Сайт направлен иммобилизации костных морфогенетических белка 2 для твердых поверхностей по химии нажмите

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Биоматериалов, легированного костных морфогенетических белков 2 (БМП2) использовали как новые терапевтические стратегии для лечения переломов костей не входящих в союз. Для преодоления побочных эффектов в результате неконтролируемого высвобождения фактора, мы предлагаем новую стратегию на сайт-непосредственно иммобилизации фактор, создавая тем самым с расширенными возможностями Остеогенные материалы.

Cite this Article

Copy Citation | Download Citations

Siverino, C., Tabisz, B., Lühmann, T., Meinel, L., Müller, T., Walles, H., Nickel, J. Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry. J. Vis. Exp. (133), e56616, doi:10.3791/56616 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Интенсивно исследуются различные терапевтические стратегии для лечения незаживающих дефектов длинной кости. В настоящее время используется настоящее лечение несколько ограничений, которые привели к использованию биоматериалов в сочетании с Остеогенные факторы роста, такие как костных морфогенетических белков (БМП). Часто используемые методы поглощения или инкапсуляция требуют выше физиологические количество БМП2, что обычно приводит к эффект релиз так называемый первоначальный всплеск, который провоцирует несколько тяжелых побочных эффектов. Возможная стратегия преодоления этих проблем бы ковалентно пара белка на эшафот. Кроме того муфты должны выполняться на основе конкретных для того чтобы гарантировать воспроизводимость продукции результат. Таким образом мы создали БМП2 вариант, в котором искусственного аминокислота (Пропаргиловый L-лизин) было введено в зрелой части белка БМП2 кодон использования расширения (БМП2-K3Plk). БМП2-K3Plk был соединен функционализированных бусины через медные катализируемой азид алкины циклоприсоединения (CuAAC). Биологическая активность спаренных БМП2-K3Plk была доказана в пробирке и Остеогенные активности БМП2-K3Plk-функционализированных бусины было доказано в ячейке на основе анализов. Функционализированных бусы при контакте с C2C12 клетки смогли побудить щелочной фосфатазы (ALP) выражение в локально ограниченных близости из бисера. Таким образом, в этой технике, может производиться функционализированных подмостей, может вызвать дифференцировки клеток к Остеогенные линии. Кроме того более низкие дозы БМП2 достаточно за счет контролируемой ориентации сайта направленных спаренных БМП2. С помощью этого метода БМП, всегда подвергаются их рецепторами на поверхности клеток в соответствующей ориентации, которая не в случае, если факторы соединены через сайт направлен муфты методов. Итоги продукт очень управляемым, и, таким образом, результаты в материалах с однородными свойствами, улучшение их применимость для ремонта критического размера костных дефектов.

Introduction

Конечная цель костной ткани инженерии и костной регенерации является преодолеть недостатки и ограничения, возникающие во время общего лечения переломов не входящих в союз. Авто - или Алло трансплантация преимущественно используются в качестве текущей стратегии терапии, хотя они оба имеют несколько недостатков. Идеальный костного трансплантата должно побудить Остеогенез osteoinduction, а также osteoconduction, ведущих к остеоинтеграции имплантата в кость. В настоящее время только Авто трансплантации рассматривается как «золотой стандарт», так как она обеспечивает все характеристики идеального костного трансплантата. К сожалению он также представляет важные негативные аспекты, такие как длинные операции раз и второй сайт травмы, что обычно влечет за собой больше осложнений (например, хронической боли, гематома образований, инфекции, косметических дефектов и т.д.). Аллогенной графтов, с другой стороны имеют субоптимальные характеристики для всех общие аспекты1. Альтернативные костного трансплантата технологии улучшились за последние несколько лет, с тем чтобы производить строительные леса, которые являются osteoinductive, остеокондуктивных, биологически и салфетка. Поскольку многие биоматериалов не показывают все эти Остеогенные характеристики, различные факторы роста, главным образом БМП2 и BMP7, были включены с целью улучшения Остеогенные потенциал конкретного леса2.

Как важным критерием такие системы доставки фактор роста должны обеспечивать контролируемые дозы выпуска со временем облегчить основные события, как набор ячеек и привязанности, врастание клеток и ангиогенеза. Однако БМП также, как другие Остеогенные факторы роста были обычно прикол non-covalently3. Провокация и адсорбции методы требуют использования выше физиологические количество белка из-за первоначальный всплеск-релиз, который приводит к серьезные недостатки в естественных условиях, обычно влияющих на окружающих тканей, вызывая разрастание костной ткани, 4остеолиза, отек и воспаление. Таким образом сохранение факторов роста на сайте доставки для более длительных периодов времени может быть достиган ковалентной иммобилизации методами. Химически изменены БМП2 (succinylated5, ацетилированный6 или7биотинилированным), инженерии гетеродимерами8или БМП2 производных Олигопептиды9 были разработаны и использованы для преодоления ограничений, связанных с поглощение. Однако био деятельность этих конструкций не является предсказуемым, поскольку соглашение потенциально препятствует привязки иммобилизованных лигандом клеточных рецепторов. Как показано ранее важно, что все четыре цепи рецептора участвует в формировании активированного лиганд рецептор комплексов взаимодействуют с иммобилизованными БМП2 для того, чтобы полностью активировать все ниже по течению сигнальные каскады10.

Для преодоления проблем исход неоднородных продукт с ограничениями с точки зрения биологическую, стабильность и биодоступность подвижности фактора, мы разработали BMP вариант, способный ковалентно привязки подмостей образом ориентированные на сайт. Этот вариант, называется БМП2-K3Plk, состоит из искусственного аминокислоты, который был представлен генетические кодон расширения11. Этот вариант был успешно связаны с подмостей, используя стратегию ковалентная связь при сохранении своей биологической активности.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Производство вариант БМП2 БМП2 K3Plk

  1. Клонирование из БМП2-K3Plk на сайт направленного мутагенеза, используя PCR 12
    1. Усиливают человека зрелого БМП2 (hmBMP2) от вектора p25N-hmBMP2 (см. Таблицу материалы) с вперед грунт (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') и обратный грунт (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') представляя янтаря стоп кодон ( ТЕГ) на позиции первого лизина BMP2´s Пожилая часть. Выполнять с использованием 33.5 мкл H2O, 10 мкл смеси реакции PCR, 1.5 мкл 10 мкм dNTP раствор, 1.5 мкл вперед праймера (10 пмоль/мкл), 1,5 мкл обратного праймера (10 пмоль/мкл), 1 мкл p25N-hmBMP2 (10 нг/мкл) реакции PCR и 1 мкл ДНК-полимеразы (см. Таблицу материалы) в тепловой циклователь (денатурация при 95 ° C за 5 мин, 30 циклов за 1 мин, отжиг при 60 ° C за 1 мин, удлинение 72 ° C за 1 мин и окончательное расширение при 72 ° C для 10 мин денатурации на 95 ° C).
    2. Очистить продукт PCR, использование коммерчески доступных комплект рекомендаций производителя (см. Таблицу материалы).
    3. Дайджест продукт PCR с энзима ограничения NdeI при 37 ° C 45 мин с помощью 16 мкл H2O 3 мкл буфера пищеварение, 10 мкл ДНК (20 нг/мкл) и 1 мкл энзима ограничения. Тепло инактивирует фермент при 65 ° C за 5 мин дайджест продукт PCR с энзима ограничения BamHI при 37 ° C за 1 ч с помощью 16 мкл H2O 3 мкл буфера пищеварение, 10 мкл ДНК (20 нг/мкл) и 1 мкл энзима ограничения. Тепло инактивирует фермент при 80 ° C за 5 мин.
    4. Дайджест вектор pET11a-pyrtRNA с NdeI при 37 ° C на 2 ч. и 45 мин с помощью 16 мкл H2O 3 мкл буфера пищеварение, 10 мкл ДНК (20 нг / мкл) и 1 мкл энзима ограничения. Тепло инактивирует при 65 ° C за 5 мин дайджест вектор pET11a-pyrtRNA с BamHI при 37 ° C за 1 ч с помощью 16 мкл H2O 3 мкл буфера пищеварение, 10 мкл ДНК (20 нг/мкл) и 1 мкл энзима ограничения. Инактивирует тепла при 80 ° C за 5 мин.
    5. Отделить переваривается вектор от непереваренных вектора и пищеварение остатки от агарозы гель электрофореза (0,8% агарозном, 60 мин 100 V). Перевязать переваривается Вставка БМП2-K3TAG с усваивается pET11a-pyrtRNA позвоночника при комнатной температуре (RT) за 2 ч с использованием 100 нг pET11a-pyrtRNA позвоночника и 34,5 нг БМП2-K3TAG вставки (молярное соотношение 1:3). Реакционную смесь содержит ДНК позвоночника и вставки, 2 мкл буфера лигаза, 1 мкл ДНК лигаза, и H2O к общим объемом 20 мкл.
    6. Выполните совместное преобразование pET11a-pyrtRNA БМП2-K3Plk и pSRF дуэт pyrtRNAsynth в BL21(DE3) бактерий:
      1. Добавьте 50 нг каждого плазмида бактерий, поместите смесь на льду на 30 мин, теплового шока при 42 ° C 50 s, место на льду на 5 мин, 500 мкл Lysogeny бульон (LB) среды в смеси и погрозит 300 об/мин, 60 мин.
      2. Распространение 100 мкл бактериальной смеси на подогретым канамицин (50 мкг/мл) / пластины ампициллин (100 мкг/мл) и Инкубируйте на ночь на 37 ° C.
  2. Выражение и очистки БМП2 K3Plk 13 , 14
    1. Пропагандировать единую колонию на ночь в 50 мл среды фунтов с 50 мкг/мл канамицин и 100 мкг/мл ампициллина при 37 ° C.
    2. Разбавить ночь культуры 1:20 в 800 мл среды потрясающий бульон (ТБ), дополнена канамицин 50 мкг/мл и 100 мкг/мл ампициллина и растут при 37 ° C, пока не будет достигнуто ОД600 0,7. Добавьте Пропаргиловый L-лизин в конечной концентрации 10 мм. Соберите 100 мкл пример от культуры до изопропиловый β-D-1-тиогалактопиранозид (IPTG) индукции.
    3. Побудить экспрессии генов путем добавления IPTG до конечной концентрации 1 мм. Растут культуры при 37 ° C для 16 h в орбитальный шейкер на 180 об/мин. Соберите 100 мкл пример от культуры.
    4. Центрифуга целая культура на 9000 x g 30 мин удалить супернатант и Ресуспензируйте бактериальных гранулы в 30 мл TBSE буфера (10 мм трис, 150 мм NaCl, 1 мм Этилендиаминтетрауксусная кислота (ЭДТА)) с 1: 1000 (v/v) 2-меркаптоэтанол (свеже добавлено).
      Предупреждение: Ручка 2-меркаптоэтанол под зонт. Избегайте контакта с кожей и глазами. Избегайте вдыхания паров или туман. Выполните все шаги ресуспендирования с буферов, содержащих 2-меркаптоэтанол под зонт.
    5. Вес пустой центрифуги стакан и передачи ресуспензированы гранулы в пустой стакан. Центрифуга на 6,360 g x 20 мин удалить супернатант и весят стакан с Пелле. Вычтите вес пустой стакан для расчета веса таблетки.
      Примечание: Протокол может быть приостановлена здесь. Заморозить гранул при-20 ° C в краткосрочной перспективе или на-80 ° C в долгосрочной перспективе. После возобновления протокол, оттепель гранул на RT.
    6. Ресуспензируйте гранулы в буфере STE (10 мм трис рН 8,0; 150 мм NaCl; 1 мм ЭДТА, 375 мм сахарозы; 1: 1000 (v/v) 2-меркаптоэтанол (свеже добавил)). Использование 200 мл буфера STE для каждые 10 г гранул.
    7. Sonicate подвеска на льду (10 мин с 40 s пульс, 20 s тормоза и 30% амплитуды). Центрифуга на 6,360 g x 20 мин удалить супернатант и весят гранулы. Повторите шаги, sonication и центрифугирования 4 раза.
    8. Ресуспензируйте гранулы в 100 мл TBS буфера (10 мм трис, 150 NaCl). Центрифуга на 6,360 g x 20 мин удалить супернатант и весят Пелле.
    9. Ресуспензируйте Пелле нуклеиназы буфера (100 мм трис, 1 ЭДТА, 3 мм MgCl2) с свежезаваренным добавлен нуклеиназы 80 ед/мл (например, Benzonase) с использованием 10 мл/г гранул. Инкубируйте подвеска на ночь на RT на перемешивание пластины (30 об/мин).
    10. Добавьте буфер Тритон (60 мм ЭДТА, 1,5 М NaCl, 6% (v/v) 4-(1,1,3,3-Tetramethylbutyl) фенил-полиэтиленгликоль) к приостановлению. Объем буфера Тритон добавить соответствует 0,5 объема часть подвески. Проинкубируйте втечение 10 мин на RT (без перемешивания). Центрифуга на 6,360 g x 20 мин удалить супернатант и весят гранулы.
    11. Ресуспензируйте гранулы в буфере TE (100 мм трис, 20 мм ЭДТА) с использованием 8 мл/г гранул. Центрифуга на 6,360 g x 20 мин удалить супернатант и весят гранулы.
    12. Ресуспензируйте гранулы путем добавления 4 мл/г 25 мм NaAc рН 5,0 и 5 мл/г из 6 M GuCl с 1 мм Дитиотреитол (DTT) (свеже добавлено). Инкубируйте подвеска на ночь при 4 ° C на перемешивание пластины (30 об/мин).
    13. Центрифуга на 75,500 g x 20 мин. Супернатант теперь содержит развернулось мономерных БМП2 белка. Собирайте супернатант и концентрат, этот экстракт 20 ОД/мл с помощью мембраны 3 кДа молекулярный вес отсечения (MWCO) в концентрации клеток (см. Таблицу материалы).
    14. Добавьте концентрации мономеров в одной капли в буфере выемка (2 M LiCl, 50 мм трис, главы 25 мм, 5 мм ЭДТА, дисульфид глутатиона 1 мм (GSSG), 2 мм глутатиона (GSH)) помешивая (30 об/мин). Инкубируйте на RT для 120 h в темноте.
      Примечание: этот период инкубации, складывая мигающих. Решение от этого шага начиная содержит сложенном димерной БМП2-K3Plk.
    15. Отрегулируйте рН раствора до 3.0 с использованием концентрированной HCl. Dialyze решение против 1 мм HCl. концентрат dialyzed решения с помощью мембраны 10 кДа молекулярный вес производства (MWCO) в концентрации клеток.
    16. Сбалансировать решение, добавляя буфера (20 мм, NaAc, 30% изопропиловый спирт). Добавьте объем буфера A соответствует 30% объема раствора. Центрифуга решение на 4700 x g за 15 мин.
    17. Сбалансировать столбце для ионного обмена на быстрый протеин жидкостной хроматографии (ПСОК) системы15 с 150 мл буфера A. Load раствор белка на столбце уравновешенной. Элюировать фракций, используя линейный градиент буфера B (20 мм NaAc, 30% изопропиловый спирт, 2 M NaCl) с использованием 100 мл буфера B. собирать 2 мл фракций.
      Примечание: Концентрат белка перед загрузкой в столбце по объему всего столбца. Окончательный белка объем должен быть < 5% от объема всего столбца.
    18. Анализ 20 мкл каждой фракции полиакриламида SDS гель (12%) электрофорез (SDS-PAGE) 16 и Окрашивание Кумасси синим17 (см. Таблицу материалы).
      Примечание: Кумасси синим витражи гель SDS-PAGE шоу фракций, содержащих димеров (26 кДа) и фракций, содержащих мономеров (13 кДа).
    19. Бассейн димер содержащие фракции. Dialyze пул димер, содержащие фракции на ночь при 4 ° C против 1 мм HCl (объем 5 литров). Концентрат конечного продукта с помощью 10 кДа, концентрируя центробежный фильтр (см. Таблицу материалы). Анализируйте конечного продукта путем электрофореза геля полиакриламида SDS (12%) (SDS-PAGE) и Окрашивание Кумасси синим.
      Примечание: Группы на Кумасси синим окрашенных SDS-PAGE гель должен показать только одна полоса на 26 кДа. Это конечный продукт БМП2-K3Plk.

2. Оптимизация меди (I)-катализированное алкины азид циклоприсоединения (CuAAC) условия

  1. Аскорбат натрия (NaAsc) и меди (II) сульфат ( 4 CuSO) на дикого типа БМП2 (БМП2-WT)
    1. Инкубировать 20 мкм БМП2-WT с различным соотношением NaAsc CuSO4. Использовать 0,5 мм NaAsc и 0,5 мм CuSO4 (начиная концентрации) в объеме 50 мкл. Продолжить с следующие соотношения NaAsc CuSO4: (1:1), (1.7:1), (10:1), (20: 1), сохраняя постоянной концентрации4 CuSO на 0,5 мм и регулировка концентрации NaAsc соответственно. Выполните реакции в H2O на вращающейся смеситель (20 мин) на ночь на RT.
    2. Подготовка сокращенных проб путем добавления загрузки буфера, содержащего 5% 2-меркаптоэтанол и инкубировать образца при 95 ° C, 6 минут анализ сокращены и гель-снижение образцы полиакриламида SDS (12%) электрофорез (SDS-PAGE) и Окрашивание Кумасси синим. Витражные Гели SDS-PAGE Coomasie Показать полосы в диапазоне 13 кДа (снижение conditons) 26 кДа и выше молекулярный вес (не снижение условия).
  2. Эффект Tris(3-hydroxypropyltriazolylmethyl) Амин (THPTA) на CuAAC реакции
    1. Инкубировать 20 мкм БМП2-K3Plk с различным соотношением THPTA CuSO4. Используйте 5 мм NaAsc и 200 мкм 3-Azido-7-hydroxycoumarin (сохранить NaAsc и 3-Azido-7-hydroxycoumarin, постоянный). Используйте в качестве отправной концентрации 50 мкм THPTA и 0,5 мм CuSO4 . Использовать различные соотношения THPTA CuSO4: (7:1); (10:1); (12:1); (15:1); (20:1). выполнять реакции в H2O (общий объем 50 мкл) для 24 h на RT на вращающейся смеситель (20 мин).
    2. 3-Azido-7-hydroxycoumarin, после сцепки, становится Люминесцентную краску. Подготовить образцы в условиях ограниченной и не уменьшена и анализировать их на SDS-PAGE. Визуализировать гелей под возбуждения канал с определенной длины волны для 3-Azido-7-hydroxycoumarin (λabs = 404 Нм;ет λ = 477 Нм).

3. ковалентная связь техника БМП2 K3Plk для азид функционализированных агарозы бусины

  1. Проинкубируйте 2 ч в РТ на rotati 20 мкм БМП2-K3Plk или БМП2-WT (используется как отрицательный контроль) с 20 мкл азид активированный агарозы бисера в общем объеме 500 мкл буфера реакции (0,1 М HEPES pH 7.0, 3,9 М мочевиной, 50 мкм CuSO4, 250 мкм THPTA, Аскорбат натрия 5 мм) микшер нг (20 мин). Остановите реакции, добавив 5 мм ЭДТА (конечная концентрация).
  2. Инкубируйте на RT 15 мин на вращающейся смеситель (20 мин). Центрифугуйте образцы на 20000 x g 1 мин на RT. собирать supernatants.
  3. Помыть лепешка, содержащие бусины три раза с 1000 мкл буфера HBS500 (50 мм HEPES, 500 мм NaCl), три раза с 1000 мкл MgCl 4 M2и два раза с 1000 мкл-фосфатный буфер (PBS). На каждом этапе стирки центрифуги на 20000 x г за 1 мин на RT и собирать supernatants. Магазин в сочетании бисер в 1000 мкл PBS на 4 ° C.
    Предупреждение: Не беспокоить Пелле шарик при удалении супернатант.

4. Проверка присутствия и биологической активности иммобилизованные БМП2 K3Plk с помощью Техас красной надписью BMP рецептор я Ectodomain ( EC BMPR-IA)

  1. Инкубировать 50 мкл БМП2-K3Plk функционализированных бусы с 1 мкм Техас Красного помечены BMPR-IAEC с 150 мкл буфера HBS500 (50 мм HEPES, 500 мм NaCl) на RT 1 h на вращающейся смеситель (20 мин).
  2. Центрифуга бусы на 20000 x g 1 мин на RT. удалить супернатант. Вымойте бусины с 1000 мкл буфера500 HBS. Повторите шаг Стиральная еще 3 раза. Центрифуга на 20000 x g 1 мин на RT после каждого мытья шаг.
  3. Ресуспензируйте бисер в 500 мкл PBS и Пипетка 50 мкл на слайд крышка стекла. Установите фильтр Микроскоп между 561 или 594 Нм. Обнаруживать Техас красный – BMPR-IAEC-БМП2-K3Plk функционализированных бусины с помощью флуоресцентной микроскопии и принимать фотографии.

5. Измерение щелочной фосфатазы (ALP) выражение, чтобы доказать In Vitro отпорности производства БМП2-K3Plk до и после сцепки реакции.

  1. Щелочная фосфатаза (ALP) пробирного
    1. Культура promyoblastic C2C12 клетки (ATCC CRL-172) в средних Дульбекко изменение орла (DMEM) с 10% сыворотки крови плода теленка (FCS), 100 ед/мл пенициллин G и стрептомицина 100 мкг/мл при 37 ° C в атмосфере увлажненные 5% CO2.
    2. Семенных клетки C2C12 на плотности 3 × 104 клетки/скважины в 96-луночных микропланшетов. Пусть клетки придают на ночь. Удаление средних и инкубации клеток C2C12 присутствии 0,5-200 Нм БМП2-WT или БМП2-K3Plk в 100 мкл/хорошо DMEM (2% FCS, 100 ед/мл пенициллин G и 100 мкг/мл стрептомицина) при 37 ° C в атмосфере увлажненные 5% CO2 за 72 ч.
    3. Удаление средних и вымыть клетки с 100 мкл PBS в колодец. Лизировать клетки на RT 1 h с 100 мкл/хорошо буфера lysis (1% NP-40, 0,1 М глицин, pH 9.6, MgCl 1 мм2, 1 мм ZnCl2) на тряску плите (220/мин).
    4. Добавьте 100 мкл/хорошо ALP буфера (0,1 М глицин, pH 9.6, 1 мм MgCl2, 1 мм ZnCl2) с 1 мг/мл p-nitrophenylphosphate (свеже добавлен) в lysate клетки.
    5. Измерение поглощения на 405 нм в многодисковое reader после добавления ALP буфер и каждые 5 минут, до завершения разработки цвет. Генерировать дозы ответ кривых и значения ЭК50, с помощью модели логистической, y = A2 + (1A-A2) / (1 + (x/x0)p).
  2. Щелочная фосфатаза (ALP) пятнать
    1. Культура promyoblastic C2C12 клетки (ATCC CRL-172) в Дульбекко изменение Eagle среднего (DMEM) с 10% сыворотки крови плода теленка (FCS), 100 ед/мл пенициллин G и стрептомицина 100 мкг/мл при 37 ° C в атмосфере увлажненные 5% CO2.
    2. Семенных клетки C2C12 на плотности 3 × 104 клетки/скважины в 96-луночных микропланшетов. Пусть клетки придают на ночь. Удаление средних и добавить 20 мкл/колодец БМП2-K3Plk сочетании бисера. БМП2-K3Plk сочетании бусины находятся в 1000 мкл суспензии PBS.
    3. Подготовьте раствор 0,4% Температура плавления агарозы в среде DMEM. Растопить в микроволновке (600 Вт 3 мин) и дайте ему остыть в водяной бане при 37 ° C до использования.
    4. 20 мкл агарозы температура плавления 0,4%, в каждой скважине (покрытие бисера и клетки). Центрифуга на 2000 x g 5 мин при 20 ° C. 80 мкл DMEM (2% FCS, 100 ед/мл пенициллин G и 100 мкг/мл стрептомицина) и инкубировать при 37 ° C в атмосфере увлажненные 5% CO2 за 72 ч.
    5. Удаление среды, стараясь не отсоединить затвердевших агарозы 0,4%. Добавить 100 мкл/скважина 1-шаг НБТ/раствора субстрата ПКВП (нитро голубой tetrazolium хлорид, 5-bromo-4-chloro-3'-indolyphosphate-толуидином соли).
    6. Анализируйте, щелочной фосфатазы окрашивание с помощью световой микроскопии, сразу же после того, как фиолетовый окрашивание становится очевидной. Используйте светлые области микроскопии и принимать фотографии.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

В этой статье мы описываем метод ковалентно пара новый вариант БМП2, БМП2-K3Plk, коммерчески доступных азид функционализированных агарозы бисером (рис. 1). Биологическую производства БМП2-K3Plk вариант был подтвержден индукции щелочной фосфатазы (ALP) экспрессии генов в клетках C2C12. В vitro тест показывает аналогичные уровни выражения ALP, вызванных дикого типа БМП2 (БМП2-WT) и БМП2-K3Plk (рис. 2).

Окислительно-восстановительных реакций между Аскорбат натрия (NaAsc) и меди (II) сульфат (4CuSO) генерировать реактивнооксигенных видов, которые могли бы повлиять на структурной целостности и таким образом влияет на биологическую БМП2-K3Plk. Чтобы проверить структурной целостности белка, мы провели ночь инкубации с CuSO4 и NaAsc, показаны БМП2-WT деградации в зависимости от концентрации (визуализированное SDS-PAGE в условиях снижения (Рисунок 3А1 )) и формирование мультимеры или агрегатов, видимые на приблизительно 40 кДа (условиях-снижение) (Рисунок 3А2). Чтобы избежать деградации белка, трис (3-hydroxypropyltriazolyl метил) Амин (THPTA) был использован в качестве защитного агента (рис. 3B). Использование THPTA предотвращает БМП2 фрагментации, в то время как формирование более высокой молекулярной массой структур не могут быть предотвращены путем добавления THPTA. Дальнейшие улучшения реакции выступил состав буфер реакции, температура реакции и время реакции (данные не показаны). Протокол описано здесь подробности окончательного достижения относительно реакции буфера состав, температуру и время реакции.

Чтобы подтвердить, что БМП2-K3Plk сохраняет отпорности после сцепления, мы использовали белка ectodomain дневно обозначенные рецептор типа я рецептор (ECBMPR-IA) для демонстрации еще в состоянии связать этот рецептор подвижности белков. Бусины с покрытием с БМП2-K3Plk через CuAAC химии, принесли флуоресценции когда инкубировали с красителя меченых BMPR-IAEC (рис. 4). В контраст, покрытые оболочкой бисером или бусины, которые инкубировали с БМП2-WT показал не флуоресценции сигнал выше фона уровнях (данные не показаны)14.

После подтверждения возможности привязки рецептор иммобилизованных лиганд в пробирке, мы также проверили ли биологической реакции могут быть вызваны функционализированных бусины в assay на основе ячеек. ALP опосредованной пятнать происходило только в тех клетках, которые находились в прямой контакт с БМП2-K3Plk-функционализированных бусины (рис. 5). Это подтверждает, что белок действительно ковалентно связан с бисером и не просто всасывается, поскольку более растопыренными окрашивания на больших расстояниях для бисера бы в противном случае наблюдались.

Figure 1
Рисунок 1: изображение БМП2-K3Plk. (A) Изображение БМП2-K3Plk вариант с локализацией введено аминокислоты замены. (B) муфта схемы: БМП2-K3Plk CuAAC реакция с азидом функционализированных бусины. Перепечатано с разрешения Табиз et al(адаптированный). (2017): сайт направленных иммобилизации БМП-2: два подхода для производства инновационных Osteoinductive леса. Биомакромолекулах. 18 (3), 695-708. Авторское право 2017 американского химического общества) Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: биологическую БМП2-вариантов. Сравнение bioactivities (ALP пробирного) БМП2-K3Plk и wildtype БМП2 (БМП2-WT). Ось x представляет концентрацию БМП2-WT или БМП2-K3Plk используется в assay. ЭК50 данные представляют собой средние значения и стандартных отклонений 4 отдельных экспериментов (N = 4). Перепечатано с разрешения Табиз et al(адаптированный). (2017): сайт направленных иммобилизации БМП-2: два подхода для производства инновационных Osteoinductive леса. Биомакромолекулах. 18 (3), 695-708. Авторское право 2017 американского химического общества) Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: эффект восстанавливающего агента на целостность БМП2. (A) БМП2-WT подверглась воздействию различных Молярная соотношения Аскорбат натрия (NaAsc), меди (II) сульфат (4CuSO). Образцы были проанализированы SDS-PAGE и Окрашивание Кумасси синим под-снижение условий (Рисунок A2) и сокращение (Рис. А1). В условиях сокращения (A1) красные стрелки представляют рассеченного БМП2-WT. В условиях-снижение (A2) красные стрелки показывают multimeric БМП2-WT. Группы, представляющие рассеченного БМП2 видов обозначены синей стрелкой. Легенда: NC-R - снижение БМП2-WT необработанный; NC - БМП2-WT необработанный; 1:1 до 20:1 - увеличение Молярная соотношения натрия аскорбат CuSO4. (B) БМП2-K3Plk был связан с 3-Azido-7-hydroxycoumarin с помощью условий реакции CuAAC с THPTA. После муфты 3-Azido-7-hydroxycoumarin становится Люминесцентную краску. Легенда: NC - БМП2-WT прореагировало с 3-Azido-7-hydroxycoumarin; 7:1 до 20:1 увеличение молярное соотношение THPTA CuSO4. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: биологическую иммобилизованных в пробирке БМП2-K3Plk. Представитель картину взаимодействия иммобилизованные БМП2-K3Plk с маркировкой Техас-красный BMPR-IAЕС. Перепечатано с разрешения Табиз et al(адаптированный). (2017): сайт направленных иммобилизации БМП-2: два подхода для производства инновационных Osteoinductive леса. Биомакромолекулах. 18 (3), 695-708. Авторское право 2017 американского химического общества) Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: биологическую иммобилизованные БМП2-K3Plk в assay на основе ячеек. (A) представитель картину щелочной фосфатазы (ALP) пятная после лечения с бисером в сочетании с БМП2-K3Plk функционализированных бусины. (B) щелочной фосфатазы (ALP) пятная после лечения с растворимых 25 Нм БМП2-K3Plk. переиздание (адаптировано) с разрешения Табиз и др. (2017): сайт направленных иммобилизации БМП-2: два подхода для производства инновационных Osteoinductive леса. Биомакромолекулах. 18 (3), 695-708. Авторское право 2017 американского химического общества) Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Генерации протеин тегами вариантов расширения генетических кодон позволяет введение различных ненатуральных аминокислоты аналогов главным образом в любом месте основного белка последовательности. В случае БМП как БМП2, общей теги, такие как тег 6-гистидин (его) может быть только представил N-неизлечимо, так как конец protein´s C-терминала похоронен в структуре высшего белка и таким образом не доступны извне. На других позициях размер тег представлен весьма вероятно может вызвать структурные изменения, которые соответственно уничтожить отпорности BMP´s. Кроме того представляя мутации в БМП2 последовательность может повлиять на эффективность refolding и можно также изменить другие параметры белка Изоэлектрическая точка изменение белка. Таким образом каждый шаг в протоколе производство установленной белка может потребоваться быть адаптированы согласно характеристикам измененный белок variant´s. Производство БМП2-K3Plk действительно требуется модификация метода установленных для выражения дикого типа БМП2. Различные культуры раз или Пропаргиловый L-лизин (ПЛК) концентрации были испытания (данные не показаны) для того, чтобы достичь высокий урожай выражение. Складывая, разделения и очистки шагов к счастью не требуют дальнейшего приспособления. Мы уже сообщали, что в случае других вариантов БМП2, производится в нашей лаборатории, некоторые характеристики белков были существенно изменяется, которая требует модификации нескольких шагов метод производства BMP18. Производства БМП2-K3Plk показало биологическую активность сравнима с протеином дикого типа. Разница возникает при высокой концентрации БМП2, вероятно вследствие меньше растворимость вариант БМП2-K3Plk в среде по сравнению с дикого типа БМП2.

Несмотря на известные преимущества медь катализируемого азид алкины циклоприсоединения (CuAAC)19CuAAC реакции должны быть тщательно адаптированы для конкретных приложений. Мы показали, как БМП2 может быть раздроблена или создать агрегаты или мультимеры из-за сильного сокращения условий реакции. Таким образом все параметры реакции пришлось детально проанализированы для того, чтобы найти условия, которые оставляют белка не влияет.

Наш подход к ковалентно пару БМП2 вариант азид функционализированных агарозы бусы, нажмите химии может быть реализован с высокой эффективностью, в результате функционализированных бусы, вызывая Остеогенные дифференциации в пробирке. Когда дикого типа БМП2 белок использовался в реакции с бисером вместо этого, мы могли наблюдать только слабые пятнать ALP выражения, указывающий соединение действительно весьма конкретно через Пропаргиловый L-лизин остатки БМП2-K3Plk.

Эта специфика позиционные муфта отражает значительное улучшение по сравнению с иммобилизацией процедуры, связанные с классической Трансплантология/EDC химии. В таких случаях случайные сцепного устройства происходит, главным образом с участием групп Первичные амины, присутствующих в остатков лизина. Спаренные белка имеет переменную Остеогенные активность, из-за множества возможных соединений на эшафот, приводит к различным ориентациям белка к клеточными рецепторами.

Использование иммобилизованные БМП2 сайт прямой может преодолеть указанные недостатки, связанные с высокими дозами растворимых БМП2, которые необходимы для формирования костей. Кроме того, результаты ясно показывают, что некоторые клеточных реакций, таких, как полностью Остеогенные дифференцировки клеток C2C12, инициированные иммобилизованные БМП2, несмотря на недавние исследования, утверждая, что сигнал трансдукции требует эндоцитоза из лиганд/лиганд рецептор комплекс20,21. Наши результаты согласуются другие исследования демонстрируют, что БМП2, который сочетании ковалентно (но не ориентированные на сайт) для не endocytosable поверхности, все еще в состоянии побудить остеобластов дифференциация22.

С учетом того, что мы использовали выше физиологические концентрации БМП2 для сцепления реакции, количество иммобилизованные БМП2 может быть дополнительно уменьшены по-прежнему сохраняя Остеогенные свойства бусин. Однако, до таких шагов оптимизации, БМП2-K3Plk-функционализированных эшафот необходимо испытываться в животных эксперименты, чтобы доказать его Остеогенные потенциал в естественных условиях.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют не конкурирующих финансовых интересов.

Acknowledgments

Авторы благодарят д-р M. Рубини (Констанц, Германия) для обеспечения кодирования pyrrolysyl-tRNA плазмида и предоставление pRSFduet-pyrtRNAsynth кодирования соответствующей аминоацил тРНК-синтетазы.

Materials

Name Company Catalog Number Comments
Material
1-Step NBT/BCIP Thermo Fisher 34042 Add solution to cells
3-Azido-7-hydroxycoumarin BaseClick BCFA-047-1 Chemical used for click reaction
Agarose low melting point Biozym 840101 Agarose for ALP assay 
Azide agarose beads Jena Bioscience CLK-1038-2 Beads used for reaction
BamHI (Fast Digest enzyme) Thermo Fisher Scientific FD0054 Restriction enzyme
BMP receptor IA (BMPR-IAEC) -- -- Produced in our lab
Coomassie Brilliant Blue G-250 Dye Thermo Fisher Scientific 20279 Chemical used for Coomassie Brilliant blue staining of SDS PAGE
Copper (II) sulfate anhydrous (CuSO4) Alfa Aesar A13986 Chemical used for click reaction
DNA Polymerase and reaction buffer  Kapabiosystems KK2102 KAPA HiFi PCR Kit
Dulbecco’s modified Eagle’s medium (DMEM) GlutaMAX Gibco 61965-026 Cell culture media
ethylenediaminetetraacetic acid (EDTA) Sigma Aldrich GmbH E5134-1kg Chemical used to stop click reaction
Isopropyl ß-D-1-thiogalactopyranoside (IPTG) Carl Roth GmbH 2316.5 Bacteria induction (1mM final concentration) 
NdeI (Fast Digest enzyme) Thermo Fisher Scientific ER0581 Restriction enzyme
NHS-activated Texas Red Life technologies T6134 Coupled to receptor
P- Nitrophenyl Phosphate Sigma Aldrich GmbH N4645-1G Alkaline Phosphatase
p25N-hmBMP2  -- -- Plasmid kindly provided from Walter Sebald to J. Nickel
pET11a-pyrtRNA -- -- Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
propargyl-L-lysine (Plk) -- -- Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
pSRFduet-pyrtRNAsynth -- -- Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
Qiagen Gel Extraction Kit Qiagen 28704 Gel Purification
Qiagen PCR purification Kit Qiagen 28104 PCR Purification 
Sodium L-ascorbate Sigma Aldrich GmbH A7631-100G Chemical used for click reaction
T4 DNA Ligase ThermoScientific EL0011 Ligation 
tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) BaseClick BCMI-006-100 Chemical used for click reaction
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol Sigma Aldrich GmbH X100-1L Triton X 100 
Name Company Catalog Number Comments
Equipment
Amicon concentrating cell 400 ml  Merck KGaA UFSC40001 Concentrating unit
Amicon Ultra-15 Centrifugal Filter Units Merck KGaA UFC901024 Concentrating centrifugal unit
ÄKTA avant FPLC ÄKTA -- FPLC machine
Avanti J-26XP Beckman Coulter  393124 Centrifuge for bacterial culture
Bacterial Shaking Incubator Infors HT Shaking incubator for bacterial culture
FluorChem Q system proteinsimple -- Imaging and analysis system for SDS-PAGE
Fluorescent miscroscope Keyence BZ-9000 (BIOREVO)
Fractogel® EMD SO3- (M) Merck KGaA 116882 Ion Exchange Chromatography column material
Greiner CELLSTAR® 96 well plates Sigma M5811-40EA 96 well plates for cell culture (ALP Assay)
Heraeus Multifuge X1R ThermoScientific -- Centrifuge
M-20 Microplate Swinging Bucket Rotor ThermoScientific 75003624 Rotor for Microcentrifuge for plate during ALP staining
Microcentrifuge - 5417R Eppendorf -- Centrifuge
OriginPro 9.1 G  OriginLab -- software for stastic analysis of ALP assay data
Polysine Slides ThermoScientific 10143265 microscope slides
Rotor JA-10 Beckman Coulter  -- rotor for Avanti J-26XP centrifuge
Rotor JLA 8.1 Beckman Coulter  -- rotor for Avanti J-26XP centrifuge
Rotor JA 25.50 Beckman Coulter  -- rotor for Avanti J-26XP centrifuge
Tecan infinite M200 multiplate reader Tecan Deutschland GmbH -- Multiplate reader for ALP assay
Thermocycler - Labcycler Gradient SensoQuest GmbH -- PCR
TxRed - microscope filter Keyence Filter for fluorescent microscope 
Ultrafiltration regenerated cellulose discs 3 kDa Merck KGaA PLBC04310 used with amicon concentrating cell 400ml
Ultrafiltration regenerated cellulose discs 10 kDa Merck KGaA PLGC04310 used with amicon concentrating cell 400ml

DOWNLOAD MATERIALS LIST

References

  1. Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. Bone substitutes: An update. Injury. 36, Suppl 3. S20-S27 (2005).
  2. Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations. Biofactors. 40, (5), 459-481 (2014).
  3. Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. Localized delivery of growth factors for bone repair. Eur J Pharm Biopharm. 58, (2), 197-208 (2004).
  4. Haidar, Z. S., Hamdy, R. C., Tabrizian, M. Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery. Biotechnol Lett. 31, (12), 1817-1824 (2009).
  5. Hollinger, J. O., Uludag, H., Winn, S. R. Sustained release emphasizing recombinant human bone morphogenetic protein-2. Adv Drug Deliv Rev. 31, (3), 303-318 (1998).
  6. Uludag, H., et al. Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model. J Biomed Mater Res. 50, (2), 227-238 (2000).
  7. Uludag, H., Golden, J., Palmer, R., Wozney, J. M. Biotinated bone morphogenetic protein-2: In vivo and in vitro activity. Biotechnol Bioeng. 65, (6), 668-672 (1999).
  8. Aono, A., et al. Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer. Biochem Biophys Res Commun. 210, (3), 670-677 (1995).
  9. Suzuki, Y., et al. Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo. J Biomed Mater Res. 50, (3), 405-409 (2000).
  10. Knaus, P., Sebald, W. Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily. Biol Chem. 382, (8), 1189-1195 (2001).
  11. Wang, L., Xie, J., Schultz, P. G. Expanding the genetic code. Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).
  12. Costa, G. L., Weiner, M. P. Rapid PCR site-directed mutagenesis. CSH Protoc. 2006, (1), (2006).
  13. Kirsch, T., Nickel, J., Sebald, W. Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2. FEBS Lett. 468, (2-3), 215-219 (2000).
  14. Tabisz, B., et al. Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds. Biomacromolecules. 18, (3), 695-708 (2017).
  15. Duong-Ly, K. C., Gabelli, S. B. Using ion exchange chromatography to purify a recombinantly expressed protein. Methods Enzymol. 541, 95-103 (2014).
  16. Brunelle, J. L., Green, R. One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE). Methods Enzymol. 541, 151-159 (2014).
  17. Brunelle, J. L., Green, R. Coomassie blue staining. Methods Enzymol. 541, 161-167 (2014).
  18. Kirsch, T., Nickel, J., Sebald, W. BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II. EMBO J. 19, (13), 3314-3324 (2000).
  19. Hein, J. E., Fokin, V. V. Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides. Chem Soc Rev. 39, (4), 1302-1315 (2010).
  20. Alborzinia, H., et al. Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists. J Cell Sci. 126, (Pt 1), 117-127 (2013).
  21. Paarmann, P., et al. Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling. Int J Biochem Cell Biol. 76, 51-63 (2016).
  22. Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation. Acta Biomater. 8, (2), 772-780 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics