Un metodo efficiente In Vitro trasposizione da un sistema di bellezza dormire trascrizionalmente regolata confezionato in un vettore lentivirale difettoso di integrazione

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Questo protocollo descrive un metodo per realizzare l'integrazione stabile di un gene di interesse nel genoma umano di sistema Sleeping Beauty trascrizionalmente regolato. Preparazione dell'integrazione dei vettori lentivirali difettosi, la trasduzione in vitro di cellule umane e l'analisi molecolare sulle cellule trasdotte sono segnalati.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il trasposone Sleeping Beauty (SB) è un sistema di integrazione non virali con provata efficacia per il trasferimento genico e genomica funzionale. Per ottimizzare il macchinario del trasposone SB, un transposase iperattivo trascrizionalmente regolata (SB100X) e basati su T2 trasposone sono impiegati. In genere, la transposase ed i trasposoni sono forniti transitoriamente mediante trasfezione di plasmide e SB100X espressione è guidato da un promotore costitutivo. Qui, descriviamo un metodo efficiente per fornire i componenti di SB a cellule umane che sono resistenti a diversi metodi di transfezione fisiche e chimiche, per controllare l'espressione di SB100X e integrare stabilmente un gene di interesse (GOI) attraverso un SB "taglia e incolla" meccanismo. L'espressione della transposase iperattivo è strettamente controllato dal sistema Tet-ON, ampiamente utilizzato per controllare l'espressione genica dal 1992. Il gene di interesse è affiancato da ripetizioni invertiti (IR) del trasposone T2. Entrambi i componenti SB sono confezionati in integrazione difettosi vettori lentivirali transitoriamente prodotta nelle cellule HEK293T. Le cellule umane, sia linee cellulari o cellule primarie da tessuti umani, sono in vitro transitoriamente trasformata con i vettori virali. Con l'aggiunta di doxiciclina (dox, tetraciclina analogica) nel terreno di coltura, una messa a punto di transposase espressione viene misurata e si traduce in un'integrazione di lunga durata del gene di interesse nel genoma delle cellule trattate. Questo metodo è efficace e applicabile alla linea cellulare (per esempio, celle HeLa) e celle primarie (ad es., keratinocytes umani primari) e rappresenta quindi uno strumento prezioso per ingegneria genetica e trasferimento di geni terapeutici.

Introduction

La transposase SB100X iperattivo accoppiato per il trasposone basati su T2 è già stato utilizzato nel gene preclinici terapia applicazioni1,2,3, genoma modifiche4,5, e cellule staminali pluripotenti indotte (iPSC) riprogrammazione6,7. In genere, i componenti di SB transitoriamente sono forniti dalla transfezione del plasmide e un forte promotore costitutivo unità l'espressione della transposase. Tuttavia, nonostante i miglioramento nuovi metodi di transfezione, consegna del sistema bi-componente rimane una sfida per molte applicazioni. Così, lo sviluppo di un nuovo protocollo di recapito ha interesse aumentante. Oltre a metodi di transfezione per plasmide8 e mRNA9, consegna virale basato su adenoviral10,11, adeno-associato virale (AAV)12, Baculovirus13, gammaretroviral14 e vettori lentivirali15 è stato proposto in passato. In particolare, il sistema di scelta deve garantire una consegna transitoria dei componenti SB senza integrazione del vettore virale. Tuttavia, l'espressione costitutiva di transposase solleva preoccupazioni di sicurezza a causa del rischio di rehopping incontrollabile del trasposone.

Pertanto, la regolazione trascrizionale di SB100X da un raffinato sistema di Tet-ON è la prima sfida. Un promotore di Tet-sensible a reagire modificato, ottenuto sostituendo il promotore originale sviluppato minimale del citomegalovirus (CMV) con il promotore minimo (-81) del gene timidina chinasi (TK) dell'Herpes Simplex Virus-1 (HSV-1)16, viene duplicato a Monte della SB100X cDNA (pTetOTKSB100X). Il mutato inverso-tetraciclina-transactivator rtTA2s-M217 è espresso sotto il controllo del promotore costitutivo forte (fosfoglicerato promotore, PGK) clonato in un plasmide differente (pCCL-PGKrtTA2S-M2). Quando aggiunto al terreno di coltura, dox associa il rtTA2s-modulatore M2 e attacchi il promotore di Tet complesso o, con conseguente induzione strettamente regolato di SB100X espressione18.

La seconda grande sfida deriva dalla inefficiente transfezione di cellule primarie umane da diversi metodi fisici e chimici. Per distribuire in modo efficiente transposase in cellule umane resistenti di transfezione, il SB100X e il rtTA2s-cassette espressione M2 sono confezionati in due integrazione vettori lentivirali difettoso (IDLVs)19: IDLVTKSB e IDLVrtTA2s- M2. Vettori virali transitoriamente sono prodotte come vettori di generazione terzi HEK293T cellule20 e pseudotipizzato con la glicoproteina G del Virus della stomatite vescicolare (VSV-G), che conferisce un ampio spettro di infezione. Particelle di vettore sono concentrate mediante ultracentrifugazione e titolate di Gag di HIV-1 p24 immunocapture. Per trasdurre linee cellulari e cellule primarie, vettore particelle complessate con polybrene e vengono incubate con cellule bersaglio in presenza o assenza di dox. Droga-dipendente l'attivazione dell'espressione di SB100X in cellule trasdotte è misurata dal quantitativo di RT-PCR (qRT-PCR)18.

Una volta è dimostrato Tet-regolata SB100X espressione, recepimento del GOI (ad es., proteina fluorescente verde, GFP) nel genoma della cellula bersaglio segue gli eventi molecolari chiaramente schematizzati di Bak e Mikkelsen21. Un terzo IDLV di vettore che trasportano una cassetta di espressione per il GOI clonato tra l'IRs T2-trasposoni (IDLVT2) deve essere costruito e confezionato come accennato in precedenza. Infine, i tre vettori IDLV possono essere utilizzati in modo efficiente trasdurre cellule umane (ad es., keratinocytes primari) in vitro e integrare il GOI in presenza di doxiciclina18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. plasmidi impiegati

Nota: Plasmide pCCL-PGKrtTA2S-M2 è stato gentilmente fornito dalla Prof. ssa Zappavigna (Università di Modena e Reggio Emilia, Modena, Italia). Il plasmide pCMVSB100X portando la sequenza codificante di transposase iperattivo e pT2/BH trasposone plasmide sono state gentilmente concesse dal Prof Z. Ivics (Paul Ehrlich Institute, Langen, Germania) e Prof. ssa Z. Izvak (centro di Max Delbrück per la medicina molecolare, Berlino, Germania).

  1. Per tutta la clonazione in Escherichia Coli (Escherichia coli), seguire la strategia di clonazione della procedura scelta e degli enzimi di limitazione o amplificazione di PCR del frammento da clonare.
    Nota: La tabella 1 riassume tutti i plasmidi impiegati in questo protocollo. Una descrizione e riferimenti per ogni plasmide sono forniti.

2. produzione di vettore virale

Nota: Tutti i vettori virali sono prodotte in una cappa biohazard a livello di contenimento di biosicurezza BSL2 secondo regole istituzionali e regolamentari.

  1. Le cellule aderenti HEK293T cultura in Medium di Eagle per volta di Dulbecco completati con 10% di siero di HyClone, 100 U/mL penicillina-streptomicina e glutamina 2mm.
  2. Giorno 0: Preparare cinque piastre/virale preparazione 15cm e seme 5.5x106 cellule in 30 mL di terreno.
  3. Giorno 1: transfezione
    1. Prima di iniziare la transfezione, preparare 100 mL di 2 x HEPES tampone salino (HBS):
      NaCl (5 M) 5,6 mL
      HEPES (1 M) 10,0 mL
      Na2HPO4 (0,5 M) 0,3 mL
      Sterile 84,1 mL di acqua
      Regolare il pH 7.1 con 37% HCl.
      Nota: 2 x HBS può essere conservata a 4 ° C. Un pH esatto è estremamente importante per la transfezione efficiente. La gamma di pH ottimale è 7.10 a 7.12.
    2. Rimuovere il mezzo e aggiungere 22,5 mL/piastra di fresco medio 4 h prima di transfezione.
    3. Transfect HEK293T cellule con il plasmide di trasferimento, il plasmide di imballaggio pMD.Lg/pRRE.D64VInt, il plasmide che codifica busta di pMD2.G e l'OSPRO-Rev (tabella 1) secondo la seguente quantità/targhetta:
      trasferimento del plasmide 25,00 µ g
      µ g pMD.Lg/pRRE.D64VInt 16,25
      µ g pMD2.G 8.75
      OSPRO-Rev 6.25 µ g
      Nota: Il plasmide DNAs sono preparati secondo il protocollo di CsCl descritto da Maniatis22 o utilizzando un kit di purificazione del plasmide privo di endotossina.
      1. Risospendere 56,25 µ g di DNA (mix di 4 plasmidi) in 1,125 mL di acqua sterile e aggiungere 125 µ l di 2,5 M CaCl2 (soluzione A).
      2. Aggiungere mL 1,250 di 2 x HBS in una provetta conica sterile 15 mL (soluzione B).
      3. Aggiungere la soluzione A (1,250 mL) a B (1,250 mL) goccia a goccia mentre bolle con una pipetta di 1 o 2 mL (soluzione di transfezione, volume totale 2.500 mL).
      4. Incubare per 20 minuti a temperatura ambiente (TA).
      5. Utilizzando una micropipetta P1000, distribuire tutta la soluzione di transfezione (2.500 mL) per il monostrato cellulare goccia a goccia.
    4. Incubare per una notte in un'incubatrice di coltura cellulare a 37 ° C, 5% CO2.
  4. Giorno 2: Rimuovere il mezzo e aggiungere 15 mL di terreno nuovo (Vedi punto 2.1).
  5. Giorno 3: Raccogliere e concentrare il supernatante contenente delle particelle lentivirale.
    1. Raccogliere il surnatante (~ 70 mL) da tutti i (n = 5) placche delle celle transfected, filtrare attraverso un 0,45 µm PESS filtrare e riempire i 2 tubi di polyallomer (1-inch x 3,5 pollici) / virale preparazione.
    2. Concentrare le particelle vettoriale mediante ultracentrifugazione a 106.000 x g per 2,5 h, a 15 ° C con freno.
    3. Immediatamente dopo l'arresto l'ultracentrifugazione (per evitare la risospensione del pellet nel tubo), delicatamente versare il surnatante in un contenitore contenente candeggina al 10% e sospendere i 2 pellet appena visibili in 100 µ l di PBS 1X (+ 1% BSA). Questo è normale in quanto il pellet è chiaro e molto piccola. Utilizzare il vettore concentrato preparato al momento, o aliquota e conservare preparati virali a-80 ° C.
      Attenzione: Il surnatante contiene particelle lentivirali che devono essere candeggiate accuratamente prima di gettare i rifiuti a rischio biologico.
  6. Per titolo la preparazione di vettori virali, utilizzare un kit di immunocapture di Gag di HIV-1 p24 secondo il protocollo del produttore.
    Nota: Per standardizzare la produzione di vettori virali, reagenti a base di liposomi potrebbero essere impiegati. Tuttavia, il titolo di vettore virale è altamente dipendente sull'efficienza di trasfezione e purezza del plasmide del DNA.

3. trasduzione di linee cellulari umane (per esempio, celle HeLa)

Nota: Le cellule HeLa sono coltivate in medium dell'Aquila di Dulbecco modificato supplementato con 10% di siero fetale di vitello, 100 U/mL penicillina-streptomicina e 2 mM glutammina. La tabella 1 riassume tutti i vettori impiegati in questo protocollo. Viene fornita una descrizione per ogni vettore. Trasduzione delle cellule HeLa consente la verifica della regolazione trascrizionale della SB transposase alla migliore combinazione di dose dei due vettori IDLV. Variazione di IDLV dosi potrebbe essere correlato a vector titolazione della particella e tipo di cella di destinazione.

  1. Giorno 0: 2 x 105 celle in 3 mL di terreno per ogni pozzetto di una piastra a 6 pozzetti del seme. Preparare 4 pozzi.
  2. Giorno 1: Trasduzione delle cellule HeLa.
    1. Per ogni condizione, diluire vettori lentivirali ad un volume finale di 1 mL di terreno (Vedi nota sopra) in presenza di 10 μL di polybrene (concentrazione finale 8 μg/mL):
      Diluizione per bene #1: mock cellule trasdotte (controllo negativo).
      Diluizione per bene #2: vettore IDLVTKSB (2.600 ng di p24).
      Diluizione per pozzi #3, #4: vettore IDLVTKSB (2.600 ng di p24) + IDLVrtTA2s-M2 vettoriale (9.600 ng di p24).
    2. Rimuovere il mezzo da ogni pozzetto dove le cellule HeLa sono state placcate al giorno 0 e aggiungere diluizioni vettore lentivirale corrispondente bene.
    3. Spinoculate la piastra 6 pozzetti a 754 x g per 45 min a 20-25 ° C e quindi trasferimento la piastra a 6 pozzetti in un'incubatrice di coltura cellulare a 37 ° C e 5% CO2.
    4. Dopo 6 h, sostituire i vettori contenenti medi con medium fresco in tutti i pozzetti e aggiungere doxiciclina a 1 μm a ben #4. Mettere la piastra in un'incubatrice di coltura cellulare a 37 ° C per 48 h.
  3. Giorno 3: Preparazione dei pellet cellulare per estrazione del RNA.
    1. Prima di staccare le cellule, preparare una soluzione di lavoro di tripsina (1x):
      2,5% tripsina (10x) 5,0 mL
      500 mM EDTA (concentrazione finale = 5 mM) 0,5 mL
      1 x mL di PBS 44.5
    2. Soluzione di lavoro di tripsina calda a 37 ° C prima dell'uso. Conservare la soluzione di lavoro di tripsina a 4 ° C.
    3. Rimuovere il mezzo e lavare le cellule con PBS 1X. Aggiungere 0,5 mL di soluzione di lavoro di tripsina pre-riscaldato 37 ° C in ogni pozzetto e incubare a 37 ° C per 7 min (in un'incubatrice di coltura cellulare).
    4. Dopo l'incubazione, aggiungere 0,5 mL di siero contenente medio ad ogni pozzetto per inattivare la tripsina e raccogliere le cellule in una provetta da centrifuga. Risciacquare bene una volta con 3 mL di PBS 1X e centrifugare la sospensione cellulare per 5 min a 240 x g.
    5. Lavare le cellule con 5 mL di 1X PBS, centrifugare per 5 min 240 x g ed eliminare il surnatante. Utilizzare pellet cellulare appena raccolti o conservare a-80 ° C. Estrarre RNA totale da pellet per eseguire RT-PCR semiquantitativa (Vedi punto 6).

4. trasduzione di cellule primarie umane (ad es., cheratinociti)

Nota: Keratinocytes umani primari sono seminate su irradiati letalmente 3T3-J2 celle (strato dell'alimentatore)23, un regalo gentile da Yan Barrandon (EPFL, Losanna, Svizzera).

  1. Crescere le cellule 3T3-J2 di Swiss mouse in per volta Eagle supplementato di Dulbecco con 10% siero bovino di donatore, 50 U/mL penicillina-streptomicina e 4 mM glutamina (3T3 medio).
  2. Crescere cheratinociti piastrate su cellule 3T3-J2 letalmente irradiato in cFAD medium, Medium di Eagle per volta di un Dulbecco e miscela di media F12 di Ham (3:1) contenente siero bovino fetale (10%), penicillina-streptomicina (1%), glutammina (2%), insulina (5 µ g/mL), adenina ( 0.18 mM), idrocortisone (0,4 µ g/mL), la tossina del colera (0.1 nM) e la triiodotironina (2 nM).
  3. Giorno 0: Seme 3 x 105 irradiati letalmente cellule 3T3-J2, precedentemente diluite in mezzo ad una concentrazione finale di 1 X 105 cellule/mL, in ciascun pozzetto della piastra a 6 pozzetti di 3T3. Preparare 9 pozzi.
  4. Giorno 1: Trasduzione dei keratinocytes primari
    Nota: Trasduzione dei cheratinociti permette la quantificazione della regolazione trascrizionale della SB transposase nella migliore combinazione di dose dei due vettori IDLV (mediante qRT-PCR) e di verificare l'integrazione del GOI (GFP) nelle cellule bersaglio (mediante citofluorimetria analisi).
    1. Prima di staccare le cellule, preparare la soluzione di lavoro di tripsina:
      0,5% tripsina-EDTA (10x) 5,0 mL
      500mM EDTA (concentrazione finale = 5 mM) 0,5 mL
      1 x mL di PBS 44.5
    2. Soluzione di lavoro di tripsina calda a 37 ° C prima dell'uso. Conservare la soluzione di lavoro di tripsina a 4 ° C.
    3. Per staccare subconfluent cheratinociti in cultura, rimuovere il mezzo, lavare le cellule con PBS 1X e aggiungere 1 mL di soluzione di lavoro pre-riscaldato tripsina in ciascun pozzetto. Incubare a 37 ° C per 15 min nell'incubatrice di coltura cellulare.
    4. Dopo l'incubazione, risospendere le cellule di un pozzo accuratamente e trasferire la sospensione cellulare in una provetta da centrifuga contenente 2 mL di siero contenente medio (se molte cellule sono ancora collegate, incubare per un ulteriore min a 37 ° C). Sciacquare bene una volta con 3 mL di 1X PBS o mezzo fresco e aggiungere la soluzione di risciacquo la provetta da centrifuga con la sospensione cellulare.
    5. Centrifugare per 5 min a 580 x g e scartare il surnatante.
    6. Lavare le cellule con 5 mL di 1X PBS, centrifugare per 5 min 580 x g e scartare il surnatante.
    7. In una provetta di polipropilene 15 mL, diluire 1.6x105 cheratinociti in 1 mL di terreno cFAD, una diluizione per ogni condizione.
    8. Diluire il vettori lentivirali in 1 mL di terreno cFAD in presenza di 20 μL di polybrene (concentrazione finale di 8 µ g/mL a un volume finale di 2 mL):
      Diluizioni per pozzi #1, #2, #3: mock cellule trasdotte (controllo negativo senza vettori).
      Diluizioni per pozzi #4, #5: vettore IDLVTKSB (13.000 ng di p24) + IDLVrtTA2s-M2 vettoriale (48.000 ng di p24).
      Diluizioni per pozzi #6, #7, #8, #9: vettore IDLVTKSB (13.000 ng di p24) + IDLVrtTA2s-M2 vettoriale (48.000 ng di p24) + IDLVT2 vettore (9.160 ng di p24).
    9. Trasducono cellule in sospensione con l'aggiunta di ogni diluizione di vettore lentivirale (1 mL) per la sospensione del keratinocyte corrispondente (1.6x105 cheratinociti in 1 mL).
    10. Rimuovere il mezzo da cellule 3T3-J2 irradiati letalmente seminate al giorno 0 e piastra trasformata cheratinociti (1.6x105 cheratinociti in 2 mL) su di loro. Dopo trasducendo un pozzo procedere con quella successiva.
    11. Incubare a 25 ° C per 30 minuti e quindi trasferire le cellule a 37 ° C nell'incubatrice di coltura cellulare per 6 h.
      Nota: Non non spinoculate keratinocytes primari, come vitalità e proliferazione ne risentiranno fortemente.
    12. Dopo 6 h, aggiungere 1 mL di medium cFAD in ciascun pozzetto. Aggiungere 1 doxiciclina μM (concentrazione finale) a wells #5, #8 e #9. Restituire le cellule a 37 ° C.
  5. Giorno 2: Sostituire cFAD medio con 3 mL di terreno KC con 10 ng/mL EGF.
  6. Giorno 3: Tripsinizzano e lavare le cellule da pozzi #1, #4 e #5 come descritto prima (Vedi 4.4.1 a 4.4.6). Congelare palline delle cellule a-80 ° C per estrarre RNA totale per analisi qRT-PCR (vedi step 7).
  7. Tripsinizzano cellule da ben #2, #6 e #8 come descritto ai punti 4.4.1-4.4.5 ed eseguire analisi citofluorimetrica per espressione di GFP (vedi passo 5).
  8. Mantenere la cultura da pozzi #3, #7 e #9 per almeno 3-4 accoppiamenti, sufficiente a diluire non-integrato IDLVT2 vettoriale (5 giorni per keratinocytes umani primari, placcato su strato dell'alimentatore).
  9. Giorno 6: Circa 5 giorni post trasduzione, tripsinizzano cellule (Vedi punti 4.4.1-4.4.5) da pozzi #3, #7 e #9 per eseguire analisi citofluorimetrica per espressione di GFP (vedi passo 5).
    Nota: L'efficienza di temporizzazione e trasduzione di esperimento sono fortemente influenzati dal tipo di cellula primaria e dalla variabilità dei campioni raccolti.

5. citofluorimetrica analisi su trasdotte keratinocytes primari

Nota: Un citometro a flusso configurato con un laser blu (488 nm), un laser rosso (633 nm) e filtri per rilevamento della fluorescenza GFP e APC è impiegato (Vedi Materiali tavolo).

  1. Per distinguere i cheratinociti da strato dell'alimentatore 3T3-J2, etichetta trasformata keratinocytes distaccato al giorno 3 e 6 (vedere i passaggi 4.7 e 4,9) con mouse monoclonale APC-anticorpo coniugato anti-alimentatore.
    1. Preparare 4 mL di buffer per ogni campione di colorazione:
      5% FBS 200 ΜL
      500 mM EDTA (concentrazione finale = 2,5 mM) 20 μL
      ΜL di PBS 1 x 3780
    2. Lavare le cellule indipendente con 1 mL di tampone di colorazione. Centrifugare per 5 min a 580 x g e scartare il surnatante.
    3. In un tubo per l'acquisizione di citometria a flusso, risospendere le 5 x 104 cellule in 100 μL di tampone di colorazione e aggiungere 2 µ l di anticorpo anti-alimentatore (01:50). Mescolare bene e incubare per 30 min in ghiaccio al buio.
    4. Dopo 30 min, lavare con 2 mL di tampone di colorazione. Centrifugare per 5 min a 580 x g e scartare il surnatante. Risospendere in 200 μL di tampone di colorazione.
    5. Acquisire segnali APC e GFP di analisi citofluorimetrica18. La frazione di cellule GFP+ della popolazione delle cellule APCindica keratinocytes trasdotte.
      Nota: Se si desidera correggere l'esempio macchiato prima di citometria a flusso con paraformaldeide al 2% in PBS 1 x e conservare a 4 ° C al buio fino alla esecuzione.
  2. Analizzare i dati di flusso cytometry tracciando il rapporto tra la percentuale di GFP+cellule presso l'endpoint (5 giorni) e la percentuale di GFP+cellule 2 giorni dopo la trasduzione, normalizzati a livello residuo di IDLVT2-trasdotte cellule.

6. semi-quantitativa di RT-PCR

Nota: Utilizzare un termociclatore PCR.

  1. Estratto totale RNA da trasdotte o controllare le cellule utilizzando un kit di purificazione di RNA, secondo il protocollo del produttore.
    Nota: il RNA totale possa essere conservato a-80 ° C.
  2. Sintetizzare cDNA in una reazione di 20 µ l usando 100 ng di RNA totale e un kit di trascrittasi inversa, secondo il protocollo del produttore.
    Nota: cDNA possa essere conservato a-20 ° C.
  3. Disegno di primer specifici per SB100X, rtTA2s-M2 e GAPDH (un gene housekeeping).
    Disegni suggeriti:
    SB forward primer: 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB reverse primer: 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 forward primer: 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 reverse primer: 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH forward primer: 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH reverse primer: 5'CCACCACCCTGTTGCTGTAG3'
  4. Eseguire PCR in un volume di reazione finale di 50 µ l. In particolare, assemblare in ciascuna provetta PCR la seguente reazione:
    cDNA (diluizione 1:5) (dal punto 6.2) 1.00 µ l
    Forward primer (stock 10 µM) 1.00 µ l
    Reverse primer (stock 10 µM) 1.00 µ l
    dNTP (stock 10 µM) 1.00 µ l
    Buffer (+ MgCl2) (10x stock) 5.00 µ l
    Taq polimerasi (stock 5 U / µ l) 0,25 µ l
    µ L di acqua sterile 40,75
  5. Utilizzare il seguente programma del termociclatore: 1 ciclo a 95 ° C per 5 minuti quindi procedere con 95 ° C per 30 s, 58 ° C per 30 s e 72 ° C per 30 s per 34 cicli per SB100X, 32 cicli per rtTA2s-M2 e 25 cicli per GAPDH.
  6. Preparare il gel di agarosio 1%. Sciogliere 1 g di agarosio in 100 mL di TBE 1 x (10 x stock diluito in acqua sterile), in un becher o boccetta. Si scioglie in un forno a microonde, agitando ogni minuto fino a quando l'agarosio è completamente sciolto. Raffreddare l'agarosio fuso fino a raggiungere circa 50 ° C e quindi aggiungere 5 µ l di bromuro di etidio (10 mg/mL di brodo). Versare agarosio fuso in un cassetto del gel assemblato con un pettine, per la colata di gel.
  7. Caricare i campioni (10 µ l) su gel di agarosio ed eseguire l'elettroforesi.
  8. Se si desidera acquisire gel foto ed eseguire analisi densitometrica sulle bande PCR.

7. quantitative RT-PCR (qRT-PCR)

Nota: È impiegato un sistema di rilevazione sequenza commerciale. 6-carboxyfluorescein (FAM) sonda per la gliceraldeide 3-fosfato deidrogenasi (GAPDH) e gli iniettori di PCR sono acquistati commercialmente.

  1. Per la retro-trascrizione, vedere il punto 6.2.
  2. Utilizzare software per disegnare primers e sonde specifiche per SB100X.
    Design suggeriti:
    SB.2 forward primer: 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 reverse primer: 5'-CCCCATGTGCAGTTGCAA-3'
    sonda FAM SB: 5'-CATAAGAAAGCCAGACTACGG-3'
  3. Eseguire Real-Time PCR in piastre da 96 pozzetti con un PCR Master Mix e mix di primer + sonda, in un volume di reazione finale di 25 µ l. In particolare, si consideri la seguente reazione per ciascun pozzetto:
    cDNA (01:10 diluizione in acqua sterile) 1.00 µ l
    2 x µ l di Master Mix 12.50
    Mix di primer + sonda 20 x 1.25 µ l
    µ L di acqua sterile 10.25
    Nota: Eseguire tutte le reazioni in triplice copia. Per evitare errori di pipettaggio, preparare una miscela per almeno n + 3 reazioni (senza cDNA). Aliquota usando una pipetta multicanale.
  4. Eseguire PCR in tempo reale utilizzando il seguente programma: 1 ciclo a 95 ° C per 10 min, poi 40 cicli di 95 ° C per 15 s e 60 ° C per 1 min e permanenza a 4 ° C.
  5. Analizzare i dati qRT-PCR normalizzando l'espressione relativa (valore RQ) di SB100X al livello di GAPDH dello stesso campione di cDNA mediante 2ΔΔCT quantificazione, utilizzando software di analisi dati tipici.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Utilizzando la procedura presentata qui, tre vettori IDLV che trasportano i componenti SB regolamentati (SB100X, rtTA2S-trasposone M2 e T2-GFP) erano confezionati e utilizzato per distribuire in modo efficiente e strettamente regolare il sistema di SB in cellule umane. Figura 1A Mostra un schema per in vitro trasduzione delle cellule HeLa, che è stata eseguita per valutare la regolazione trascrizionale di SB transposase con la migliore combinazione di dose dei due vettori IDLV (riportati nella tabella 2). La regolazione trascrizionale di SB100X è stata misurata mediante qRT-PCR (Figura 1B) e tracciata come un valore di quantità relativa (RQ) per quanto riguarda lo stato off (IDLVTKSB solo RQ = 1). In cellule HeLa trasdotte, è stata ottenuta un'attivazione 8 volte (+ dox) dell'espressione di SB100X sopra la priorità bassa (IDLVTKSB). In particolare, le cellule HeLa cotransduced in assenza di dox ha mostrato l'espressione transposase paragonabile agli Stati off, che indica uno stretto controllo del promotore di TetTK di rtTA2s-modulatore M2.

Figure 1
Figura 1: Trasduzione di HeLa cells per l'espressione di trascrizionalmente regolata SB transposase trasportati da vettori IDLV. (A) un regime per la trasduzione in vitro delle cellule HeLa con IDLVs per l'espressione di transposase. (B) analisi di qRT-PCR delle cellule HeLa trasformata con IDLVTKSB (2.600 ng di p24) nella presenza (+) o meno (-) di IDLVrtTA2S-M2 (9.600 ng di p24) e 1 µM doxiciclina (dox). La linea tratteggiata collega campioni che presentano valori significativamente diversi (* * * P < 0,005). L'esperimento è stato effettuato in triplice copia. Significa Sangiorgi è indicato come barre di errore. (Figura per volta da Cocchiarella, F. et al., 201618). Clicca qui per visualizzare una versione più grande di questa figura.

Ad esempio, la figura 2 Mostra la dose che vanno esperimento impostata per raggiungere l'ottima regolazione trascrizionale della transposase. Cellule HeLa sono state trasdotte con dosi crescenti (130, 260 e 2.600 ng di p24) di IDLVTKSB in combinazione con IDLVrtTA2s-M2 (960 e 9.600 ng di p24), in presenza o assenza di dox. Analisi di RT-PCR semi-quantitativa dimostra chiaramente che le dosi elevate di entrambi IDLVs erano tenute a fortemente inducono l'espressione di SB100X. Tipo di cella di destinazione diversi e variazioni nella titolazione vettore virale possono provocare espressione SB sup-ottimale, e si consiglia pertanto di eseguire esperimenti di impostazione di dosaggio.

Figure 2
Figura 2: IDLV dose setting esperimento in cellule HeLa di definire la dose ottimale combinazione dei due IDLVs. Analisi di RT-PCR semi-quantitativa su cellule HeLa co-trasformata con differenti dosi di vettore IDLVTKSB (130, 260 e 2.600 ng di p24) nell'assenza o nella presenza di IDLVrtTA2s-M2 vettoriale (960 e 9.600 ng di p24) e dox. La GAPDH è stato amplificato come un controllo standard. SB100X transposase ed rtTA2s-espressione M2 sono segnalati in tutte le condizioni testate; NC = controllo negativo. (Figura per volta da Cocchiarella, F. et al., 201618). Clicca qui per visualizzare una versione più grande di questa figura.

Sistema trascrizionale regolato SB potrebbe essere utilizzato anche in cellule primarie, particolarmente in quelle cellule resistenti ai diversi metodi di transfezione, come keratinocytes umani primari. La figura 3 Mostra uno schema per trasduzione del primario keratinocytes coltivati su letalmente irradiato 3T3-J2 strato dell'alimentatore, con vettori IDLV che trasportano i componenti SB regolamentati, in presenza o assenza di dox di indurre l'espressione di SB100X.

Figure 3
Figura 3: trasduzione in sospensione dei keratinocytes umani primari con IDLV vettori per l'espressione di SB transposase trascrizionalmente regolata e trasposoni. Uno schema per la trasduzione in vitro dei keratinocytes umani primari con IDLVs per esprimere trascrizionalmente regolata transposase SB e trasposoni, in presenza o assenza di 1 µM dox. Clicca qui per visualizzare una versione più grande di questa figura.

L'analisi di qRT-PCR in Figura 4A spettacoli che la migliore dose di combinazione di modulatore e transposase vettori, riportati nella tabella 2, ha provocato 15 volte l'attivazione dell'espressione di SB sopra lo stato off (-dox). L'esperimento di recepimento è stato effettuato nei keratinocytes trasformata con i vettori IDLV tre (IDLVTKSB, IDLVrtTA2s-M2 e IDLVT2) in presenza o assenza di dox. Espressione della GOI (GFP) beared da T2-trasposoni, nel vano di APC , è stata misurata dal flusso cytometer analisi 2 giorni post-traduzionali (dpt) e presso l'endopoint della cultura (5 giorni per keratinocytes umani primari). L'endpoint è stato raggiunto quando un trasposone T2-GFP è sceso a un livello a mala pena rilevabile (una media di 0,6%) a causa di divisione cellulare dipendente dalla diluizione. Figura 4B Mostra il rapporto tra la percentuale di GFP+ cellule nel vano APC all'endpoint e 2 giorni post trasduzione, normalizzato per il livello residuo del trasposone da solo. Questo indica la percentuale di cellule hosting almeno 1 copia del GOI espresso stabilmente integrato nel loro genoma, valutata al 12% per keratinocytes umani primari.

Figure 4
Figura 4: analisi dell'espressione di GFP e di transposase in trasdotte keratinocytes umani primari. (A) assay qRT-PCR sul primario keratinocytes trasformata con IDLVTKSB e IDLVrtTA2S-M2 in presenza o assenza di dox 1 µM. (B) co-trasduzione dei keratinocytes primari con trasposoni IDLVT2 e IDLVs per transposase espressione in presenza o assenza di dox. Sull'asse y, % GFP+ cellule 5dpt / GFP+ % celle 2 dpt * 100 (media ± SEM di due esperimenti). * * mostrano valori significativamente differenti (P < 0,05). (Figura per volta da Cocchiarella, F. et al., 201618). Clicca qui per visualizzare una versione più grande di questa figura.

Plasmide Descrizione Riferimenti
pCCL-TetOTKSB Trasferimento del plasmide usato per generare IDLVTKSB vettore. Questo plasmide è derivato da pTetOTKSB, dopo la clonazione TetOTKSB nel backbone lentivirali pCCL. 18, 20
pCCL-PGKrtTA2S-M2 Trasferimento del plasmide utilizzato per generare IDLVrtTA2s-M2 vettoriale. fornito dalla Prof. ssa V. Zappavigna
pCCL-T2GFP Trasferimento del plasmide usato per generare IDLVT2 vettore. Questo plasmide è derivato da pT2GFP, dopo la clonazione la GFP tra l'IRs T2-trasposoni nel backbone lentivirali pCCL. 18, 20
pMD.Lg/pRRE.D64VInt Imballaggio del plasmide per generare IDLV vettore. 19
pMD2.G Plasmide che codifica per busta VSV-G generare vettore lentivirale. 20
OSPRO-Rev Plasmide REV per generare vettore lentivirale. 20
Vector Descrizione
IDLVTKSB Vettore lentivirale difettoso di integrazione per l'espressione di SB100X sotto il controllo del promotore TK Tet-sensible a reagire.
IDLVrtTA2s-M2 Vettore lentivirale difettoso di integrazione per l'espressione del rtTA2s-modulatore M2 sotto il controllo del promotore PGK.
IDLVT2 Vettore lentivirale difettoso di integrazione per l'espressione del GOI clonato tra l'IRs T2-trasposoni.

Tabella 1: plasmidi e vettori impiegati in questo protocollo. Descrizioni e riferimenti sono forniti.

Vettori HeLa (2 x 105 cellule) Cheratinociti (1.6x105 cellule)
IDLVTKSB 2.600 ng p24 13.000 ng p24
IDLVrtTA2s-M2 9.600 ng p24 48.000 ng p24
IDLVT2 9.160 ng p24

Tabella 2: Dosi vettoriale ottimizzata per la trasduzione di cellule HeLa e keratinocytes umani primari.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Qui, descriviamo una metodologia ampiamente accessibile per integrare stabilmente un GOI nel genoma delle cellule bersaglio di Sleeping Beauty-mediata di recepimento. Anche se il sistema di SB è stato sviluppato per fornire un metodo nonviral per l'editing genomico, consegna efficiente dei macchinari integrazione (permettono e T2 trasposone) è obbligatoria. Quindi, per utilizzare il sistema di SB su quasi transfectable cellule primarie, una consegna virale dei componenti SB è stata perseguita in questi anni10,12,15. Tuttavia, nessuno dei vettori virali impiegati fino a ora affrontato la questione dell'espressione costitutiva di transposase che potrebbe comportare il rischio di rehopping incontrollabile del trasposone.

Per trascrizionalmente regolano l'espressione di transposase, abbiamo approfittato di un sistema di modificate Tet-ON16. Il promotore minimo TK fusa per l'elemento di TetO, legandosi al rtTA2s-modulatore M2 in presenza di dox, conferito una messa a punto di attivazione transposase sopra il fondo (stato off, in assenza di dox). La regolamentazione delle prestazioni dipendono il IDLVs appropriato (IDLVTKSB e IDLVrtTA2s-M2) combinazione a dose di vettore e sui tipi cellulari (ad es., cellule HeLa e keratinocytes umani primari). Indipendentemente dalle cellule bersaglio, la dose di vettore deve garantire il massimo livello di trasduzione delle cellule bersaglio senza colpire l'attuabilità delle cellule, così una combinazione a dose escalation esperimento in cellule HeLa (o altre linee cellulari) per definire le dosi ottimali, di RT-PCR semi-quantitativa, è fortemente consigliato.

Recepimento del governo indiano è stato valutato in cellule primarie. Keratinocytes umani primari, seminate su strato dell'alimentatore irradiati letalmente 3T3-J2 sono state trasdotte con 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 e IDLVT2) alle dosi sperimentalmente definite. Un'attivazione chiaro dox-dipendente della transposase è stata dimostrata mediante qRT-PCR. Inoltre, integrazione stabile del GOI è stata dimostrata mediante analisi citofluorimetrica dell'espressione di GFP in cellule trasformata in presenza o assenza di dox, che indica la possibilità di impiegare la piattaforma IDLV al veicolo la SB trascrizionalmente regolata componenti per le cellule primarie e il successo dell'integrazione di un GOI nel genoma delle cellule bersaglio.

I passaggi critici nel protocollo sono IDLV vettoriale produzione e trasduzione di cellule bersaglio all'efficienza ottimale e una combinazione a dose vettoriale. L'efficienza di trasfezione basso di HEK293T cellule potrebbero rendimento basso vettoriale. La definizione delle dosi di IDLVTKSB e IDLVrtTA2s-M2 è necessaria per evitare uno squilibrio dei componenti Tet-ON che possono provocare ad alta permeabilità in assenza del modulatore o in piega bassa induzione del promotore TetOTK previo trattamento di dox. Questi passaggi critici potrebbero essere affrontati da modifiche minori. Per esempio, il protocollo di transfezione potrebbe essere standardizzato utilizzando reagenti di transfezione commerciale. Il protocollo di trasduzione dovrebbe essere adattato in base al tipo di cella di interesse, in particolare considerando se spinoculation aumenta l'efficienza di trasduzione senza compromettere la vitalità cellulare. Vettori e polybrene potrebbe essere aggiunto al terreno di coltura delle cellule bersaglio e sostituiti con mezzo fresco dopo incubazione di 6 h o una notte. Vale anche la pena notare che la percentuale di GFP+ cellule 5 giorni dopo trasduzione potrebbe essere influenzata tramite l'integrazione di sfondo del IDLVs.

Una minore limitazione di questo metodo è che i vettori IDLV sono prodotte transitoriamente di transfezione delle cellule HEK293T. A seconda del vettore dosi da impiegare, ripetuto vettoriale produzioni sono necessari. Una seconda limitazione è correlata alla lunghezza del GOI, come la capacità di carico del vettore IDLV è di circa 8 kb.

In conclusione, questo metodo qui permette l'integrazione di un GOI attraverso trascrizionalmente regolate componenti SB confezionato in vettori IDLV, che, tra i metodi esistenti per fornire sistema SB, mostrano una vasta gamma di tropismo ed efficienza di trasduzione alta. Inoltre, il sistema modificato di Tet-ON permette una regolazione trascrizionale dell'espressione SB100X, una questione rilevante nel rischio di trasposone ri-hopping o più eventi di trasposizione seriale se sono necessari. Possibili applicazioni di questo metodo includono ingegneria di genoma di linee cellulari (ad es., cellule HeLa, cellule HEK293) per stabilire le cellule di imballaggio stabile per vettori virali e integrazione di geni terapeutici cliniche pertinenti cellule primarie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Si ringrazia la Prof. ssa Zappavigna, Università di Modena e Reggio Emilia, Modena, Italia per averci fornito il pCCL-PGKrtTA2S-plasmide M2. Riconosciamo anche Prof Z. Ivics (Istituto Ehlrich Paolo, Langen, Germania) e Prof. ssa Z. Izvak (Centro Max Delbrück per la medicina molecolare, Berlino, Germania) per pCMVSB100X e pT2/BH plasmidi. Questo lavoro è stato supportato da DEBRA internazionale e Ministero dell'Università e della ricerca.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics