Eine effiziente In-vitro- Umsetzung-Methode durch eine Transcriptionally geregelten Schönheit Schlafsystem verpackt in eine Integration defekt Lentivirale Vektor

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Dieses Protokoll beschreibt eine Methode, um stabile Integration eines Gens von Interesse des menschlichen Genoms durch das transcriptionally regulierte Dornröschen -System zu erreichen. Vorbereitung der Integration von defekten Lentivirale Vektoren, die in-vitro- Transduktion von menschlichen Zellen und molekulare Tests auf Zellen ausgestrahlt werden gemeldet.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Das Transposon Sleeping Beauty (SB) ist ein nicht-viralen Integration System mit nachgewiesener Wirksamkeit für Gentransfer und funktionelle Genomik. Um die SB-Transposon-Maschinen zu optimieren, sind ein transcriptionally geregelten hyperaktiv Transposase (SB100X) und T2-basierte Transposon beschäftigt. In der Regel werden die Transposase und Transposons vorübergehend von Plasmid Transfektion und SB100X Ausdruck wird angetrieben von einem konstitutiven Promoter. Hier beschreiben wir eine effiziente Methode um die SB-Komponenten an menschliche Zellen zu liefern, resistent gegen verschiedene physikalische und chemische Transfektion Methoden, SB100X Ausdruck zu steuern und stabil integrieren ein Gen des Interesses (GOI) durch eine "Ausschneiden und einfügen" SB Mechanismus. Der Ausdruck der hyperaktive Transposase wird durch das Tet-ON-System, häufig verwendet, um die Genexpression seit 1992 kontrollieren streng kontrolliert. Das gen des Interesses wird von invertierte Wiederholungen (IR) der T2 Transposons flankiert. Beide SB-Komponenten werden bei der Integration verpackt defektive Lentivirale Vektoren vorübergehend in HEK293T Zellen hergestellt. Menschliche Zellen, Zell-Linien oder primäre Zellen aus menschlichen Gewebe sind in-vitro- vorübergehend mit viralen Vektoren ausgestrahlt. Nach Zugabe von Doxycyclin (Dox, Tetracyclin analog) in das Kulturmedium eine Feinabstimmung der Transposase Ausdruck wird gemessen und ergibt eine dauerhafte Integration der das gen des Interesses in das Genom der behandelten Zellen. Diese Methode ist effizient und für die Zell-Linie (z. B. HeLa-Zellen) und primäre Zellen (z. B. menschliche primären Keratinozyten) und stellt somit ein wertvolles Werkzeug für Gentechnik und therapeutischer Gentransfer.

Introduction

Die hyperaktiven SB100X Transposase gekoppelt an das T2-basierte Transposon wurde bereits in präklinischen Gen Therapie Anwendungen1,2,3, Genom Änderungen4,5, verwendet und induzierte pluripotente Stammzellen (iPSC) Neuprogrammierung6,7. In der Regel werden die SB-Komponenten vorübergehend von Plasmid Transfektion und starken konstitutiven Promoter treibt den Ausdruck der Transposase. Dennoch, trotz der verbesserten neuen Methoden der Transfektion Lieferung von zwei-Komponenten-System bleibt eine Herausforderung für viele Anwendungen. So hat die Entwicklung einer neuen Übermittlungsprotokoll zunehmendes Interesse. Neben Transfektion Methoden für Plasmid8 und mRNA9virale Lieferung basierend auf adenoviralen10,11, Adeno-assoziierten Viren (AAV)12, Baculovirus13gammaretroviralen14 und Lentivirale Vektoren15 hat in der Vergangenheit vorgeschlagen worden. Vor allem muss das System der Wahl eine vorübergehende Lieferung der SB-Komponenten ohne Integration des viralen Vektors garantieren. Dennoch wirft die konstitutive Expression von Transposase Sicherheitsbedenken wegen des Risikos einer unkontrollierbaren rehopping der das Transposon.

Transcriptional Regelung des SB100X durch ein raffiniertes Tet-ON-System ist daher die erste Herausforderung. Modifizierte Tet eine geschlechtergerechte Förderer, erreicht durch Ersetzen des original entwickelten minimal Cytomegalovirus (CMV) Projektträgers mit dem minimalen Promotor (-81) des Gens Timidine Kinase (TK) von Herpes Simplex Virus 1 (HSV-1)16, geklont stromaufwärts von der SB100X cDNA (pTetOTKSB100X). Die mutierten Reverse-Tetracyclin-Transaktivator rtTA2s-M217 drückt sich unter der Kontrolle von der starken konstitutiven Promoter (Phosphoglycerate Promotor, PGK) geklont in verschiedenen Plasmid (pCCL-PGKrtTA2S-M2). Wenn das Kulturmedium hinzugefügt, Dox bindet die rtTA2s-M2-Modulator und Leinen der Tet-Promoter komplexe oder daraus resultierenden in streng regulierten Induktion der SB100X Ausdruck18.

Die zweite große Herausforderung ergibt sich aus der ineffizienten Transfektion von menschlichen Primärzellen durch verschiedene physikalische und chemische Methoden. Um effizient Transposase in menschlichen Zellen resistent gegen Transfektion, die SB100X und die rtTA2sliefern-M2 Expressionskassetten sind verpackt in zwei Integration defekt Lentivirale Vektoren (IDLVs)19: IDLVTKSB und IDLVrtTA2s- M2. Virale Vektoren werden vorübergehend als dritte Generation Vektoren in HEK293T Zellen20 und mit dem Glykoprotein G von vesikulärer Stomatitis Virus (VSV-G), die ein breites Spektrum an Infektion verleiht pseudotyped produziert. Vektor-Partikel sind durch Ultrazentrifugation konzentriert und von HIV-1 Gag p24 Immunocapture titriert. Um Zelllinien und Primärzellen transduzieren, Vektor-Partikel sind komplexiert mit Polybrene und mit Zielzellen in das Vorhandensein oder Fehlen von Dox inkubiert werden. Drogen-abhängige Aktivierung der SB100X Ausdruck in Zellen ausgestrahlt wird durch quantitative RT-PCR (qRT-PCR)18gemessen.

Tet-regulierten SB100X Ausdruck nachgewiesen wird, folgt Umsetzung der indischen Regierung (z. B. grün fluoreszierendes Protein, GFP) in die Ziel-Zelle-Genom der molekularen Ereignisse deutlich von Bak und Mikkelsen21schematisiert. Eine dritte IDLV Vektor-Ausführung hat eine Expressionskassette für die indische Regierung zwischen der T2-Transposon-IRs (IDLVT2) geklont zu konstruiert und verpackt, wie oben erwähnt werden. Die drei IDLV Vektoren ist zu guter Letzt lässt sich effizient transduzieren menschliche Zellen (z. B. primären Keratinozyten) in Vitro und integrieren die indische Regierung im Beisein von Doxycyclin18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

(1) Plasmide eingesetzt

Hinweis: Plasmid pCCL-PGKrtTA2S-M2 wurde freundlicherweise zur Verfügung gestellt von Prof. Zappavigna (Universität von Modena und Reggio Emilia, Modena, Italien). Die pCMVSB100X Plasmid trägt die kodierende Sequenz des hyperaktiven Transposase und pT2/BH Transposon Plasmid wurden freundlicherweise von Prof. Z. Ivics (Paul-Ehrlich-Institut, Langen, Deutschland) und Prof. Z. Izvak (Max-Delbruck-Centrum für Molekularmedizin, Berlin, (Deutschland).

  1. Folgen Sie für alle Klonen in Escherichia Coli (E. Coli) die Klonen Strategie der Wahl und Restriktionsenzym Verfahren oder PCR-Amplifikation des Fragments geklont werden.
    Hinweis: Tabelle 1 enthält eine Zusammenfassung aller Plasmide, die in diesem Protokoll eingesetzt. Eine Beschreibung und Referenzen für jedes Plasmid sind vorhanden.

(2) viralen Vektoren Produktion

Hinweis: Die virale Vektoren werden in ein Biohazard-Haube auf einer BSL2 Biosafety Aufhaltestufe nach institutionellen Regeln und Vorschriften produziert.

  1. Kultur anhaftende HEK293T Zellen in Dulbeccos geändert Eagle Medium ergänzt mit 10 % HyClone Serum, 100 U/mL Penicillin-Streptomycin und 2 mM Glutamin.
  2. Tag 0: Bereiten Sie fünf 15 cm Platten/virale Vorbereitung und 5.5x106 Samenzellen in 30 mL des Mediums.
  3. Tag 1: Transfektion
    1. Bereiten Sie vor Beginn der Transfektion, 100 mL 2 X HEPES Puffer Kochsalzlösung (HBS):
      NaCl (5 M) 5,6 mL
      HEPES (1 M) 10,0 mL
      Na2HPO4 (0,5 M) 0,3 mL
      Steriles Wasser 84,1 mL
      Passen Sie auf pH 7.1 mit 37 % HCl.
      Hinweis: 2 X HBS kann bei 4 ° c aufbewahrt werden Ein genaue pH ist extrem wichtig für effiziente Transfektion. Der optimale pH-Bereich ist 7.10 um 7.12.
    2. Medium zu entfernen und Hinzufügen von 22,5 mL/Teller mit frischen mittlere 4 h vor Transfektion.
    3. Transfizieren Sie HEK293T Zellen mit Transfer-Plasmid, das Plasmid pMD.Lg/pRRE.D64VInt Verpackung und pMD2.G Umschlag-Codierung Plasmid pRSV-Rev (Tabelle 1) entsprechend den folgenden Betrag/Platte:
      Plasmid 25,00 µg zu übertragen
      pMD.Lg/pRRE.D64VInt 16.25 µg
      pMD2.G 8,75 µg
      pRSV-Rev 6,25 µg
      Hinweis: Plasmid DNA sind nach dem CsCl-Protokoll beschrieben durch Maniatis22 oder über ein Endotoxin-freie Plasmid-Reinigung-Kit bereit.
      1. 56,25 µg DNA (Mischung aus 4 Plasmide) in 1,125 mL sterilem Wasser Aufschwemmen und 125 µL 2,5 M CaCl2 (Lösung A) hinzufügen.
      2. Eine sterile 15 mL konische Zentrifugenröhrchen (Lösung B) 1,250 mL 2 X HBS hinzufügen.
      3. Lösung hinzufügen (1,250 mL) nach B (1,250 mL) tropfenweise während sprudelt mit einer 1 oder 2 mL Pipette (Transfektion Lösung, Gesamtvolumen 2,500 mL).
      4. 20 min bei Raumtemperatur (RT) inkubieren.
      5. Mit einer Mikropipette P1000, verteilen Sie die Transfektion Lösung (2,500 mL) für die Zelle Monolage tropfenweise.
    4. Brüten Sie über Nacht in einer Zelle Kultur Inkubator bei 37 ° C, 5 % CO2.
  4. Tag 2: Entfernen Sie das Medium und 15 mL frisches Medium (siehe Punkt 2.1).
  5. Tag 3: Sammeln und den Lentivirale Partikel-haltigen überstand zu konzentrieren.
    1. Sammeln Sie überstand (~ 70 mL) von allen (n = 5) transfizierten Zellplatten Filtern durch einen 0,45 µm PESS filtern und füllen 2 Polyallomer Röhren (1 Zoll x 3,5 Zoll) / virale Vorbereitung.
    2. Die Vektor-Partikel durch Ultrazentrifugation bei 106.000 x g 2,5 h bei 15 ° C mit Bremse zu konzentrieren.
    3. Sofort nach dem Absetzen der Ultrazentrifugation (um Wiederfreisetzung des Geschosses im Rohr zu vermeiden), vorsichtig gießen Überstand in einen Behälter mit 10 % Bleichmittel und unterbrechen die 2 kaum sichtbare Pellets in 100 µL 1 X PBS (+ 1 % BSA). Dies ist normal, da die Pellets klar und sehr klein ist. Verwenden Sie den konzentrierten Vektor frisch zubereitete oder Aliquote und speichern Sie virale Vorbereitungen bei-80 ° C.
      Vorsicht: Der Überstand enthält Lentivirale Partikel, die gründlich vor dem Ablegen im Biohazard Abfall gebleicht werden müssen.
  6. Um die Vorbereitung von viralen Vektoren zu titrieren, verwenden Sie eine Gag von HIV-1-p24 Immunocapture Kit laut Protokoll des Herstellers.
    Hinweis: Um die Produktion von viralen Vektoren zu standardisieren, konnte Liposomen-basiertes Reagenzien eingesetzt werden. Der viralen Vektoren-Titer ist jedoch stark abhängig von der Transfektion Effizienz und Reinheit der Plasmid DNA.

(3) Transduktion von humanen Zelllinien (z. B. HeLa-Zellen)

Hinweis: HeLa-Zellen sind in Dulbeccos modifizierten Eagle Medium ergänzt mit 10 % fetalen Kälberserum, 100 U/mL Penicillin-Streptomycin und 2 mM Glutamin kultiviert. Tabelle 1 fasst alle Vektoren, die in diesem Protokoll eingesetzt. Eine Beschreibung für jeden Vektor. Transduktion von HeLa-Zellen ermöglicht die Überprüfung der transcriptional Regelung des SB Transposase in die beste Dosis Kombination der beiden IDLV Vektoren. Variation von IDLV Dosen kann beziehen sich auf Partikel Titration und Zelle Zieltyp Vektor.

  1. Tag 0: 2 x 105 Samenzellen in 3 mL Medium für jede Vertiefung einer 6-Well-Platte. Bereiten Sie 4 Brunnen.
  2. Tag 1: Transduktion von HeLa-Zellen.
    1. Für jede Bedingung verdünnen Lentivirale Vektoren zu einem Endvolumen von 1 mL Medium (siehe Hinweis oben) in Anwesenheit von 10 μL des Polybrene (Endkonzentration 8 μg/mL):
      Verdünnung für gut #1: ausgestrahlt Zellen (Negativkontrolle) zu verspotten.
      Verdünnung für gut #2: IDLVTKSB-Vektor (2.600 ng von p24).
      Verdünnung für Brunnen #3, #4: IDLVTKSB-Vektor (2.600 ng von p24) + IDLVrtTA2s-M2-Vektor (9.600 ng von p24).
    2. Entfernen Sie das Medium aus jedem Brunnen wo HeLa-Zellen am Tag 0 überzogen waren und fügen Sie Lentivirale Vektor Verdünnungen hinzu, die entsprechend gut.
    3. Spinoculate 6-Well-Platte bei 754 X g für 45 min bei 20-25 ° C, und übertragen Sie dann die 6-Well-Platte in einer Zelle Kultur Inkubator bei 37 ° C und 5 % CO2.
    4. Nach 6 h 1 μM gut #4 Fügen Sie Doxycyclin hinzu und ersetzen Sie die mittlere mit Vektoren durch frisches Medium in alle Wells. Legen Sie die Platte in eine Zelle Kultur Inkubator bei 37 ° C für 48 h.
  3. Tag 3: Vorbereitung der Zelle Pellet für RNA-Extraktion.
    1. Vor dem Abnehmen der Zellen, bereiten Sie eine Trypsin Funktionslösung (1 X):
      2,5 % Trypsin (10 X) 5,0 mL
      500 mM EDTA (Endkonzentration = 5 mM) 0,5 mL
      1 x mL PBS 44,5
    2. Warmen Trypsin funktionierende Lösung bei 37 ° C vor dem Gebrauch. Trypsin funktionierende Lösung bei 4 ° c lagern
    3. Entfernen Sie Medium zu und waschen Sie Zellen mit 1 X PBS. Hinzufügen von 0,5 mL vorgewärmten 37 ° C Trypsin Arbeitslösung in jede Vertiefung und Inkubation bei 37 ° C für 7 min. (in einer Zelle Kultur Inkubator).
    4. Nach der Inkubation hinzufügen 0,5 mL Serum-haltige Mittel in jede Vertiefung, Trypsin und sammeln Zellen in ein Zentrifugenröhrchen zu inaktivieren. Spülen Sie gut einmal mit 3 mL 1 X PBS und Zentrifugieren Sie die Zellsuspension für 5 min bei 240 X g.
    5. Zellen mit 5 mL 1 X PBS, Zentrifuge für 5 min bei 240 X g waschen und überstand verwerfen. Benutzen Sie frisch gesammelten Zelle Pellets oder lagern Sie bei-80 ° C. Extrahieren von Gesamt-RNS von Pellets, semi-quantitativen RT-PCR durchzuführen (siehe Schritt 6).

(4) Transduktion von menschlichen Primärzellen (z. B. Keratinozyten)

Hinweis: Menschliche primären Keratinozyten sind auf letal bestrahlten 3 t 3-J2 Zellen (Feeder Layer)23, eine Art Geschenk von Yan Barrandon (EPFL, Lausanne, Schweiz) ausgesät.

  1. Wachsen Sie Schweizer 3 t 3-J2 Mauszellen in Dulbeccos geändert Eagle Medium mit 10 % Spender Rinderserum, 50 U/mL Penicillin-Streptomycin und 4 mM Glutamin (3 t 3 Medium) ergänzt.
  2. Wachsen Sie Keratinozyten auf letal bestrahlten 3 t 3-J2 Zellen in cFAD Mittel, eine Dulbecco geändert Eagle Medium und Hams F12 Medien Mischung (3:1) mit fötalen Rinderserum (10 %), Penicillin-Streptomycin (1 %), Glutamin (2 %), Insulin (5 µg/mL), Adenin (vernickelt 0,18 mM), Hydrocortison (0,4 µg/mL), Cholera-Toxin (0,1 nM), und Trijodthyronins (2 nM).
  3. Tag 0: 3 x 10 Samen5 bestrahlt tödlich 3 t 3-J2 Zellen, zuvor verdünnt in 3 t 3 Medium, eine Endkonzentration von 1 X 105 Zellen/mL, in jede Vertiefung des 6-Well-Platte. Bereiten Sie 9 Brunnen.
  4. Tag 1: Transduktion von primären Keratinozyten
    Hinweis: Transduktion von Keratinozyten erlaubt Quantifizierung der transcriptional Regelung des SB Transposase in die beste Dosis Kombination der beiden IDLV Vektoren (durch qRT-PCR) und die Integration von GOI (GFP) in den Zielzellen (Cytofluorimetric überprüfen -Analyse).
    1. Vor dem Abnehmen der Zellen, bereiten Sie die Trypsin-Arbeitslösung:
      0,5 % Trypsin-EDTA (10 X) 5,0 mL
      500mM EDTA (Endkonzentration = 5 mM) 0,5 mL
      1 x mL PBS 44,5
    2. Warmen Trypsin funktionierende Lösung bei 37 ° C vor dem Gebrauch. Trypsin funktionierende Lösung bei 4 ° c lagern
    3. Zum Lösen von subconfluent Keratinozyten in Kultur Medium zu entfernen, Zellen mit 1 X PBS waschen und 1 mL vorgewärmten Trypsin Arbeitslösung in jede Vertiefung. Inkubation bei 37 ° C für 15 min in der Zelle-Kultur-Inkubator.
    4. Nach der Inkubation der Zellen eines Brunnens Aufschwemmen gründlich und übertragen die Zellsuspension auf eine Zentrifugenröhrchen mit 2 mL Serum-haltigen Medium (wenn viele Zellen noch hängen, für eine zusätzliche Minuten bei 37 ° C inkubieren). Spülen Sie gut einmal mit 3 mL 1 x PBS oder frisches Medium und Zentrifugenröhrchen mit der Zellsuspension fügen Sie die Spüllösung hinzu.
    5. Für 5 min bei 580 X g Zentrifugieren und den Überstand verwerfen.
    6. Zellen mit 5 mL 1 X PBS, Zentrifuge für 5 min bei 580 X g waschen und entsorgen des Überstands.
    7. Verdünnen Sie in einem 15-mL-Polypropylen-Rohr 1.6x105 Keratinozyten in 1 mL cFAD Medium, eine Verdünnung für jede Bedingung.
    8. Verdünnen Sie Lentivirale Vektoren in 1 mL cFAD Medium in Anwesenheit von 20 μl des Polybrene (Endkonzentration von 8 µg/mL bei einem Endvolumen von 2 mL):
      Verdünnungen für Brunnen #1, #2, #3: ausgestrahlt Zellen (negative Kontrolle ohne Vektoren) zu verspotten.
      Verdünnungen für Brunnen #4, #5: IDLVTKSB-Vektor (13.000 ng von p24) + IDLVrtTA2s-M2-Vektor (48.000 ng von p24).
      Verdünnungen für Brunnen #6, #7, #8, #9: IDLVTKSB Vektor (13.000 ng von p24) + IDLVrtTA2s-M2-Vektor (48.000 ng von p24) + IDLVT2-Vektor (9.160 ng von p24).
    9. Transduzieren Sie Zellen in Suspension durch Zugabe von jeder Lentivirale Vektor-Verdünnung (1 mL) zu den entsprechenden Keratinozyten Suspension (1.6x105 Keratinozyten in 1 mL).
    10. Entfernen Sie das Medium aus 3 t 3-J2 letal bestrahlten Zellen ausgesät am Tag 0 und Platte ausgestrahlt Keratinozyten (1.6x105 Keratinozyten in 2 mL) auf sie. Nach transducing eine gut fahren Sie mit dem nächsten.
    11. Bei 25 ° C für 30 min inkubieren Sie, und übertragen Sie dann die Zellen auf 37 ° C in der Zelle-Kultur-Brutkasten für 6 h.
      Hinweis: Nicht Spinoculate primären Keratinozyten, Rentabilität und Verbreitung stark beeinflusst werden.
    12. Fügen Sie nach 6 h 1 mL cFAD Medium in jede Vertiefung. Fügen Sie 1 μM Doxycyclin (Endkonzentration) in Brunnen #5, #8 und #9. Rückkehr von Zellen auf 37 ° C.
  5. Tag 2: Ersetzen Sie cFAD Medium mit 3 mL KC Medium mit 10 ng/mL EGF.
  6. Tag 3: Trypsinize und waschen Sie Zellen aus Brunnen #1, #4 und #5 wie beschrieben vor (siehe 4.4.1, 4.4.6). Einfrieren der Zelle Pellets bei-80 ° C, total RNA zur qRT-PCR-Analyse zu extrahieren (siehe Schritt 7).
  7. Trypsinize Zellen aus gut #2, #6 und #8 wie 4.4.1 zu 4.4.5 beschrieben und Cytofluorimetric Analysen für die GFP Expression durchführen (siehe Schritt 5).
  8. Halten Sie die Kultur von Brunnen #3, #7 und #9 für mindestens 3-4 Verdoppelungen, ausreichen, um un-integrierte IDLVT2-Vektor (5 Tage für menschliche primären Keratinozyten auf Feeder Schicht überzogen) verdünnen.
  9. 6. Tag: Ca. 5 Tage post Transduktion, trypsinize Zellen (siehe Schritte 4.4.1 zu 4.4.5) aus Brunnen #3, #7 und #9 Cytofluorimetric Analyse für die GFP Expression durchführen (siehe Schritt 5).
    Hinweis: Experiment Timing und Transduktion Effizienz sind stark beeinflusst, nach Primärzelle und Variabilität der gesammelten Proben.

(5) Cytofluorimetric Analyse der primären Keratinozyten ausgestrahlt

Hinweis: Ein Durchflusszytometer konfiguriert mit einem blauen Laser (488 nm), ein roter Laser (633 nm) und Filter für die Erkennung der GFP und APC Fluoreszenz eingesetzt wird (siehe Materialtabelle).

  1. Um die Keratinozyten aus 3 t 3-J2 Feeder Layer diskriminieren, Label ausgestrahlt Keratinozyten freistehend an Tag 3 und Tag 6 (siehe Schritte 4,7 und 4,9) mit Maus monoklonalen APC-konjugierten Anti-Feeder-Antikörper.
    1. Bereiten Sie 4 mL Puffer für jede Probe Beizen:
      5 % FBS 200 ΜL
      500 mM EDTA (Endkonzentration = 2,5 mM) 20 μL
      PBS 1 x 3780 μL
    2. Waschen Sie freistehende Zellen mit 1 mL Puffer Färbung. Für 5 min bei 580 X g Zentrifugieren und den Überstand verwerfen.
    3. Aufschwemmen Sie in einem Rohr für Flow Cytometry Erwerb 5 x 104 Zellen in 100 μL der Färbung Puffer und fügen Sie 2 μL des Antikörpers Anti-Feeder (01:50). Gut mischen und 30 min auf Eis im Dunkeln inkubieren.
    4. Waschen Sie nach 30 min mit 2 mL Puffer Färbung. Für 5 min bei 580 X g Zentrifugieren und den Überstand verwerfen. In 200 μl der Färbung Puffer aufzuwirbeln.
    5. Erwerben Sie APC und GFP-Signale durch Cytofluorimetric Analyse18. Die GFP+ Zelle Bruchteil der APC-Zell-Population zeigt ausgestrahlt Keratinozyten.
      Hinweis: Falls gewünscht, beheben die gefärbte Probe vor Durchflusszytometrie mit 2 % Paraformaldehyd in PBS 1 X und Store bei 4 ° C im Dunkeln bis der Flucht.
  2. Flow Cytometry Daten analysieren, indem Sie das Verhältnis zwischen dem Anteil der GFP+PlottenZellen an den Endpunkt (5 Tage) und der Prozentsatz der GFP+Zellen 2 Tage post Transduktion, normiert auf Restniveau von den IDLVT2 ausgestrahlt Zellen.

(6) semi-quantitativen RT-PCR

Hinweis: Verwenden Sie ein PCR-Thermocycler.

  1. Extrahieren Sie Gesamt RNA aus ausgestrahlt oder Zellen mit einer RNA-Reinigung-Kit laut Protokoll des Herstellers zu kontrollieren.
    Hinweis: Gesamt-RNS kann bei-80 ° c aufbewahrt werden
  2. Synthetisieren cDNA in einer 20 µL Reaktion mit 100 ng Gesamt-RNS und ein Reverse-Transkriptase-Kit, laut Protokoll des Herstellers.
    Hinweis: cDNA kann bei-20 ° c aufbewahrt werden
  3. Design Primer spezifisch für SB100X, rtTA2s-M2 und GAPDH (ein Zimmermädchen-gen).
    Vorgeschlagene Designs:
    SB nach vorne Grundierung: 5'-GCCACTCAGCAAGGAAGAAG-3 "
    SB reverse Primer: 5'-GTGTTGGAAGACCCATTTGC-3 "
    rtTAM2 forward Primer: 5'- GACGACAAGGAAACTCGCTC-3 "
    rtTAM2 reverse Primer: 5'-TTACCCGGGAGCATGTCAA-3 "
    GAPDH forward Primer: 5'-GACCACAGTCCATGCCATCAC-3 "
    GAPDH reverse Primer: 5'CCACCACCCTGTTGCTGTAG3'
  4. Führen Sie PCR in eine endgültige Reaktionsvolumen von 50 µL. Vor allem in jedem PCR-Röhrchen montieren Sie die folgende Reaktion:
    cDNA (Verdünnung 1:5) (aus Schritt 6.2) 1,00 µL
    Grundierung (10 µM bestand) weiterleiten 1,00 µL
    Reverse Primer (10 µM bestand) 1,00 µL
    dNTPs (10 µM bestand) 1,00 µL
    Puffer (+ MgCl2) (10 X verfügbar) 5,00 µL
    Taq Polymerase (5 U/µL bestand) 0,25 µL
    Steriles Wasser 40,75 µL
  5. Verwenden Sie das folgende Programm der Thermocycler: 1 Zyklus bei 95 ° C für 5 min dann fortfahren mit 95 ° C für 30 s, 58 ° C für 30 s und 72 ° C für 30 s für 34 Zyklen für SB100X, 32 Zyklen für rtTA2s-M2 , und 25 Zyklen für GAPDH.
  6. Bereiten Sie 1 % Agarose-Gel. Lösen Sie 1 g Agarose in 100 mL TBE 1 x (10 X bestand in sterilem Wasser verdünnt), in einem Becher oder einer Flasche. Schmelzen Sie in der Mikrowelle, wirbeln jede Minute bis die Agarose komplett aufgelöst ist. Lassen Sie die geschmolzene Agarose abkühlen, bis es etwa 50 ° C erreicht, und fügen Sie 5 µL Interkalation Bromid (10 mg/mL Brühe). Gießen Sie geschmolzene Agarose in einem montierten Gel Tablett mit einem Kamm für Gelgießen.
  7. Laden Sie Proben (10 µL) auf das Agarosegel und durchführen Sie Elektrophorese.
  8. Falls gewünscht, Gel Bild zu erwerben und densitometrische Analysen auf den Bändern PCR durchführen.

(7) Quantitative RT-PCR (qRT-PCR)

Hinweis: Ein kommerzieller Sequence Detection System wird eingesetzt. PCR-Primer und 6-Carboxyfluorescein (FAM) Sonde für Glyceraldehyde-3-Phosphat-Dehydrogenase (GAPDH) sind im Handel erworben.

  1. Für Retro-Transkription siehe Punkt 6.2.
  2. Verwenden Sie Software, um design-Primer und Sonde für SB100X bestimmten.
    Vorgeschlagenen Entwurf:
    SB.2 forward Primer: 5'-GAAGAAGCCACTGCTCCAAAA-3 ",
    SB.2 reverse Primer: 5'-CCCCATGTGCAGTTGCAA-3 "
    Sonde SB FAM: 5'-CATAAGAAAGCCAGACTACGG-3 "
  3. Real-Time PCR in 96-Well-Platten mit einer PCR-Master-Mix und Grundierungen + Sonde mischen, in eine endgültige Reaktionsvolumen von 25 µL. Beachten Sie insbesondere die folgende Reaktion für jedes gut:
    cDNA (01:10 Verdünnung in sterilem Wasser) 1,00 µL
    2 x Master Mix 12,50 µL
    Primer + 20 X Sonde mischen 1,25 µL
    Steriles Wasser 10,25 µL
    Hinweis: Führen Sie alle Reaktionen in dreifacher Ausfertigung. Um Pipettieren Fehler zu vermeiden, bereiten Sie eine Mischung für mindestens n + 3 Reaktionen (ohne cDNA). Aliquoten mit einer Mehrkanal-Pipette.
  4. Real-Time PCR mit dem folgenden Programm ausführen: 1 Zyklus bei 95 ° C für 10 min, dann 40 Zyklen von 95 ° C für 15 s und 60 ° C für 1 min und Halt bei 4 ° C.
  5. Analysieren Sie qRT-PCR-Daten durch die Normalisierung des relativen Ausdrucks (RQ-Wert) des SB100X auf das Niveau von GAPDH der gleichen DNA Probe von 2ΔΔCT Quantifizierung, mit typischen Daten-Analyse-Software.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Mit dem Verfahren präsentiert hier drei IDLV Vektoren tragen die regulierten SB-Komponenten (SB100X, rtTA2S-M2 und T2-GFP Transposon) wurden verpackt und verwendet, um effizient und straff regulieren das SB-System in den menschlichen Zellen. Abbildung 1A zeigt ein Schema für in-vitro- Transduktion von HeLa-Zellen, die durchgeführt wurde, die transkriptionelle Regulierung der SB Transposase mit die beste Dosis Kombination der beiden IDLV Vektoren (berichtet in Tabelle 2) zu bewerten. Die transkriptionelle Regulierung des SB100X wurde durch qRT-PCR (Abbildung 1 b) gemessen und dargestellt als eine relative Menge (RQ) Wert in Bezug auf den aus-Zustand (IDLVTKSB allein RQ = 1). HeLa-Zellen ausgestrahlt wurde erhielt eine 8-fold Aktivierung (+ Dox) des SB100X Ausdrucks über dem Hintergrund (IDLVTKSB). Vor allem cotransduced HeLa-Zellen in der Abwesenheit von Dox zeigte Transposase Ausdruck vergleichbar mit den aus Staaten Angabe eine strikte Kontrolle des TetTK-Promotors durch rtTA2s-M2-Modulator.

Figure 1
Abbildung 1: Transduktion von HeLa-Zellen für den Ausdruck von transcriptionally reguliert SB Transposase getragene Vektoren IDLV. (A) ein Schema für in-vitro- Transduktion von HeLa-Zellen mit IDLVs für den Ausdruck der Transposase. (B) qRT-PCR-Analyse von HeLa-Zellen mit IDLVTKSB ausgestrahlt (2.600 ng von p24) in der Gegenwart (+) oder (-) fehlender IDLVrtTA2S-M2 (9.600 ng von p24) und 1 µM Doxycyclin (Dox). Die gestrichelte Linie verbindet Proben zeigen deutlich unterschiedliche Werte (*** P < 0,005). Der Versuch wurde in dreifacher Ausfertigung durchgeführt. Meine S.E.M als Fehlerbalken angezeigt wird. (Abbildung von Cocchiarella, F. Et Al., 201618geändert). Bitte klicken Sie hier für eine größere Version dieser Figur.

Als Beispiel in Abbildung 2 wird die Dosis reicht Experiment eingerichtet, dass die optimale transcriptional Regelung der Transposase erreicht. HeLa-Zellen wurden mit steigenden Dosen ausgestrahlt (130, 260 und 2.600 ng von p24) des IDLVTKSB in Kombination mit IDLVrtTA2s-M2 (960 und 9.600 ng von p24), in dem Vorhandensein oder Fehlen von Dox. Semi-quantitativen RT-PCR-Analyse zeigt deutlich, dass hohe Dosen von beiden IDLVs erforderlich waren, um stark SB100X Expression induzieren. Unterschiedliche Zielgruppen Zelltyp und Variationen in viralen Vektoren Titration können in Sup-optimale SB Ausdruck, und wir empfehlen daher Dosierung Einstellung experimentieren.

Figure 2
Abbildung 2: IDLV Dosis Einstellung Experiment in HeLa-Zellen zu definieren, die optimale Dosis-Kombination von zwei IDLVs. Semi-quantitativen RT-PCR-Analyse auf HeLa-Zellen, die zusammen mit verschiedenen Dosierungen von IDLVTKSB Vektor ausgestrahlt (130, 260 und 2.600 ng von p24) in das Fehlen oder Vorhandensein von IDLVrtTA2s-M2-Vektor (960 und 9.600 ng von p24) und Dox. Die GAPDH wurde als ein Standardsteuerelement verstärkt. SB100X Transposase und rtTA2s-M2 Ausdruck ausgewiesen unter allen getesteten Bedingungen; NC = Negativkontrolle. (Abbildung von Cocchiarella, F. Et Al., 201618geändert). Bitte klicken Sie hier für eine größere Version dieser Figur.

Die transkriptionelle SB-Regelung könnte auch in Primärzellen, besonders in diesen Zellen resistent gegen mehrere Transfektion Methoden, wie menschliche primären Keratinozyten verwendet werden. Abbildung 3 zeigt, dass eine Regelung für die Transduktion von primären Keratinozyten kultiviert auf letal 3 t 3-J2 Feeder Schicht mit IDLV Vektoren tragen die regulierten SB-Komponenten in das Vorhandensein oder Fehlen von Dox induzieren SB100X Ausdruck bestrahlt.

Figure 3
Abbildung 3: Transduktion in Aussetzung der menschlichen primären Keratinozyten mit IDLV Vektoren für die Ausprägung der transcriptionally reguliert SB Transposase und Transposon. Ein Schema für in-vitro- Transduktion von menschlichen primären Keratinozyten mit IDLVs in das Vorhandensein oder Fehlen von 1 µM Dox transcriptionally reguliert SB Transposase und Transposons, zum Ausdruck zu bringen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Die qRT-PCR-Analyse in Abbildung 4A zeigt, dass die beste Kombination von Transposase und Modulator Vektoren, die in Tabelle 2, berichtet Dosis führte zu 15-fold Aktivierung des SB Ausdruck über den aus-Zustand (-Dox). Das Experiment der Umsetzung erfolgte in Keratinozyten ausgestrahlt mit den drei IDLV Vektoren (IDLVTKSB, IDLVrtTA2s-M2 und IDLVT2) in das Vorhandensein oder Fehlen von Dox. Ausdruck von den GOI (GFP) beared von T2-Transposons, im Abteil APC wurde von Flow Cytometer Analyse 2 Tage Post-Transduktion (dpt) und an der Endopoint der Kultur (5 Tage für menschliche primären Keratinozyten) gemessen. Der Endpunkt wurde erreicht, als ausgegrenzte T2-GFP Transposon auf ein kaum nachweisbaren Niveau (durchschnittlich 0,6 %) durch Zellteilung-abhängige Verdünnung gesunken. Abbildung 4 b zeigt dem Verhältnis zwischen dem Anteil der GFP+ Zellen in das APC -Fach am Endpunkt und 2 Tage Transduktion, normiert auf die Restniveau das Transposon allein buchen. Dies gibt den Prozentsatz der Zellen, die Hosting-mindestens 1 Exemplar von der zum Ausdruck gebrachten GOI stabil in ihrem Genom, bewertet mit 12 % für menschliche primären Keratinozyten integriert.

Figure 4
Abbildung 4: Analyse des Ausdrucks der Transposase und GFP im menschlichen primären Keratinozyten ausgestrahlt. (A) qRT-PCR-Assay auf primären Keratinozyten mit IDLVTKSB und IDLVrtTA2S-M2 in das Vorhandensein oder Fehlen von 1 µM Dox ausgestrahlt. (B) Co Transduktion von primären Keratinozyten mit IDLVT2 Transposon und IDLVs für die Transposase Expression in Anwesenheit oder Abwesenheit von Dox. Auf Y-Achse Zellen GFP+ % 5dpt / GFP+ % Zellen 2 dpt * 100 (Mittelwert ± SEM von zwei Experimenten). ** zeigen deutlich unterschiedliche Werte (P < 0,05). (Abbildung von Cocchiarella, F. Et Al., 201618geändert). Bitte klicken Sie hier für eine größere Version dieser Figur.

Plasmid Beschreibung Referenzen
pCCL-TetOTKSB Zur Erzeugung von IDLVTKSB Vector Plasmid übertragen. Dieses Plasmid abgeleitet von pTetOTKSB, nach dem Klonen TetOTKSB im pCCL Lentivirale Backbone. 18, 20
pCCL-PGKrtTA2S-M2 Transfer zur Erzeugung von IDLVrtTA2sPlasmid-M2-Vektor. zur Verfügung gestellt von Prof. V. Zappavigna
pCCL-T2GFP Zur Erzeugung von IDLVT2 Vector Plasmid übertragen. Dieses Plasmid abgeleitet von pT2GFP, nach dem Klonen der GFP zwischen der T2-Transposon IRs im pCCL Lentivirale Backbone. 18, 20
pMD.Lg/pRRE.D64VInt Packaging Plasmid, IDLV Vektor zu generieren. 19
pMD2.G Plasmid Codierung für VSV-G Umschlag, Lentivirale Vektor zu generieren. 20
pRSV-Rev Rev-Plasmid, Lentivirale Vektor zu generieren. 20
Vektor Beschreibung
IDLVTKSB Integration defekt Lentivirale Vektor für den Ausdruck des SB100X unter der Kontrolle des Tet-responsive TK-Promotors.
IDLVrtTA2s-M2 Integration defekt Lentivirale Vektor für den Ausdruck der rtTA2s-M2-Modulator unter der Kontrolle der PGK Promotor.
IDLVT2 Integration defekt Lentivirale Vektor für den Ausdruck der indischen Regierung geklont zwischen der T2-Transposon-IRs.

Tabelle 1: Plasmide und Vektoren in diesem Protokoll eingesetzt. Beschreibungen und Referenzen sind vorhanden.

Vektoren HeLa (2 x 105 Zellen) Keratinozyten (1.6x105 Zellen)
IDLVTKSB 2.600 ng p24 13.000 ng p24
IDLVrtTA2s-M2 9.600 ng p24 48.000 ng p24
IDLVT2 9.160 ng p24

Tabelle 2: Optimierte Vektor-Dosen für die Transduktion von HeLa-Zellen und menschliche primären Keratinozyten.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier beschreiben wir eine allgemein zugängliche Methodik ein GOI stabil in das Genom der Zielzellen von Dornröschenzu integrieren-Umsetzung vermittelt. Obwohl das SB-System entwickelt wurde, um ein nonviral Verfahren für die Bearbeitung von Genom zu schaffen, ist die effiziente Bereitstellung der Integration Maschinen (Transposase und T2 Transposon) obligatorisch. Daher wurde eine virale Lieferung von SB-Komponenten um das SB-System auf kaum transfectable Primärzellen verwenden, in den letzten Jahren10,12,15verfolgt. Jedoch ging keiner der viralen Vektoren beschäftigt bis zu jetzt der Frage konstitutive Expression von Transposase, die das Risiko einer unkontrollierbaren rehopping der das Transposon führen könnte.

Um transcriptionally Transposase Ausdruck regulieren, nutzten wir einen modifizierten Tet-ON System16. Der minimale TK-Promoter verschmolzen zum TetO Element bei der Bindung an die rtTA2s-M2-Modulator im Beisein von Dox, eine Feinabstimmung der Transposase Aktivierung über dem Hintergrund (aus-Zustand, in Ermangelung von Dox) verliehen. Die regulatorischen Leistung hängt von der entsprechenden IDLVs (IDLVTKSB und IDLVrtTA2s-M2) Vektor-Dosis Kombination und Zelltypen (z. B. HeLa-Zellen und menschliche primären Keratinozyten). Unabhängig vom Ziel-Zellen die Vektor-Dosis muss ohne Zellviabilität Transduktion von den Zielzellen auf höchste Niveau sicherstellen, damit experimentieren einer eskalierenden Dosis-Kombination in HeLa-Zellen (oder andere Zell-Linien), die optimale Dosis zu definieren, indem semi-quantitativen RT-PCR, wird dringend empfohlen.

Umsetzung der indischen Regierung wurde Primärzellen bewertet. Menschlichen primären Keratinozyten auf letal bestrahlten 3 t 3-J2 Feeder Layer ausgesät wurden ausgestrahlt, mit 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 und IDLVT2) bei den experimentell bestimmten Dosierungen. Eine klare Dox-abhängige Aktivierung von der Transposase zeigte qRT-PCR. Stabile Integration der indischen Regierung zeigte sich darüber hinaus durch Cytofluorimetric Analyse der GFP Expression in Zellen ausgestrahlt in dem Vorhandensein oder Fehlen von Dox, zeigt die Möglichkeit, die IDLV-Plattform Fahrzeug transcriptionally geregelten SB zu beschäftigen Komponenten für die PV-Zellen und die erfolgreiche Integration von einem GOI in das Genom der Zielzellen.

IDLV Vektor Produktion und Transduktion von Zielzellen der optimale Effizienz und Vektor Dosis Kombination sind die entscheidenden Schritte in das Protokoll. Niedrige Transfektion Effizienz von HEK293T Zellen führen niedrige Vektor Ausbeute. Die Definition von Dosen von IDLVTKSB und IDLVrtTA2s-M2 ist notwendig, um eine Unwucht des Tet-ON-Komponenten zu vermeiden, die hohe Undichtigkeit in der Abwesenheit des Modulators oder in niedrigen Falte Induktion des Projektträgers TetOTK Dox Behandlung führen kann. Diese kritischen Schritte könnte durch kleinere Modifikationen begegnet werden. Beispielsweise könnte die Transfektion Protokoll mit kommerziellen Transfektion Reagenzien standardisiert werden. Die Transduktion Protokoll sollte je nach Zelltyp von Interesse, vor allem wenn man bedenkt, ob Spinoculation Transduktion Effizienzsteigerungen ohne Zellviabilität angepasst werden. Vektoren und Polybrene hinzugefügt, um dem Kulturmedium von den Zielzellen und nach 6 Stunden oder über Nacht Inkubation mit frischem Medium ersetzt. Es ist auch erwähnenswert, dass der Anteil der GFP+ Zellen 5 Tage nach Transduktion von Hintergrund-Integration von IDLVs betroffen sein könnten.

Eine kleine Einschränkung dieser Methode ist, dass die IDLV Vektoren vorübergehend durch Transfektion von HEK293T Zellen produziert werden. Je nach der Vektor wiederholt Dosen verwendet werden, Vektor Produktionen erforderlich sind. Eine zweite Einschränkung bezieht sich auf die Länge der indischen Regierung, wie die Ladekapazität des IDLV Vektors ungefähr 8 kb ist.

Zusammenfassend, ermöglicht diese Methode hier die Integration der GOI durch transcriptionally geregelten SB-Komponenten verpackt in IDLV Vektoren, die zu den bestehenden Methoden, SB-System, liefern zahlreiche Tropismus und hohe Transduktion Effizienz zeigen. Darüber hinaus ermöglicht das modifizierte Tet-ON System eine transcriptional Regelung des SB100X Ausdrucks, ein relevantes Thema in das Risiko von Transposon wieder hüpfen oder in mehreren seriellen Umsetzung Ereignisse, wenn sie benötigt werden. Mögliche Anwendungen dieser Methode sind Genom Engineering von Zelllinien (z. B. HeLa-Zellen, HEK293 Zellen), stabile Verpackungszellen für virale Vektoren zu etablieren und Integration der therapeutischen Gene in klinischen relevanten Primärzellen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir danken Prof. Zappavigna, Universität von Modena und Reggio Emilia, Modena, Italien für die Bereitstellung von uns mit dem pCCL-PGKrtTA2S-M2-Plasmid. Wir erkennen auch Prof Z. Ivics (Paul Ehlrich Institut, Langen, Deutschland) und Prof. Z. Izvak (Max Delbruck-Centrum für Molekularmedizin, Berlin, Deutschland) für pCMVSB100X und pT2/BH Plasmide. Diese Arbeit wurde von DEBRA internationalen und italienischen Ministerium für Universität und Forschung unterstützt.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics