Um método eficiente em Vitro transposição por um sistema de beleza dormindo Transcriptionally regulado empacotado em um vetor de Lentivirus defeituoso de integração

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este protocolo descreve um método para alcançar a integração estável de um gene de interesse no genoma humano pelo sistema transcriptionally regulado de Bela adormecida . Preparação da integração dos vetores de Lentivirus defeituosos, a transdução em vitro de células humanas e o ensaio molecular em células transduzidas são relatados.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

O transposon Bela adormecida (SB) é um sistema de integração não-virais com eficácia comprovada para transferência genética e genômica funcional. Para otimizar a maquinaria de transposon SB, uma transposase hiperativo transcriptionally regulado (SB100X) e baseada em T2 transposon são empregados. Normalmente, o transposase transposon providenciam e transitoriamente por transfeccao Plasmideo e SB100X expressão é impulsionado por um promotor constitutivo. Aqui, descrevemos um método eficiente para entregar os componentes SB em células humanas que são resistentes a vários métodos de Transfeccao de física e química, para controlar a expressão de SB100X e integrar estàvel um gene de interesse (GOI) através de um "cortar e colar" SB mecanismo. A expressão de transposase hiperativo é rigidamente controlada pela sistema de Tet-ON, amplamente utilizado para controlar a expressão do gene desde 1992. O gene de interesse é ladeado por repetições invertidas (IR) do transposon T2. Ambos os componentes do SB são embalados em integração defeituosos vetores Lentivirus transitoriamente produzidos nas células HEK293T. Células humanas, ou linhas de célula ou células primárias do tecido humano, estão em vitro transitoriamente transfectadas com vetores virais. Após adição de doxiciclina (dox, tetraciclina analógica) no meio de cultura, um ajuste fino de expressão transposase é medido e resulta em uma integração duradoura do gene de interesse no genoma das células tratadas. Este método é eficiente e aplicável para a linha de celular (por exemplo, as células HeLa) e células primárias (por exemplo, queratinócitos primárias humanas) e, portanto, representa uma ferramenta valiosa para a engenharia genética e a transferência do gene terapêutico.

Introduction

O hiperativo transposase SB100X acoplado ao transposon baseada em T2 já foi usado no gene pré-clínicos terapia aplicações1,2,3, genoma modificações4,5, e pluripotentes induzidas células-tronco (iPSC) reprogramação6,7. Normalmente, os componentes de SB transitoriamente são fornecidos pelo transfeccao Plasmideo e um forte promotor constitutivo conduz a expressão do transposase. No entanto, apesar dos métodos aperfeiçoados de novos do transfection, entrega do dois-componente sistema permanece um desafio para muitas aplicações. Assim, o desenvolvimento de um novo protocolo de entrega tem interesse crescente. Além de métodos de Transfeccao para plasmídeo8 e mRNA9, viral entrega baseada em adenovírus10,11, adeno-associado (AAV) viral12, Baculovirus13, gammaretroviral14 e vetores Lentivirus15 foi proposto no passado. Notavelmente, o sistema de escolha deve garantir uma entrega transitória dos componentes SB sem integração do vetor viral. No entanto, a expressão constitutiva de transposase gera preocupações de segurança devido ao risco de rehopping incontrolável do transposon.

Portanto, o Regulamento transcriptional de SB100X por um refinado sistema de Tet-ON é o primeiro desafio. Um promotor Tet-responsivo modificado, obtido substituindo o original promotor desenvolvidos mínimo citomegalovírus (CMV) com o promotor mínimo-(81) do gene Timidine quinase (TK) de Herpes Simplex vírus 1 (HSV-1)16, é clonado a montante do CDNA de SB100X (pTetOTKSB100X). A mutação reversa-tetraciclina-liberada rtTA2s-M217 manifesta-se sob o controle do promotor constitutivo forte (promotor fosfoglicerato, PGK) clonado em um plasmídeo diferente (pCCL-PGKrtTA2S-M2). Quando adicionado ao meio de cultura, dox vincula o rtTA2s-modulador M2 e amarras o promotor Tet ou complexo, resultando em rigidamente regulamentada indução da expressão de SB100X18.

O segundo grande desafio surge o transfeccao ineficiente de células humanas primárias por vários métodos físicos e químicos. Entregar eficientemente transposase em células humanas resistentes para transfeccao, o SB100X e o rtTA2s-fitas de expressão M2 são empacotados em dois vetores de Lentivirus defeituoso (IDLVs) de integração19: IDLVTKSB e IDLVrtTA2s- M2. Vetores virais são produzidos transitoriamente como vetores de terceira geração em HEK293T células20 e pseudotyped com a glicoproteína G do vírus da estomatite vesiculosa dos (VSV-G), que confere um amplo espectro de infecção. Partículas de vetor são concentradas por ultracentrifugação e tituladas por HIV-1 Gag p24 immunocapture. Para transduce linhas celulares e as células primárias, partículas de vetor são complexadas com polybrene e são incubadas com células alvo na presença ou ausência de dox. Ativação de dependentes de drogas de SB100X expressão em células transduzidas é medida pelo quantitativo de RT-PCR (qRT-PCR)18.

Uma vez que a expressão SB100X Tet-regulado é demonstrada, transposição do governo da Índia (por exemplo, proteína verde fluorescente, GFP) no genoma da célula alvo segue os eventos moleculares claramente esquematizados por Bak e Mikkelsen21. Um terceiro IDLV vetor carregando uma gaveta de expressão para o governo indiano clonado entre o IRs transposon-T2 (IDLVT2) tem de ser construído e empacotado como mencionado acima. Por último, os três vetores IDLV podem ser usados eficientemente transduce células humanas (por exemplo, os queratinócitos primários) em vitro e integrar o governo indiano na presença de doxiciclina18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. os plasmídeos empregados

Nota: Plasmídeo pCCL-PGKrtTA2S-M2 foi gentilmente fornecidas pelo Prof Zappavigna (Universidade de Modena e Reggio Emilia, Módena, Itália). O plasmídeo pCMVSB100X carregando a sequência de código de transposase hiperativo e plasmídeo de transposon de pT2/BH foram gentilmente cedidos pelo Prof Z. Ivics (Instituto de Paul Ehrlich, Langen, Alemanha) e Prof Z. Izvak (Max Delbruck centro de Medicina Molecular, Berlim, Alemanha).

  1. Para todos os clonagem em Escherichia Coli (e. coli), siga a estratégia de clonagem do processo de escolha e a enzima de restrição ou amplificação por PCR do fragmento a ser clonado.
    Nota: A tabela 1 resume todos os plasmideos empregados no presente protocolo. Uma descrição e referências para cada plasmídeo são fornecidas.

2. produção viral vector

Nota: Todos os vetores virais são produzidos em uma capa de risco biológico em um nível de confinamento de biossegurança BSL2, de acordo com as regras institucionais e regulamentares.

  1. Pilhas HEK293T aderentes de cultura em meio de águia de Dulbecco modificado suplementado com 10% de soro de HyClone, 100 U/mL de penicilina-estreptomicina e glutamina de 2 mM.
  2. Dia 0: Prepare cinco placas/viral preparação de 15 cm e sementes 5.5x106 células em 30 mL do meio.
  3. Dia 1: Transfection
    1. Antes de iniciar a transfeccao, prepare 100 mL de solução salina de reserva 2 x HEPES (HBS):
      NaCl (5m) 5,6 mL
      HEPES (1 M) 10,0 mL
      Na2HPO4 (0,5 M) 0,3 mL
      Estéril 84,1 mL de água
      Ajustar o pH 7.1 com 37% HCl.
      Nota: 2 x HBS pode ser armazenado a 4 ° C. Um pH exato é extremamente importante para o transfection eficiente. Faixa de pH ideal é 7.10 para 7.12.
    2. Médio de remover e adicionar 22,5 mL/placa de fresco médio 4h antes do transfection.
    3. Transfect HEK293T células com o plasmídeo de transferência, o plasmídeo de empacotamento de pMD.Lg/pRRE.D64VInt, o plasmídeo de codificação de envelope de pMD2.G e o pRSV-Rev (tabela 1) de acordo com a seguinte montante/placa:
      transferência do plasmídeo 25,00 µ g
      pMD.Lg/pRRE.D64VInt 16,25 µ g
      pMD2.G 8.75 µ g
      pRSV-Rev 6.25 µ g
      Nota: DNAs plasmideo são preparados de acordo com o protocolo de CsCl descrito por Maniatis22 ou usando um kit de purificação de plasmídeo livre de endotoxinas.
      1. Resuspenda 56.25 µ g/ml de DNA (mistura de 4 plasmídeos) 1,125 mL de água estéril e adicionar 125 µ l de 2,5 M CaCl2 (solução A).
      2. Adicione 1,250 mL de 2 x HBS para um tubo de centrifuga conico de estéril 15 mL (solução B).
      3. Adicionar um (1,250 mL) de solução a B (1,250 mL) gota a gota ao borbulhando com uma pipeta de 1 ou 2 mL (solução de transfeccao, volume total 2,500 mL).
      4. Incube durante 20 min em temperatura ambiente (RT).
      5. Utilizando uma micropipeta P1000, distribua toda a solução de transfeccao (2,500 mL) para a monocamada de células gota a gota.
    4. Incube durante uma noite em uma incubadora de cultura de célula a 37 ° C, 5% de CO2.
  4. Dia 2: Remover o meio e adicionar 15 mL de meio fresco (consulte a etapa 2.1).
  5. Dia 3: Coletar e concentrar-se o sobrenadante contendo partículas Lentivirus.
    1. Recolher o sobrenadante (~ 70 mL) de todos (n = 5) placas de células transfectadas, filtrar um 0,45 µm PESS filtrar e preencher 2 tubos de polyallomer (1 polegada x 3,5 polegadas) / viral preparação.
    2. Concentre as partículas de vetor por ultracentrifugação a 106.000 x g, durante 2,5 h, a 15 ° C, com freio.
    3. Imediatamente depois de parar a ultracentrifugação (para evitar a ressuspensão da pelota no tubo), delicadamente despeje o sobrenadante em um recipiente contendo água sanitária 10% e suspender as 2 bolinhas mal visíveis em 100 µ l de PBS 1x (+ 1% de BSA). Isso é normal, pois a pelota é claro e muito pequeno. Usa o vetor de concentrados preparado na hora, ou alíquota e armazenar virais preparações a-80 ° C.
      Atenção: O sobrenadante contém particulas de Lentivirus que devem ser branqueadas cuidadosamente antes de eliminar os resíduos de risco biológico.
  6. Para dosear a preparação de vetor viral, use um kit de immunocapture p24 HIV-1 Gag de acordo com o protocolo do fabricante.
    Nota: Para padronizar a produção de vetor viral, baseada em lipossomas reagentes poderiam ser empregados. No entanto, o título de vetor viral é altamente dependente de transfeccao eficiência e pureza do ADN do plasmídeo.

3. transdução da linhas de células humanas (por exemplo, as células HeLa)

Nota: As células HeLa são cultivadas em meio da águia de Dulbecco modificado suplementado com 10% de soro fetal bezerro, 100 U/mL de penicilina-estreptomicina e glutamina de 2 mM. A tabela 1 resume todos os vetores utilizados neste protocolo. É fornecida uma descrição para cada vetor. Transdução de células HeLa permite a verificação do Regulamento do transcriptional de SB transposase na melhor combinação de dose de dois vetores IDLV. Variação das doses IDLV pode estar relacionada com vetor titulação de partícula e tipo de célula de destino.

  1. Dia 0: Semente de 2 x 105 células em 3 mL de meio para cada poço de uma placa de 6. Prepare 4 poços.
  2. Dia 1: Transdução de células HeLa.
    1. Para cada condição, diluir Lentivirus vetores até um volume final de 1 mL de meio (ver nota acima) na presença de 10 μL de polybrene (concentração final 8 μg/mL):
      Diluição para bem #1: zombar transduzidas células (controle negativo).
      Diluição para bem #2: vetor IDLVTKSB (2.600 ng de p24).
      Diluição para poços 3 #, 4 #: vetor IDLVTKSB (2.600 ng de p24) + IDLVrtTA2s-vector M2 (9.600 ng de p24).
    2. Remover o meio de cada poço onde as células HeLa foram banhadas no dia 0 e adicionar diluições de vetor de Lentivirus para o correspondente bem.
    3. Spinoculate a placa de 6 a 754 x g durante 45 min, 20-25 ° C, e em seguida traslado a placa de 6 para uma incubadora de cultura celular em 37 ° C e 5% de CO2.
    4. Após 6 h, substitua os vetores contendo médios meio fresco em todos os poços e adicionar doxiciclina a 1 μM em bem #4. Colocar a placa em uma incubadora de cultura de célula a 37 ° C por 48 h.
  3. Dia 3: Preparação de centrifugado para extração de RNA.
    1. Antes de retirar as células, prepare uma solução de trabalho de tripsina (1 x):
      2,5% tripsina (10 x) 5,0 mL
      500 mM EDTA (concentração final = 5 mM) 0,5 mL
      1 x mL de PBS 44,5
    2. Solução de trabalho de tripsina aquecido a 37 ° C antes do uso. Armazenar a solução de trabalho de tripsina a 4 ° C.
    3. Médio de remover e lavar as células com PBS 1x. Adicionar 0,5 mL de solução de trabalho de tripsina previamente aquecido a 37 ° C a cada poço e incubar a 37 ° C por 7 min (em uma incubadora de cultura de células).
    4. Após a incubação, adicionar 0,5 mL de soro contendo médio para cada poço para inactivar a tripsina e coletamos células num tubo de centrífuga. Lave bem uma vez com 3 mL de 1X PBS e centrifugar a suspensão de eritrócitos durante 5 min à 240 x g.
    5. Lavam-se células com 5 mL de 1X PBS, centrifugar durante 5 min à 240 x g e descartar o sobrenadante. Usar celular recém coletados pelotas ou armazenar a-80 ° C. Extrair o RNA total de pelotas para realizar a RT-PCR semi-quantitativa (consulte a etapa 6).

4. transdução de células primárias humanas (por exemplo, queratinócitos)

Nota: Humanos queratinócitos primários são semeados no letalmente irradiados 3T3-J2 células (camada de alimentador)23, um presente tipo de Yan Barrandon (EPFL, Lausanne, Suíça).

  1. Desenvolvem-se células de rato Swiss 3T3-J2 em modificado Eagle suplementado de Dulbecco com 10% de soro de bovino doador, 50 U/mL de penicilina-estreptomicina e glutamina 4mm (3T3 médio).
  2. Crescer queratinócitos chapeados em células de letalmente irradiados 3T3-J2 em cFAD médio, meio de um Dulbecco de Eagle modificado e mistura de mídia F12 do Ham (3:1) contendo soro fetal bovino (10%), insulina (5 µ g/mL), adenina (penicilina-estreptomicina (1%), glutamina (2%) 0,18 mM), hidrocortisona (0,4 µ g/mL), a toxina da cólera (0,1 nM) e a triiodotironina (2 nM).
  3. Dia 0: Semente 3 x 105 letalmente irradiados células 3T3-J2, previamente diluídas em 3T3 médio para uma concentração final de 1 X 105 células/mL, em cada poço da placa de 6. Prepare-se 9 poços.
  4. Dia 1: Transdução de queratinócitos primários
    Nota: Transdução de queratinócitos permite a quantificação da regulação transcricional do SB transposase na melhor combinação de dose de dois vetores IDLV (por qRT-PCR) e para verificar a integração de GOI (GFP) nas células alvo (por cytofluorimetric análise).
    1. Antes de retirar as células, prepare a solução de trabalho de tripsina:
      0,5% trypsin-EDTA (10x) 5,0 mL
      500mM EDTA (concentração final = 5 mM) 0,5 mL
      1 x mL de PBS 44,5
    2. Solução de trabalho de tripsina aquecido a 37 ° C antes do uso. Armazenar a solução de trabalho de tripsina a 4 ° C.
    3. Para desanexar Observacao queratinócitos em cultura, remover médio, lavam-se células com PBS 1x e adicione 1 mL de solução de trabalho de tripsina pré-aquecido a cada poço. Incube a 37 ° C por 15 min na incubadora de cultura celular.
    4. Após a incubação, Ressuspender as células de um poço completamente e transferir a suspensão de células para um tubo de centrífuga contendo 2 mL de soro contendo médio (se muitas células ainda estão conectadas, incubar por um adicional min a 37 ° C). Lave bem uma vez com 3 mL de 1X PBS ou meio fresco e adicionar a solução de lavagem para tubo de centrífuga com a suspensão de eritrócitos.
    5. Centrifugue por 5 min a 580 x g e descartar o sobrenadante.
    6. Lavam-se células com 5 mL de 1X PBS, centrifugar por 5 min a 580 x g e descartar o sobrenadante.
    7. Em um tubo de polipropileno de 15 mL, dilua 1.6x105 queratinócitos em 1 mL de meio de cFAD, uma diluição para cada condição.
    8. Dilua Lentivirus vetores em 1 mL de meio de cFAD na presença de 20 μL de polybrene (concentração final de 8 µ g/mL em um volume final de 2ml):
      Diluições para poços 1 #, 2 #, 3 #: zombar transduzidas células (controlo negativo sem vetores).
      Diluições para poços de 4 #, 5 #: vetor IDLVTKSB (13.000 ng de p24) + IDLVrtTA2s-vector M2 (48.000 ng de p24).
      Diluições para poços de 6 #, 7 #, 8 #, #9: vector IDLVTKSB (13.000 ng de p24) + IDLVrtTA2s-vector M2 (48.000 ng de p24) + IDLVT2 vector (9.160 ng de p24).
    9. Transduce células em suspensão, adicionando cada diluição de vetor de Lentivirus (1 mL) para a correspondente suspensão de queratinócitos (1.6x105 queratinócitos em 1 mL).
    10. Remova o meio de células 3T3-J2 letalmente irradiados semeadas no dia 0 e placa transfectada queratinócitos (1.6x105 queratinócitos em 2 mL) em direção a eles. Depois transducing um poço prosseguir com o próximo.
    11. Incubar a 25 ° C por 30 min e depois transferir as células a 37 ° C, a incubadora de cultura celular para 6 h.
      Nota: Não spinoculate queratinócitos primários, como a viabilidade e proliferação será fortemente afetado.
    12. Após 6 h, adicione 1 mL de meio de cFAD a cada poço. Adicione 1 doxiciclina μM (concentração final) em poços #5, #8 e #9. Células de retorno a 37 ° C.
  5. Dia 2: Substituir cFAD medium com 3 mL de meio KC com 10 ng/mL EGF.
  6. Dia 3: Trypsinize e lavar as células dos poços #1, #4 e #5 como descrito antes (ver 4.4.1 a 4.4.6). Congelar as pelotas de célula a-80 ° C para extrair o RNA total para análise de qRT-PCR (consulte a etapa 7).
  7. Trypsinize células de bem #2, #6 e #8 conforme descrito nas etapas 4.4.1 a 4.4.5 e realizar a análise de cytofluorimetric para a expressão de GFP (Veja passo 5).
  8. Manter a cultura de poços #3, #7 e #9 pelo menos 3-4 doublings, suficientes para diluir un-integrado IDLVT2 vector (5 dias para humanos queratinócitos primários chapeados na camada do alimentador).
  9. Dia 6: Aproximadamente 5 dias post transdução, trypsinize células (ver passos 4.4.1 a 4.4.5) de poços #3, #7 e #9 para realizar análise de cytofluorimetric para expressão de GFP (Veja passo 5).
    Nota: Eficiência de sincronismo e transdução do experimento são altamente influenciados pelo tipo de célula primária e pela variabilidade das amostras coletadas.

5. Cytofluorimetric análise sobre transduzidos queratinócitos primários

Nota: Um citômetro de fluxo, configurado com um laser azul (488 nm), um laser vermelho (633 nm) e filtros para a deteção da fluorescência de GFP e APC é empregada (ver Tabela de materiais).

  1. Para discriminar os queratinócitos da camada de alimentador 3T3-J2, rótulo transfectado queratinócitos destacados no dia 3 e dia 6 (consulte as etapas 4.7 e 4.9) com mouse monoclonal APC-anticorpo conjugado antialimentador.
    1. Prepare-se 4 mL de tampão para cada amostra de coloração:
      5% FBS 200 ΜL
      500 mM EDTA (concentração final = 2,5 mM) 20 μL
      ΜL de PBS 1 x 3780
    2. Lavam-se células moradia com 1 mL de tampão de coloração. Centrifugue por 5 min a 580 x g e descartar o sobrenadante.
    3. Em um tubo para aquisição de citometria de fluxo, resuspenda 5 x 104 células em 100 μL de tampão, coloração e adicionar 2 μL do anticorpo antialimentador (01:50). Misture bem e incube por 30 min no gelo no escuro.
    4. Após 30 min, lave com 2 mL de tampão de coloração. Centrifugue por 5 min a 580 x g e descartar o sobrenadante. Resuspenda em 200 μL de tampão de coloração.
    5. Adquira sinais APC e GFP por análise de cytofluorimetric18. A fração de células GFP+ da população celular APCindica transduzidos queratinócitos.
      Nota: Se desejar, consertar a amostra manchada antes de citometria de fluxo com 2% paraformaldeído em PBS 1 x e loja a 4 ° C, no escuro até a execução.
  2. Analisar dados de citometria de fluxo, traçando a relação entre a porcentagem de GFP+células no ponto de extremidade (5 dias) e a porcentagem de GFP+células 2 dias post transdução, normalizada a nível residual de IDLVT2-transfectadas células.

6. semi-quantitativo de RT-PCR

Nota: Use um termociclador PCR.

  1. Extraia o total RNA de transfectadas ou controlar as células usando um kit de purificação de RNA, de acordo com o protocolo do fabricante.
    Nota: O RNA Total pode ser armazenado a-80 ° C.
  2. Sintetizar o cDNA em uma reação de 20 µ l usando 100 ng de RNA total e um kit de transcriptase reversa, de acordo com o protocolo do fabricante.
    Nota: o cDNA pode ser armazenado a-20 ° C.
  3. Projeto primers específicos para SB100X, rtTA2s-M2 e GAPDH (um gene de limpeza).
    Projetos sugeridos:
    SB encaminhar cartilha: 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB reverter a primeira demão: 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 para a frente da primeira demão: 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 inverter a primeira demão: 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH encaminhar cartilha: 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH reverter a primeira demão: 5'CCACCACCCTGTTGCTGTAG3'
  4. Realize PCR em um volume final de reação de 50 µ l. Em particular, monte em cada tubo PCR a seguinte reação:
    cDNA (diluição 1:5) (a partir de passo 6.2) 1,00 µ l
    Encaminhar a cartilha (estoque de 10 µM) 1,00 µ l
    Reverter a primeira demão (estoque de 10 µM) 1,00 µ l
    dNTPs (estoque de 10 µM) 1,00 µ l
    Tampão (+ MgCl2) (10 x estoque) 5,00 µ l
    Taq polimerase (estoque de 5 U / µ l) 0,25 µ l
    µ L de água estéril 40.75
  5. Use o seguinte programa do termociclador: 1 ciclo a 95 ° C por 5 min depois prosseguir com a 95 ° C por 30 s, 58 ° C por 30 s e 72 ° C por 30 s para 34 ciclos para SB100X, 32 ciclos para rtTA2s-M2 e 25 ciclos para GAPDH.
  6. Prepare o gel de agarose 1%. Dissolva 1 g de agarose em 100 mL de TBE 1 x (10 x estoque diluído em água estéril), em um béquer ou balão. Derreta no microondas, rodando a cada minuto até a agarose é completamente dissolvido. Arrefecer o agarose derretido até atingir cerca de 50 ° C e em seguida, adicione 5 µ l de brometo de etídio (estoque de 10 mg/mL). Despeje a agarose derretido em uma bandeja de gel de montado com um pente, gel de fundição.
  7. Carregar amostras (10 µ l cada) sobre o gel de agarose e eletroforese de executar.
  8. Se desejar, adquirir imagens de gel e executar a análise densitométricos das bandas PCR.

7. quantitativo de RT-PCR (qRT-PCR)

Nota: Um sistema de detecção de sequência comercial é empregado. Iniciadores de PCR e 6-carboxyfluorescein (FAM) sonda para gliceraldeído 3-fosfato-desidrogenase (GAPDH) são adquiridos comercialmente.

  1. Para retro-transcrição, consulte Passo 6.2.
  2. Use o software para projetar primers e sonda específica para SB100X.
    Projeto sugerido:
    SB.2 para a frente da primeira demão: 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 inverter a primeira demão: 5'-CCCCATGTGCAGTTGCAA-3'
    sonda FAM SB: 5'-CATAAGAAAGCCAGACTACGG-3'
  3. Realizar o PCR em tempo real em placas de 96 poços com um PCR Master Mix e cartilhas + sonda se misturam, em um volume final de reação de 25 µ l. Em particular, considere a seguinte reação para cada poço:
    cDNA (01:10 diluição em água estéril) 1,00 µ l
    2 x µ l do Mix Master 12,50
    As primeiras demão + 20 sonda x mistura 1,25 µ l
    µ L de água estéril 10.25
    Nota: Execute todas as reacções em triplicado. Para evitar erros de pipetagem, prepare uma mistura para pelo menos n + 3 reações (sem cDNA). Alíquota usando uma pipeta multicanal.
  4. Executar o PCR em tempo real usando o programa a seguir: 1 ciclo a 95 ° C por 10 min, então 40 ciclos de 95 ° C por 15 s e 60 ° C por 1 min e espera a 4 ° C.
  5. Analise dados de qRT-PCR normalizando a expressão relativa (valor RQ) da SB100X ao nível de GAPDH da mesma amostra do cDNA por 2ΔΔCT quantificação, usando software de análise de dados típicos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Usar o procedimento apresentado aqui, três vectores IDLV, carregando os componentes SB regulamentados (SB100X, rtTA2S-transposon M2 e T2-GFP) foram embalados e costumava entregar eficientemente e firmemente, regular o sistema de SB em células humanas. A figura 1A mostra um esquema para em vitro transdução de células HeLa, que foi realizado para avaliar o Regulamento transcriptional de transposase SB com a melhor combinação de dose de dois vetores IDLV (relatado na tabela 2). A regulação transcricional de SB100X foi medida por qRT-PCR (figura 1B) e plotada como um valor relativo de quantidade (RQ) em relação ao estado de fora (RQ sozinho IDLVTKSB = 1). Nas células de HeLa transduzidas, foi obtida uma ativação 8 vezes (+ dox) da expressão de SB100X sobre o plano de fundo (IDLVTKSB). Nomeadamente, cotransduced as células HeLa, na ausência de dox mostraram transposase expressão comparável aos Estados desligados, indicando um controlo apertado de promotor TetTK por rtTA2s-modulador M2.

Figure 1
Figura 1: Transdução de HeLa células para a expressão de transcriptionally regulado SB transposase transportada por vetores IDLV. (A) um esquema para transdução em vitro de células HeLa com IDLVs para a expressão de transposase. (B) análise de qRT-PCR de células HeLa transfectadas com IDLVTKSB (2.600 ng de p24) na presença (+) ou ausência (-) de IDLVrtTA2S-M2 (9.600 ng de p24) e 1 µM doxiciclina (dox). Linha tracejada conecta amostras apresentando valores significativamente diferentes (* * * P < 0.005). O experimento foi realizado em triplicata. Quer dizer S.E.M é mostrado como barras de erro. (Figura modificada de Cocchiarella, F. et al., 201618). Clique aqui para ver uma versão maior desta figura.

Por exemplo, a Figura 2 mostra a dose variando experimento criado para alcançar o ideal Regulamento transcriptional de transposase. Células HeLa foram transfectadas com o aumento de doses (130, 260 e 2.600 ng de p24) de IDLVTKSB em combinação com IDLVrtTA2s-M2 (960 e 9.600 ng de p24), na presença ou ausência de dox. Análise de RT-PCR semi-quantitativa mostra claramente que altas doses de ambos os IDLVs eram obrigados a induzir fortemente SB100X expressão. Tipo de célula de destino diferente e variações na titulação de vetor viral podem resultar na expressão de SB sup-ideal, e, portanto, recomendamos realizar experimentos de ajuste de dosagem.

Figure 2
Figura 2: experimento de ajuste de dose IDLV em células HeLa, para definir a combinação de dose ideal dos dois IDLVs. Análise de RT-PCR semi-quantitativa em células HeLa co transfectadas com diferentes doses de vetor IDLVTKSB (130, 260 e 2.600 ng de p24) na ausência ou presença de IDLVrtTA2s-vetorial de M2 (960 e 9.600 ng de p24) e dox. A GAPDH foi amplificado como um controle padrão. SB100X transposase e rtTA2s-expressão M2 são relatados em todas as condições testadas; NC = controlo negativo. (Figura modificada de Cocchiarella, F. et al., 201618). Clique aqui para ver uma versão maior desta figura.

O sistema de SB de regulamentado transcriptional também poderia ser usado em células primárias, particularmente nas células resistentes a vários métodos de transfeccao, como humanos queratinócitos primários. A Figura 3 mostra um esquema para a transdução de queratinócitos primários cultivadas sobre letalmente irradiados 3T3-J2 camada de alimentador, com vetores IDLV carregando os componentes SB regulamentados, na presença ou ausência de dox para induzir a expressão de SB100X.

Figure 3
Figura 3: transdução em suspensão de queratinócitos primários humanos com IDLV vectores para a expressão de transcriptionally regulado SB transposase e transposon. Um regime de transdução em vitro de queratinócitos primários humanos com IDLVs para expressar transcriptionally regulado SB transposase e transposon, na presença ou ausência de 1 µM dox. Clique aqui para ver uma versão maior desta figura.

A análise de qRT-PCR na Figura 4A mostra que a melhor dose de combinação de vetores transposase e modulador, relatado na tabela 2, resultou em 15-fold ativação da expressão de SB sobre o fora-de-estado (-dox). A experiência de transposição foi realizada em queratinócitos transformados com os três vetores IDLV (IDLVTKSB, IDLVrtTA2s-M2 e IDLVT2) na presença ou ausência de dox. Expressão do GOI (GFP) aguentado por transposon-T2, no compartimento do APC , foi medido por transdução de pós (dpt) 2 dias análise citômetro de fluxo e o endopoint da cultura (5 dias para queratinócitos primários humanos). O ponto de extremidade foi alcançado quando dificultando transposon T2-GFP caiu para um nível quase não detectável (uma média de 0,6%) devido à diluição de divisão celular-dependente. Figura 4B mostra a relação entre a porcentagem de GFP+ células no compartimento do APC no ponto de extremidade e 2 dias postar transdução, normalizada para o nível residual do transposon sozinho. Isso indica a porcentagem de células de hospedagem pelo menos 1 exemplar do governo do Índia expressado estàvel integrado no seu genoma, avaliada em 12% para queratinócitos primários humanos.

Figure 4
Figura 4: análise da expressão de transposase e GFP em queratinócitos primários humanos transduzidos. (A) ensaio de qRT-PCR em queratinócitos primários transformados com IDLVTKSB e IDLVrtTA2S-M2 na presença ou ausência de 1 µM dox. (B) co transdução de queratinócitos primários com transposon IDLVT2 e IDLVs para expressão de transposase na presença ou ausência de dox. No eixo y, %+ de GFP células 5dpt / %+ de GFP células 2 dpt * 100 (média ± SEM das duas experiências). * * Mostrar valores significativamente diferentes (P < 0,05). (Figura modificada de Cocchiarella, F. et al., 201618). Clique aqui para ver uma versão maior desta figura.

Plasmídeo Descrição Referências
pCCL-TetOTKSB Transferência do plasmídeo usado para gerar o vetor IDLVTKSB. Este plasmídeo derivado de pTetOTKSB, após a clonagem TetOTKSB na espinha dorsal de Lentivirus pCCL. 18, 20
pCCL-PGKrtTA2S-M2 Transferência do plasmídeo usado para gerar IDLVrtTA2s-vector M2. fornecido pelo Prof V. Zappavigna
pCCL-T2GFP Transferência do plasmídeo usado para gerar o vetor IDLVT2. Este plasmídeo derivado de pT2GFP, após a clonagem do GFP entre o IRs transposon-T2 na espinha dorsal de Lentivirus pCCL. 18, 20
pMD.Lg/pRRE.D64VInt Embalagem do plasmídeo para gerar o vetor IDLV. 19
pMD2.G Plasmídeo que codifica para envelope de VSV-G gerar o vetor de Lentivirus. 20
pRSV-Rev Rev plasmídeo vetor de Lentivirus de gerar. 20
Vector Descrição
IDLVTKSB Defeituoso vector Lentivirus de integração para a expressão da SB100X sob o controle do promotor Tet-responsivo TK.
IDLVrtTA2s-M2 Vetor de Lentivirus defeituoso de integração para a expressão do rtTA2s-modulador M2 sob o controle do promotor PGK.
IDLVT2 Vetor de Lentivirus defeituoso de integração para a expressão do governo da Índia clonado entre o IRs T2-transposon.

Tabela 1: plasmídeos e vetores utilizados neste protocolo. Descrições e referências são fornecidas.

Vetores HeLa (2 x 105 células) Queratinócitos (células de5 1.6x10)
IDLVTKSB 2.600 ng p24 13.000 ng p24
IDLVrtTA2s-M2 9.600 ng p24 48.000 ng p24
IDLVT2 9.160 ng p24

Tabela 2: Doses de vetor otimizado para transdução de células HeLa e queratinócitos primários humanos.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aqui, descrevemos uma metodologia amplamente acessível para integrar estàvel um GOI no genoma das células alvo por Bela adormecida-mediada por transposição. Embora o sistema SB foi desenvolvido para fornecer um método nonviral para edição de genoma, entrega eficiente da maquinaria integração (transposase e T2 transposon) é obrigatória. Portanto, para usar o sistema SB dificilmente transfectable as células primárias, uma viral entrega de componentes de SB foi perseguida nos últimos anos10,12,15. No entanto, nenhum dos vetores virais empregados até agora abordou a questão da expressão constitutiva de transposase que pode resultar em risco de rehopping incontrolável do transposon.

Para transcricionalmente regular expressão transposase, aproveitamos uma modificada Tet-ON sistema16. O promotor TK mínimo fundido ao elemento de TetO, com ligação para a rtTA2s-modulador M2 na presença de dox, conferido a um ajuste fino de transposase ativação sobre o fundo (do estado, na ausência de dox). O desempenho regulatório depende os IDLVs apropriados (IDLVTKSB e IDLVrtTA2s-M2) combinação de dose de vetor e em tipos de células (por exemplo, as células HeLa e humanos queratinócitos primários). Independentemente de células-alvo, a dose de vetor deve garantir o alto nível de transdução das células alvo, sem afetar a viabilidade celular, assim, uma combinação em dose escalada-experiência em células HeLa (ou outras linhas de células) para definir as doses ideais, por RT-PCR semi-quantitativa, sugere-se fortemente.

Transposição do governo da Índia foi avaliada em células primárias. Humanos queratinócitos primários semeados na camada de alimentador 3T3-J2 letalmente irradiados foram transformados com 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 e IDLVT2) nas doses definidas experimentalmente. Uma ativação de clara dox-dependente do transposase foi demonstrada por qRT-PCR. Além disso, a integração estável do governo da Índia foi demonstrada por cytofluorimetric análise da expressão de GFP em células transfectadas na presença ou ausência de dox, indicando a possibilidade de usar a plataforma IDLV ao veículo o SB transcriptionally regulado componentes para as células primárias e a integração bem sucedida de um indiano no genoma das células alvo.

Os passos críticos no protocolo são IDLV vector produção e transdução de células alvo na eficiência otimizada e combinação de dose de vetor. Eficiência baixa transfecção de células HEK293T pode resultar em rendimento baixo do vetor. A definição de doses de IDLVTKSB e IDLVrtTA2s-M2 é necessária para evitar um desequilíbrio de componentes de Tet-ON que pode resultar em alta leakiness na ausência do modulador ou em dobra baixa indução do promotor TetOTK tratamento de dox. Estes passos críticos podem ser superados por pequenas modificações. Por exemplo, o protocolo do transfection poderia ser padronizado usando reagentes de transfecção comercial. O protocolo de transdução deve ser adaptado de acordo com o tipo de célula de interesse, especialmente considerando-se spinoculation aumenta a eficiência de transdução sem afetar a viabilidade celular. Vetores e polybrene poderiam ser adicionados ao meio de cultura das células alvo e substituído com meio fresco após incubação de 6 h ou durante a noite. É também interessante notar que a porcentagem de GFP+ células 5 dias depois de transdução pode ser afectada pela integração fundo de IDLVs.

Uma menor limitação desse método é que os vetores IDLV são produzidos transitoriamente por transfecção de células HEK293T. Dependendo do vetor de doses a ser usado, repetido vector produções são necessárias. Uma segunda limitação está relacionada ao comprimento do governo do Índia, como a capacidade de carga do vetor IDLV é aproximadamente 8 kb.

Em conclusão, este método aqui permite a integração de um GI através de componentes de SB transcriptionally regulados empacotados em vetores IDLV, que, entre os métodos existentes para entregar o sistema SB, mostram uma ampla gama de tropismo e transdução de alta eficiência. Além disso, o sistema modificado de Tet-ON permite que um regulamento transcriptional da expressão SB100X, uma questão relevante no risco de re-hopping transposon ou em vários eventos de transposição serial se eles são necessários. Aplicações possíveis deste método incluem genoma engenharia de linhas de celulares (por exemplo, as células HeLa, células HEK293) estabelecer células de embalagem estável para vetores virais e integração de genes terapêuticos clínicas relevantes as células primárias.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Agradecemos a Prof Zappavigna, Universidade de Modena e Reggio Emilia, Módena, Itália por fornecer-nos com o pCCL-PGKrtTA2S-plasmídeo M2. Reconhecemos também o Prof Z. Ivics (Instituto de Ehlrich de Paul, Langen, Alemanha) e Prof Z. Izvak (Max Delbruck centro de Medicina Molecular, Berlim, Alemanha) para plasmídeos pCMVSB100X e pT2/BH. Este trabalho foi apoiado por DEBRA internacional e o Ministério italiano da Universidade e da investigação.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics