyük miktarda nedeniyle azalmıştır. Parahaemolyticus hangi gıda örnek ortamı taklit diğer gıda kaynaklı patojenler ayrımcılık açıkça başardık.

Onlar yerel gıda çeşitli popüler maddeler olduğundan daraltan DNA biyoalgılayıcı doğrulama Bu çalışmanın gerçek örnekleri olarak seçildi. Çiğ istiridye kez patojenik V taşımak bilindiği. parahaemolyticus ve özellikle onlar yetersiz65hasat sonra depolama sırasında buzdolabında Eğer bu bakterilerin insanlara, iletebilir. Cockle örnekleri tedavi grubu 24 h için-20 ° C'de depolanan ve UV ışığı DNA ekstraksiyon bizim ön arıtma adım sırasında önce 4 h için 20 ° C'de maruz. Şekil 19 PCR analiz parahaemolyticus V. her iki tedavi ve tedavi edilmezse (çivili) örnekleri bulunan gösterir. Bu Lane 7, 8, 9, 10, 11 ve 12 koloni ile korele önceki kýsýmda saymak gösterilir. Yok V. parahaemolyticus tedavi ve tedavi edilmezse (unspiked) örneklerinde koloni sayımı örnekleri varlığını işaret vermedi rağmen Lane 1, 2, 3, 4, 5 ve 6 PCR sonuçlarında gösterildiği gibi görünür. Olası bir neden metabolitleri ayıklanan DNA66protein gibi bulaşıcı varlığıdır.

Şekil 20 başarıyla parahaemolyticus V. varlığı çivili ve unspiked örnekleri oluşan tedavi grubunda belirlenen gelişmiş DNA biyoalgılayıcı kullanarak algılama sonuçlarını özetler. Bu sonuçlar olumlu daha önce tartıılan PCR sonuçları ile aralarındaki ilişkileri belirlemektir. Olumlu sonuçlar gösterdi PCR her örneği AuNP tabanlı, elektrokimyasal biyoalgılayıcı PLA-sağlamlık yöntemi kullanarak keşfedildi ve DPV pik alanı açıkça elde edilen PCR yoğunluk grupları ile (Şekil 19 ve denk Şekil 20). Bu sonuçlar bu nedenle PCR için sonuçları orijinalliğini etkisi ile üstün olduğunu kanıtlamak gerçek örneklerde bu çalışmada önerilen nanoparçacık tabanlı elektrokimyasal sensörü parahaemolyticus V. tespit başarıyla gösteriyor.

Figure 1
Resim 1 : Absorbans PLA-AuNPs Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : X-ışını kırınım spektrum PLA-AuNPs. Ref. [30] izniyle uyarlanmıştır. Telif hakkı (2016) Sociedade Brasileira de Química. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : TEM frekans çapı dağılımı ve PLA-AuNPs imge vasıl bir ölçüm ölçek 50 nm. Ref. [30] izni ile yayımlanmaktadır. Telif hakkı (2016) Sociedade Brasileira de Química. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : EDX spectra ve (a) çıplak SPCE ve (b) SPCE/PLA-AuNPs FESEM görüntüleri. Ref. [30] izni ile yayımlanmaktadır. Telif hakkı (2016) Sociedade Brasileira de Química. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5 : En yüksek tarama hızı kare kökü ve çevrimsel voltammograms karşı geçerli oksidasyon Arsa: (a) çıplak SPCE ve (b) SPCE/PLA-AuNPs 1.0 mmol L-1 içinde K3[Fe(CN)6] (pH 7). 300, 250, 200, 150, 100 ve 50 mV s tarama oranları vardı1. Ref. [30] izniyle uyarlanmıştır. Telif hakkı (2016) Sociedade Brasileira de Química. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6 : Empedans spectra 1.0 mmol L-1 içinde modifiye elektrot K 3 [Fe(CN)6] (pH 7). Genlik: 5 mV ve frekans aralığı: 0.1-105 Hz. uyarlama izniyle ref. [22]. Telif hakkı (2016) Elsevier. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 7
Şekil 7 : Anodik en yüksek akımı modifiye elektrot 1.0 mmol L-1 K 3 [Fe(CN)6] (pH 7) 0.1 V s tarama oranında -1 çevrimsel voltammetry ölçüm kullanarak Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 8
Şekil 8 : SPCE/PLA-AuNPs üzerinde ssDNA immobilizasyon 0.1 mol L-1 içinde konsantrasyona etkisini PBS (pH 7) tarama hesaplı 0.1 V s -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 9
Şekil 9 : SPCE/PLA-AuNPs 0,1 mol L içinde ssDNA immobilizasyon zaman etkisi -1 PBS (pH 7) 0.1 V s tarama oranında -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 10
Şekil 10 : SPCE/PLA-AuNPs 0.1 V s tarama oranında ssDNA immobilizasyon sıcaklık etkisi -1 0,1 mol L -1 PBS (pH 7) bir kuluçka süresi 30 dk içinde 20 µM diferansiyel puls voltammetry ölçüm kullanarak MB sonra Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 11
Şekil 11 : SPCE/PLA-AuNPs/ssDNA 0,1 mol L içinde hibridizasyon zaman etkisi -1 PBS (pH 7) 0.1 V s tarama oranında -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 12
Şekil 12 : SPCE/PLA-AuNPs/ssDNA 0,1 mol L içinde hibridizasyon sıcaklık etkisi -1 PBS (pH 7) 0.1 V s tarama oranında -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB. Ref. [22] izni ile yayımlanmaktadır. Telif hakkı (2016) Elsevier. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 13
Şekil 13 : Histogram 0,1 mol L DNA'ın farklı türleri kullanarak geçerli MB azaltma tepe -1 PBS (pH 7) 0.1 V s tarama oranında -1 30 dk kuluçka 20 µM MB içinde sonra. İlave fark darbe voltammograms aynı koşullarda göstermektedir. Ref. [22] izni ile yayımlanmaktadır. Telif hakkı (2016) Elsevier. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 14
Şekil 14 : Histogram MB azaltma tepe 0,1 mol L farklı DNA toplama kullanarak geçerli -1 PBS (pH 7) 0.1 V s tarama oranında -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB. Ref. [22] izni ile yayımlanmaktadır. Telif hakkı (2016) Elsevier. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 15
Şekil 15 : Azaltılması bir doğrusal arsa zirve geçerli MB 0,1 mol L farklı DNA konsantrasyon günlük karşı -1 PBS (pH 7) 0.1 V s tarama oranında -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB. Ref. [22] izni ile yayımlanmaktadır. Telif hakkı (2016) Elsevier. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 16
Şekil 16 : SPCE/PLA-AuNPs/ssDNA 6 ayda depolama aralığının farklı hibridizasyon sıcaklık etkisi (n = 3). Ölçümleri yapıldı 0,1 mol L-1 0.1 V s tarama oranında PBS (pH 7)-1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB. Ref. [22] izni ile yayımlanmaktadır. Telif hakkı (2016) Elsevier. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 17
Şekil 17 : Özel jel elektroforez-PCR güçlendirme 16S rRNA gen sıralama ürünler bakteri kültüründen seçili bakterilerin kullanarak. Lane M: 1kb DNA merdiven, Lane C−: negatif kontrol (steril distile su), Lane c +: pozitif kontrol (DNA elde E. coli şablon olarak kullanılır), Lane EC: E. coli O157: H7, Lane CJ: C. jejuni , Lane M.Ö.: B. cereus, Lane KP: K. pnömoni, Lane ST: S. typhimurium, Lane LM: L. Monositogenez, Lane SE: S. enterit, Lane VP: V. parahaemolyticus ve Lane VV: alginolyticus V. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 18
Şekil 18 : Histogram MB azaltma maksimum akım DNA biyoalgılayıcı 0,1 mol L çeşitli gıda kaynaklı patojenler karşı olan çalışma için -1 PBS (pH 7) 0.1 V s tarama oranında -1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB. Ref. [23] izni ile yayımlanmaktadır. Telif hakkı (2017) Springer. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 19
Şekil 19 : Özel jel elektroforez-PCR güçlendirme ürünleri Parahaemolyticus V. taze cockle örneklerinden. Lane M: 2ul 100 bp DNA merdivenin, Lane 1-3: unspiked örnekleri, Lane 4-6 tedavi edilmezse: unspiked örnekleri, Lane 7-9 tedavi: çivili örnekleri, Lane 10-12 tedavi edilmezse: çivili örnekleri, Lane c + tedavi: pozitif kontrol (parahaemolyticus V. ATCC 17802), Lane C-: denetim (steril distile su) negatif. Ref. [23] izni ile yayımlanmaktadır. Telif hakkı (2017) Springer. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 20
Şekil 20 : MB azaltma maksimum tespiti için akım histogramını Parahaemolyticus taze cockle örneklerinde DNA biyoalgılayıcı 0,1 mol L içinde kullanarak-1 0.1 V s tarama oranında PBS (pH 7)-1 sonra 20 µM 30 dk kuluçka diferansiyel puls voltammetry ölçüm kullanarak MB. Ref. [23] izni ile yayımlanmaktadır. Telif hakkı (2017) Springer. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Elektrot kompozisyon Kuluçka süresi (h) Sıcaklık (° C) Büyüme medya
Campylobacter jejuni 48 42 BA / BB
Listeria Monositogenez 48 30 TSA / TEKERLEKLİ SANDALYE BASKETBOLU
Salmonella typhimurium 24 37 TSA / TEKERLEKLİ SANDALYE BASKETBOLU
Salmonella enteritidis 24 37 TSA / TEKERLEKLİ SANDALYE BASKETBOLU
Klebsiella pnömoni 24 37 EMBAT / TEKERLEKLİ SANDALYE BASKETBOLU
Escherichia coli O157: H7 24 37 MA / TEKERLEKLİ SANDALYE BASKETBOLU
Bacillus cereus 24 37 MYPA / TEKERLEKLİ SANDALYE BASKETBOLU
Vibrio alginolyticus 24 37 TSA + % 3 NaCl/TSB+3% NaCl
Vibrio parahaemolyticus 24 37 CA/TSA+3% NaCl/TSB+3% NaCl

Tablo 1: Kültür koşullar seçilen bakteri.

Örnek Poz [° 2.] FWHM [° 2.] d-aralığı [Å] Crystallite boyutu (nm)
PLA-AuNPs 31.682 0.3149 2.8243 27

Tablo 2: PLA-AuNP crystallites boyutu. Uyarlama izniyle ref. [30]. Telif hakkı (2016) Sociedade Brasileira de Química.

Modifiye elektrot % RSD (n = 6) Sinyal azaltma (%) (n = 20)
Tekrarlanabilirliği Tekrarlanabilirlik
SPCE/PLA-AuNPs 4.26 4.05 18

Tablo 3: modifiye elektrot k AuNPs ve PLA-AuNPs değişikliği ile ilgili özellikleri 3 [Fe(CN)6] 1.0 mmol L ile -1 tarama hızı 0.1 V s konsantrasyonu -1 . Ref. [30] izniyle uyarlanmıştır. Telif hakkı (2016) Sociedade Brasileira de Química.

Elektrot kompozisyon Benpa (µA) Epa Seçicilik oranı (%)
(n = 3) (V)
SPCE/PLA-AuNP/sonda DNA 4.79 ± 0.10 -0.46 -
SPCE/PLA-AuNP/sigara-tamamlayıcı DNA 3.25 ± 0,12 -0.44 67.85
SPCE/PLA-AuNP/3-üsleri eşleşmeyen DNA 1,05 ± 0,11 -0.45 21.92
SPCE/PLA-AuNP/1-temel eşleşmeyen DNA 0,94 ± 0,12 -0.46 19.62
SPCE/PLA-AuNP/tamamlayıcı DNA 0,73 ± 0.10 -0.45 15,24

Tablo 4: DPV selectivity MB maksimum akım 0,1 mol L -1 PBS (pH 7) 0.1 V s tarama oranında -1 30 dk kuluçka içinde 20 µM MB sonra

Elektrotlar bileşimi Algılama yöntemi Doğrusal aralığı (M) Algılama sınırı (M) Referanslar
3D AuNPs DPV 1.5 × 10-6 - 7.0 × 10-9 2.0 × 10-10 69
(+) AuNPs DPV 1,0 × 10-9 - 1.5 × 10-12 2.6 × 10-12 70
AuNPs/GR DPV 1.3 × 10-9 - 2.5 × 10-11 8.3 × 10-12 71
AuNPs-ADH-GSs DPV 5.0 × 10-8 - 3.0 × 10-13  3.0 × 10-13 72
AuNPs-MPTS DPV 5.0 × 10-9 - 1,0 × 10-11  5.0 × 10-11 73
AuNPs-git DPV 1,0 × 10-9 - 1,0 × 10-14 3,5 × 10-15 74
Çünkü / AuNPs DPV 1,0 × 10-9 - 1,0 × 10-12 7.0 × 10-13 75
PLA-AuNPs DPV 2.0 × 10-8 - 2.0 × 10-13 5.3 × 10-12 Bu eser

Tablo 5: Bazı son zamanlarda geliştirilen elektrokimyasal DNA nanosensors karşılaştırılması. Ref. [22] izni ile yayımlanmaktadır. Telif hakkı (2016) Elsevier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bir dönüştürücü (nükleik asit veya DNA burada) için uygun biyolojik tanıma öğeler seçimi, elektrokimyasal biyoalgılayıcı bu tip başarılı geliştirme için bir çerçeve içinde önemli adımlardır dönüştürücü algılama tabakası oluşturmak için kimyasal bir yaklaşım; iletim malzeme; DNA immobilizasyon ve hibridizasyon duruma getirilmesi; ve gerçek numuneleri kullanılarak geliştirilen biyoalgılayıcı doğrulama.

Hassas ve seçici elektrokimyasal DNA biyoalgılayıcı başarılı gelişimine çekirdek, immobilizasyon ve hibridizasyon durumun en iyi duruma getirme. Bu çalışmada, biz karmaşık redoks MB kullanılır. MB-DNA etkileşimleri çeşitli ilkeleri şunlardır: (i) Elektrostatik etkileşim MB katyonik gider fosfat omurga anyonik ücretli ssDNA ve dsDNA; (II) G-C baz çifti dsDNA olarak alternatif arasında başarılı ekleme MB ile MB enterkalasyon tarafından; (III) hedef ssDNA sonuna kovalent bağ tarafından hangi düşük etiket yoğunluğu (bir ya da iki MB moleküller DNA dizisi başına); üretir (iv) ile ilişkisiz bir guanin ssDNA içinde temel MB etkileşimler tarafından. Biz doğru reaktivite bakteri ve taze istiridye çapraz parahaemolyticus V. üzerinden tanımlar dördüncü ilke uygulanır. Sonra oksitlenmeye özel ilgi MB ve ssDNA arasında daha güçlü bir yakınlık vardı. Hibridizasyon ssDNA tamamlayıcı, sıra ile gümrüklü MB moleküllerin yerini alır ve böylece sinyal azaltır.

Deneysel sonuçlar yukarıda sunulan dizi parahaemolyticus V. yüksek seçicilik ve DNA hibridizasyon kullanılmasının duyarlılık ile algılama hızlı bir yöntem geliştirilmesi üzerinde duruluyor. Sentez ve karakterizasyonu polylactic asit-sağlamlık altın nano tanecikleri (PLA-AuNPs) (rakamlar 1-6 ve Tablo 2) elektrot modifikasyonu için ilk adımdır. Altın nano tanecikleri kalitesini kullanarak görünür morötesi Spektroskopi (UV-VIS), x-ışını kırınım (XRD), alan emisyon Scanning elektron mikroskobu (FESEM), transmisyon elektron mikroskobu (TEM), çevrimsel Voltammetry (CV) değerlendirildi ve Empedans analiz. Geliştirme ikinci bölümü çıplak elektrot göre modifiye elektrot başarılı geliştirme belirlenen modifiye elektrot (rakamlar 7-12 ve Tablo 3-4) elektrokimyasal bir karakterizasyonu dahil hibridizasyon olay algılama koşulları.

Üçüncü adım temel DNA biyoalgılayıcı geliştirme hibridizasyon olay deneysel koşullar optimizasyonu ve gelişmiş biyoalgılayıcı uygulamaya gerçek patojen (Şekil 13-20) algılama dayanıyordu. Patojen tespiti başarısı belirlenen hibridizasyon olay fark nabız voltammetry (DPV) kullanarak değerlendirildi. Hedeflenen patojen olumlu varlığını geçerli bir azalma ile belirtilmiştir. Gelişmiş biyoalgılayıcı duyarlılığını kalibrasyon Arsa İnşaat ve LOD (Şekil 15) hesaplanması ile değerlendirilmiştir. Fabrikasyon biyoalgılayıcı özellikle parahaemolyticus V. geçerli azaltma (rakamlar 17 ve 18) farklı düzeylerine göre diğer patojenleri ayırmak başardı. Gelişmiş biyoalgılayıcı parahaemolyticus V. tespiti gerçek gıda örnek fizibilite değerlendirilmesi rakamlar 19 ve 20 sunulur ve hedeflenen patojen olumlu varlığını geçerli azaltma tarafından belirtilir . DNA tabanlı biyosensörler başarılı gelişimi DNA prob seçimi, geliştirme modifiye elektrot yanı sıra deneysel koşullar getirilmesi son derece bağlıdır. DNA prob burada Nakano67önceki işten adapte edilmiş. Geliştirme modifiye elektrot nanosize standardizasyonu sağlamak için altın nano tanecikleri polylactic asit ile stabilize kullanılarak gerçekleştirildi. Altın nano tanecikleri fonksiyonu olarak elektro katalitik malzeme68 ve hareket elektron transfer oranını artırmak ve ayrıca hangi DNA prob tutturmak bir yüzey sağlar. Deneysel parametreleri forma çift yönlü DNA örneği almak için çok önemli olan sıcaklık ve kuluçka zaman açısından optimize. Hibridizasyon sıcaklık sensörünün seçicilik non-spesifik adsorpsiyon ile bu artışları arasındaki mesafeyi etkiler. Hibridizasyon kuluçka süresi çift yönlü oluşumu olasılığını artıracaktır. İmmobilizasyon yordamı DNA prob oluşturmak için çift yönlü oluşumu için uygun yönde olacak emin olmak için optimize edilmiş olması gerekir.

Örnek bir Tablo 5 karşılaştırır son zamanlarda elektrokimyasal DNA biyosensörler69,70,71,72,73,74,75 geliştirilen ,. DNA tabanlı biosensing önce yöntem için yerinde kullanımı taşınabilir olabilir, ele alınması gereken bazı sınırlamalar olmakla moleküler tabanlı teknikleri eski yerine koymak için umut verici bir yöntemdir. Örnek işleme DNA ekstraksiyon saflık olarak ana sınırlamasıdır ve ücreti çıkarılan DNA miktarı standart laboratuar tabanlı yöntemi tarafından çıkarılan kadar iyi olması muhtemel değildir. PCR ve jel elektroforez mikrosıvısal gibi örnek tedavi öncesi sistemi ile değiştirilebilir, ancak, umut verici bir alternatif var.

Biyosensörler DNA tabanlı tıbbi teşhis, çevresel izleme ve gıda kontrolü de dahil olmak üzere birçok uygulama için potansiyel olarak yararlı olur. Bu teknik bakım noktası hastalarının izlenmesi gibi online kalite kontrol işlemleri izleme olanak sağlar. Bütün sensör sistemi taşınabilirliği tanılama işlemleri nerede tüketici-ebilmek kullanma algılama sistemi kendi ev konforunda yerelleşme sağlayacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Yazarlar Universiti Putra Malezya destek kabul etmek istiyorum.

Materials

Name Company Catalog Number Comments
Acetic acid Merck 100056
Chloroform Merck 102445
Diaminoethane tetraacetic acid Promega E5134
Dibasic sodium phosphate  Sigma-Aldrich S9763
Disodium hydrogen phosphate Sigma-Aldrich 255793
Ethanol  Sigma-Aldrich 16368
Gold (III) chloride trihydrate Sigma-Aldrich 520918
Hydrochloric acid Merck 100317
Methylene blue Sigma-Aldrich M44907
Monobasic sodium phosphate, monohydrate Sigma-Aldrich S3522
Phosphate-buffered saline Sigma-Aldrich P5119
Poly(lactic acid) resin, commercial grade 4042D NatureWorks 4042D
Potassium chloride R&M Chemicals 59435
Potassium dihydrogen phosphate Sigma-Aldrich P9791
Potassium hexacyanoferrate III R&M Chemicals 208019
Sodium acetate anhydrous salt Sigma-Aldrich S2889
Sodium chloride Sigma-Aldrich S9888
Trisodium citrate Sigma-Aldrich S1804
Tris(hydroxymethyl) aminomethane Fisher Scientific T395-100
Tris-Base Fisher Scientific BP152-500
2X PCR Master Mix with Dual-Dye Norgen Biotek 28240
Agarose gel Merck 101236
Bolton Agar Merck 100079
Bolton Broth Merck 100079
CHROMagar Vibrio CHROMagar VB910
dNTPs Promega U1511
Nuclease-free water Thermo Scientific R0581
Eosin methylene blue agar  Merck 101347
GelRed Biotium 41001
Glycerol Merck 104092
Go Taq Buffer Promega M7911
Loading dye 100 bp DNA ladder Promega G2101
Loading dye 1kb DNA ladder Promega G5711
Magnesium chloride Promega 91176
Mannitol egg yolk polymyxin agar Merck 105267
McConkey Agar Merck 105465
Nutrient Broth Merck 105443
Taq polymerase Merck 71003
Trypticase Soy Broth Merck 105459
Trypticase Soy Agar Merck 105458

DOWNLOAD MATERIALS LIST

References

  1. Gould, L. H., Rosenblum, I., Nicholas, D., Phan, Q., Jones, T. F. Contributing factors in restaurant-associated foodborne disease outbreaks, FoodNet sites, 2006 and 2007. Journal of Food Protection. 76, 1824-1828 (2013).
  2. Arvanitoyannis, I. S., Kotsanopoulos, K. V., Papadopoulou, A. Rapid detection of chemical hazards (toxins, dioxins, and PCBs) in seafood. Critical Reviews in Food Science and Nutrition. 54, 1473-1528 (2014).
  3. Robertson, L. J., Sprong, H., Ortega, Y. R., van der Giessen, J. W. B., Fayer, R. Impacts of globalisation on foodborne parasites. Trends in Parasitology. 30, 37-52 (2014).
  4. Sandilands, E. A., Bateman, D. N. The epidemiology of poisoning. Medicine. 44, 76-79 (2016).
  5. Boschi-Pinto, C., Velebit, L., Shibuya, K. Estimating child mortality due to diarrhoea in developing countries. Bulletin of the World Health Organization. 86, 710-717 (2008).
  6. Farthing, M. J. G. Diarrhoea: A Significant Worldwide Problem. International Journal of Antimicrobial Agents. 14, 65-69 (2000).
  7. World Health Organization. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015. 1-255 (2015).
  8. Yeung, M., Boor, K. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease. 1, 74-88 (2004).
  9. Sakazaki, R. Foodborne Diseases. Cliver, D. O., Riemann, H. P. Academic Press. 127-136 (2002).
  10. Grochowsky, J., Odom, S. R., Akuthota, P., Stead, W. Primary Septicemia and Abdominal Compartment Syndrome From Vibrio parahaemolyticus Infection in a 40-Year-Old Patient With No Known Immunocompromise. Infectious Disease in Clinical Practice. 22, (2013).
  11. Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Frontiers in Microbiology. 5, 805 (2014).
  12. Kalburge, S. S., Whitaker, W. B., Boyd, E. F. High-Salt Preadaptation of Vibrio parahaemolyticus Enhances Survival in Response to Lethal Environmental Stresses. Journal of Food Protection. 77, 246-253 (2014).
  13. Esteves, K., Hervio-Heath, D., Mosser, T., Rodier, C., Tournoud, M. G., Jumas-Bilak, E., Colwell, R. R., Monfort, P. Rapid proliferation of Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae during freshwater flash floods in French Mediterranean Coastal lagoons. Applied and Environmental Microbiology. 81, 7600-7609 (2015).
  14. Khandeparker, L., Anil, A. C., Naik, S. D., Gaonkar, C. C. Daily variations in pathogenic bacterial populations in a monsoon influenced tropical environment. Marine Pollution Bulletin. 96, 337-343 (2015).
  15. Caburlotto, G., Suffredini, E., Toson, M., Fasolato, L., Antonetti, P., Zambon, M., Manfrin, A. Occurrence and molecular characterization of Vibrio parahaemolyticus in crustaceans commercialised in Venice area, Italy. International Journal of Food Microbiology. 220, 39-49 (2016).
  16. Wong, H. C., Chen, M. C., Liu, S. H., Liu, D. P. Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries. International Journal of Food Microbiology. 52, 181-188 (1999).
  17. Rosec, J. P., Causse, V., Cruz, B., Rauzier, J., Carnat, L. The international standard ISO/TS 21872-1 to study the occurence of total and pathogenic Vibrio parahaemolyticus and Vibrio cholerae in seafood: ITS improvement by use of a chromogenic medium and PCR. International Journal of Food Microbiology. 157, 189-194 (2012).
  18. Maniyankode, R. A., Kingston, J. J., Murali, H. S., Batra, H. V. Specific identification of vibrio parahaemolyticus employing monoclonal antibody based immunoassay. International Journal of Pharmacy and Biological Sciences. 4, (2), B156-B164 (2013).
  19. Suffredini, E., Lopez-Joven, C., Maddalena, L., Croci, L., Roque, A. Pulsed-field gel electrophoresis and PCR characterization of environmental Vibrio parahaemolyticus strains of different origins. Applied and Environmental Microbiology. 77, 6301-6304 (2011).
  20. Bhattacharyya, N., Hou, A. A pentaplex PCR assay for detection and characterization of Vibrio vulnificus and Vibrio parahaemolyticus isolates. Letters in Applied Microbiology. 57, 233-240 (2013).
  21. da Silva, E. T. S. G., et al. Electrochemical Biosensors in Point-of-Care Devices: Recent Advances and Future Trends. ChemElectroChem. 4, (4), 778-794 (2017).
  22. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. Sensitive detection of multiple pathogens using a single DNA probe. Biosensors and Bioelectronics. 86, 398-405 (2016).
  23. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. A simple, portable, electrochemical biosensor to screen shellfish for Vibrio parahaemolyticus. AMB Express. 7, (1), 41 (2017).
  24. Zhang, J., Li, Z., Zhang, H., Wang, J., Liu, Y., Chen, G. Rapid detection of several foodborne pathogens by F0F1-ATPase molecular motor biosensor. Journal of Microbiological Methods. 93, 37-41 (2013).
  25. Barsan, M. M., Ghica, E. M., Brett, C. M. A. Portable biosensing of food toxicants and environmental pollutants. Nikolelis, D. P., Varzakas , T., Erdem, A., Nikoleli, G. P. CRC Press, Taylor & Francis Group. Boca Raton. 33-69 (2014).
  26. Kwun, J., Yun, S., Park, L., Lee, J. H. Development of 1,1'-oxalyldiimidazole chemiluminescent biosensor using the combination of graphene oxide and hairpin aptamer and its application. Talanta. 119, 262-267 (2014).
  27. Thavanathan, J., Huang, N. M., Thong, K. L. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms. International Journal of Nanomedicine. 10, 2711-2722 (2015).
  28. Hushiarian, R., Yusof, N. A., Abdullah, A. H., Ahmad, S. A. A., Dutse, S. W. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase. Analytical Chemistry Research. 6, 17-25 (2015).
  29. Dutse, S. W., Yusof, N. A., Ahmad, H., Hussein, M. Z., Zainal, Z., Hushiarian, R., Hajian, R. An Electrochemical Biosensor for the Determination of Ganoderma boninense Pathogen Based on a Novel Modified Gold Nanocomposite Film Electrode. Analytical Letters. 47, (5), 819-832 (2014).
  30. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hajian, R. Characterization of Polylactide-Stabilized Gold Nanoparticles and Its Application in the Fabrication of Electrochemical DNA Biosensors. Journal of the Brazilian Chemical Society. 27, (9), 1679-1686 (2016).
  31. Vongkamjan, K., Wang, S., Moreno Switt, A. I. Rapid detection of foodborne bacterial pathogens in seafood. Handbook of Seafood: Quality and Safety Maintenance and Applications. 247-257 (2016).
  32. Wang, F., Jiang, L., Yang, Q., Han, F., Chen, S., Pu, S., Vance, A., Ge, B. Prevalence and antimicrobial susceptibility of major foodborne pathogens in imported seafood. Journal of Food Protection. 74, (9), 1451-1461 (2011).
  33. Szermer-Olearnik, B., Sochocka, M., Zwolinska, K., Ciekot, J., Czarny, A., Szydzik, J., Kowalski, K., Boratynski, J. Comparison of microbiological and physicochemical methods for enumeration of microorganisms. Postepy Higieny i Medycyny Doswiadczalnej. 68, 1392-1396 (2014).
  34. Ivanov, I. G., Bachvarov, D. R. Determination of plasmid copy number by the "boiling" method. Analytical Biochemistry. 165, (1), 137-141 (1987).
  35. Gopireddy, V. R. Biochemical tests for the identification of bacteria. International Journal of Pharmacy and Technology. 3, (4), 1536-1555 (2011).
  36. Böhme, K., Fernández-No, I. C., Pazos, M., Gallardo, J. M., Barros-Velázquez, J., Cañas, B., Calo-Mata, P. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting. Electrophoresis. 34, (6), 877-887 (2013).
  37. Seoudi, R., Fouda, A. A., Elmenshawy, D. A. Synthesis, characterization and vibrational spectroscopic studies of different particle size of gold nanoparticle capped with polyvinylpyrrolidone. Physica B: Condensed Matter. 405, 906-911 (2010).
  38. Mishra, A., Harper, S., Yun, S. I. Interaction of biosynthesized gold nanoparticles with genomic DNA isolated from E. coli and S. aureus. Nanotechnology (IEEE-NANO). 1745-1750 (2011).
  39. Sugimoto, T. Formation of modoispersed nano- and micro-particles controlled in size, shape, and internal structure. Chemical Engineering and Technology. 26, 313-321 (2003).
  40. Rath, C., Sahu, K. K., Kulkarni, S. D., Anand, S., Date, S. K., Das, R. P., Mishra, N. C. Microstructure-dependent coercivity in monodispersed hematite particles. Applied Physics Letters. 75, 4171-4173 (1999).
  41. Abbas, M., Wu, Z. Y., Zhong, J., Ibrahim, K., Fiori, A., Orlanducci, S., Sessa, V., Terranova, M. L., Davoli, I. X-ray absorption and photoelectron spectroscopy studies on graphite and single-walled carbon nanotubes: Oxygen effect. Applied Physics Letters. 87, (5), 051923 (2005).
  42. Lim, S. C., Choi, Y. C., Jeong, H. J., Shin, Y. M., An, K. H., Bae, D. J., Lee, Y. H., Lee, N. S., Kim, J. M. Effect of gas exposure on field emission properties of carbon nanotubes arrays. Advanced Materials. 13, 1563-1567 (2001).
  43. Kim, B. H., Kim, B. R., Seo, Y. G. A study on adsorption equilibrium for oxygen and nitrogen into carbon nanotubes. Adsorption. 11, 207-212 (2005).
  44. Bard, A. J., Faulkner, L. R. Electrochemical methods: Fundamentals and applications. John Wiley & Sons Inc. (2000).
  45. Tan, Q., Wang, L., Ma, L., Yu, H., Ding, J., Liu, Q., Xiao, A., Ren, G. Study on anion electrochemical recognition based on a novel ferrocenyl compound with multiple binding sites. Journal of Physical Chemistry B. 112, 11171-11176 (2008).
  46. Manivannan, S., Ramaraj, R. Polymer-embedded gold and gold/silver nanoparticle-modified electrodes and their applications in catalysis and sensors. Pure and Applied Chemistry. 83, 2041-2053 (2011).
  47. Benali, O., Larabi, L., Traisnel, M., Gengembre, L., Hareka, Y. Electrochemical, theoretical and XPS studies of 2-mercapto-1-methylimidazole adsorption on carbon steel in 1 M HClO4. Applied Surface Science. 253, 6130-6139 (2007).
  48. Shi, Y., Wen, L., Li, F., Cheng, H. M. Nanosized Li4Ti5O12/graphene hybrid materials with low polarization for high rate lithium ion batteries. Journal of Power Sources. 196, 8610-8617 (2011).
  49. Bentiss, F., Traisnel, M., Lagrenee, M. The substituted 1,3,4-oxadiazoles: a new class of corrosion inhibitors of mild steel in acidic media. Corrosion Science. 42, 127-146 (2000).
  50. Wang, M., Gong, W., Meng, Q., Zhang, Y. Electrochemical DNA impedance biosensor for the detection of DNA hybridization with polymeric film, single walled carbon nanotubes modified glassy carbon electrode. Russian Journal of Electrochemistry. 47, 1368-1373 (2011).
  51. Herdt, A. R., Drawz, S. M., Kang, Y., Taton, T. A. DNA dissociation and degradation at gold nanoparticle surfaces. Colloids and Surfaces B: Biointerfaces. 51, (2), 130-139 (2006).
  52. Bhatt, N., Huang, P. J. J., Dave, N., Liu, J. Dissociation and degradation of thiol-modified DNA on gold nanoparticles in aqueous and organic solvents. Langmuir. 27, 6132-6137 (2011).
  53. Liu, X., Jang, C. H., Zheng, F., Jürgensen, A., Denlinger, J. D., Dickson, K. A., Raines, R. T., Abbott, N. L., Himpsel, F. J. Characterization of protein immobilisation at silver surfaces by near edge X-ray absorption fine structure spectroscopy. Langmuir. 22, 7719-7725 (2006).
  54. Willey, T. M., Andrew, L., Vance, T., Buuren, V., Bostedt, C., Terminello, L. J., Fadley, C. S. Rapid degradation of alkanethiol-based self-assembled monolayers on gold in ambient laboratory conditions. Surface Science. 576, (1), 188-196 (2005).
  55. Farjami, E., Clima, L., Gothelf, K., Ferapontova, E. E. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific. Analyst. 135, 1443-1448 (2010).
  56. Lin, X., Ni, Y., Kokot, S. An electrochemical DNA-sensor developed with the use of methylene blue as a redox indicator for the detection of DNA damage induced by endocrine-disrupting compounds. Analytica Chimica Acta. 867, 29-37 (2015).
  57. Zhang, F. T., Nie, J., Zhang, D. W., Chen, J. T., Zhou, Y. L., Zhang, X. X. Methylene Blue as a G-Quadruplex Binding Probe for Label-Free Homogeneous Electrochemical Biosensing. Analytical Chemistry. 86, 9489-9495 (2014).
  58. Ning, L., Li, X., Yang, D., Miao, P., Ye, Z., Li, G. Measurement of Intracellular pH Changes Based on DNA-Templated Capsid Protein Nanotubes. Analytical Chemistry. 86, 8042-8047 (2014).
  59. Sani, N. D. M., Heng, L. Y., Surif, S., Lazim, A. M., et al. AIP Conference Proceedings. Murad, A., et al. 1571, 636-640 (2013).
  60. Xu, P., Wang, J., Xu, Y., Chu, H., Shen, H., Zhang, D., Zhao, M., Liu, J., Li, G. Binding modes and interaction mechanism between different base pairs and methylene blue trihydrate: a quantum mechanics study. Advances in Experimental Medicine and Biology. 827, 187-203 (2015).
  61. Guo, Y., Chen, J., Chen, G. A label-free electrochemical biosensor for detection of HIV related gene based on interaction between DNA and protein. Sensors & Actuators, B: Chemical. 184, 113-117 (2013).
  62. Huang, K. J., Liu, Y. J., Wang, H. B., Wang, Y. Y., Liu, Y. M. Sub-femtomolar DNA detection based on layered molybdenum disulfide/multi-walled carbon nanotube composites, au nanoparticle and enzyme multiple signal amplification. Biosensors and Bioelectronics. 55, 195-202 (2014).
  63. Kong, R. M., Song, Z. L., Meng, H. M., Zhang, X. B., Shen, G. L., Yu, R. Q. A label-free electrochemical biosensor for highly sensitive and selective detection of DNA via a dual-amplified strategy. Biosensors and Bioelectronics. 54, 442-447 (2014).
  64. Rashid, J. I. A., Yusof, N. A., Abdullah, J., Hashim, U., Hajian, R. Novel Disposable Biosensor Based on SiNWs/AuNPs Modified-Screen Printed Electrode for Dengue Virus DNA Oligomer Detection. IEEE Sensors Journal. 15, 4420-4421 (2015).
  65. Yingkajorn, M., Sermwitayawong, N., Palittapongarnpimp, P., Nishibuchi, M., Robins, W. P., Mekalanos, J. J., Vuddhakul, V. Vibrio parahaemolyticus and its specific bacteriophages as an indicator in cockles (Anadara granosa) for the risk of V. parahaemolyticus infection in Southern Thailand. Microbial Ecology. 67, 849-856 (2014).
  66. Ahmad Ganaie, H., Ali, M. N. Short term protocol for the isolation and purification of DNA for molecular analysis. International Journal of Pharmaceutical Sciences Review and Research. 24, 266-270 (2014).
  67. Nakano, K., Kimura, T., Kitamura, Y., Ihara, T., Ishimatsu, R., Imato, T. Potentiometric DNA sensing platform using redox-active DNA probe pair for sandwich-type dual hybridization at indicator electrode surface. Journal of Electroanalytical Chemistry. 720-721, 71-75 (2014).
  68. Yang, J., Jim Yang, L., Heng-Phon, T., Gan-Moog, C. Inhibition of DNA hybridization by small metal nanoparticles. Biophysical Chemistry. 120, 87-95 (2006).
  69. Niu, L. M., Liu, F., Wang, W., Lian, K. Q., Ma, L., Shi, H. M., Kang, W. J. Electrochemical Behavior of Paraquat on a Highly Ordered Biosensor Based on an Unmodified DNA-3D Gold Nanoparticle Composite and Its Application. Electrochimica Acta. 153, 190-199 (2015).
  70. Li, Z., Miao, X., Xing, K., Zhu, A., Ling, L. Enhanced electrochemical recognition of double-stranded DNA by using hybridization chain reaction and positively charged gold nanoparticles. Biosensors and Bioelectronics. 74, 687-690 (2015).
  71. Niu, S., Sun, J., Nan, C., Lin, J. Sensitive DNA biosensor improved by 1,10-phenanthroline cobalt complex as indicator based on the electrode modified by gold nanoparticles and graphene. Sensors and Actuators B: Chemical. 176, 58-63 (2013).
  72. Yi, H., Xu, W., Yuan, Y., Bai, L., Wu, Y., Chai, Y., Yuan, R. A pseudo triple-enzyme cascade amplified aptasensor for thrombin detection based on hemin/G-quadruplex as signal label. Biosensors and Bioelectronics. 54, 415-420 (2014).
  73. Das, R., Sharma, M. K., Rao, V. K., Bhattacharya, B. K., Garg, I., Venkatesh, V., Upadhyay, S. An electrochemical genosensor for Salmonella typhi on gold nanoparticles-mercaptosilane modified screen printed electrode. Journal of Biotechnology. 188, 9-16 (2014).
  74. Han, X., Fang, X., Shi, A., Wang, J., Zhang, Y. An electrochemical DNA biosensor based on gold nanorods decorated graphene oxide sheets for sensing platform. Analytical Biochemistry. 443, (2), 117-123 (2013).
  75. Huang, K. J., Liu, Y. J., Zhang, J. Z., Cao, J. T., Liu, Y. M. Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification. Biosensors and Bioelectronics. 67, 184-191 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics