Un método de transposición eficiente In Vitro por un sistema de belleza durmiente transcripcionalmente regulada en un Vector lentivirales defectuosa integración

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Este protocolo describe un método para lograr la integración estable del gen de interés en el genoma humano por el sistema transcripcionalmente regulado de La bella durmiente . Preparación de la integración de vectores lentivirales defectuosos, la transducción en vitro de las células humanas y el análisis molecular de células transduced se divulgan.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El transposón Durmiente (SB) es un sistema integrador no virales con eficacia demostrada para la transferencia génica y genómica funcional. Para optimizar la maquinaria de transposon de SB, se emplean una transposasa hiperactiva transcripcionalmente regulada (SB100X) y transposones basada en T2. Típicamente, la transposasa y transposon transitoriamente por la transfección del plásmido y SB100X expresión es conducida por un promotor constitutivo. Aquí, describimos un método eficiente para entregar los componentes de la SB a las células humanas que son resistentes a varios métodos de transfección física y química, para controlar la expresión de SB100X y estable integrar un gen de interés (GOI) a través de un "cortar y pegar" SB mecanismo. La expresión de la transposasa hiperactiva es estrechamente controlada por el sistema de Tet-ON, ampliamente utilizado para controlar la expresión génica desde 1992. El gen de interés es flanqueado por repeticiones invertidas (IR) de los transposones de T2. Ambos componentes SB vienen en vectores lentivirales defectuosos transitorio producidos en células HEK293T integración. Las células humanas, líneas celulares o células primarias del tejido humano, están en vitro transduced transitoriamente con vectores virales. Además de doxiciclina (dox, análogo de la tetraciclina) en el medio de cultivo, un ajuste fino de la transposasa expresión se mide y da lugar a una integración duradera del gen de interés en el genoma de las células tratadas. Este método es eficaz y aplicable a la línea celular (por ejemplo, las células HeLa) y células primarias (por ejemplo, keratinocytes humanos primarios) y así representa una valiosa herramienta para la ingeniería genética y transferencia de genes terapéuticos.

Introduction

La transposasa hiperactiva de SB100X juntada al transposon basada en T2 ya se ha utilizado en preclínica gene terapia aplicaciones1,2,3, genoma modificaciones4,5, y célula de vástago pluripotent inducidas (iPSC) reprogramación6,7. Típicamente, los componentes del SB son provistos transitoriamente por transfección del plásmido y un fuerte promotor constitutivo conduce la expresión de la transposasa. Sin embargo, a pesar de los nuevos métodos de mejora de la transfección, entrega del sistema de dos componentes sigue siendo un desafío para muchas aplicaciones. Así, el desarrollo de un nuevo protocolo de entrega tiene creciente interés. Además de métodos de transfección de plásmidos8 y mRNA9, entrega viral basado en adenoviral10,11, adeno-associated virus (AAV)12, Baculovirus13gammaretroviral14 y vectores lentivirales15 ha sido propuesto en el pasado. En particular, el sistema de elección debe garantizar una entrega transitoria de los componentes del SB sin integración del vector viral. Sin embargo, la expresión constitutiva de la transposasa plantea preocupaciones de seguridad debido al riesgo de rehopping incontrolable de los transposones.

Por lo tanto, la regulación transcripcional de SB100X por un refinado sistema de Tet-ON es el primer desafío. Se clona un promotor TTE responden modificado, obtenido mediante la sustitución del original promotor desarrollado mínimo citomegalovirus (CMV) con el promotor mínimo (-81) del gen Timidine quinasa (TK) del Virus del Herpes simple 1 (HSV-1)16, aguas arriba de la CDNA de SB100X (pTetOTKSB100X). La transformada inversa-tetraciclina-transactivator rtTA2s-M217 se expresa bajo el control del promotor constitutivo fuerte (fosfoglicerato promotor, PGK) clonado en un plásmido diferentes (pCCL-PGKrtTA2S-M2). Cuando se añade al medio de cultivo, dox une el rtTA2s-modulador M2 y anclar el promotor de Tet o complejo, dando como resultado una inducción bien regulada de SB100X expresión18.

El segundo gran reto surge de la ineficiente de la transfección de células primarias humanas por varios métodos físicos y químicos. Para administrar transposasa en células humanas resistentes a la transfección, la SB100X y la rtTA2s-cassettes de expresión M2 vienen en dos integración vectores lentivirales defectuoso (IDLVs)19: IDLVTKSB y IDLVrtTA2s- M2. Vectores virales se producen transitoriamente como tercer vectores de generación de células HEK293T20 y pseudotyped con la glicoproteína G del Virus de la estomatitis Vescicular (VSV-G), que le confiere un amplio espectro de la infección. Las partículas de vector son concentradas por ultracentrifugación y graduadas por Inmunocaptura p24 de HIV-1 Gag. Para transducir las líneas celulares y células primarias, las partículas de vector son complexed con polibreno y se incuban con las células Diana en la presencia o ausencia de dox. Activación dependiente de la droga de SB100X expresión en células transduced se mide por RT-PCR (qRT-PCR) cuantitativa18.

Una vez que se demuestra expresión regulada de Tet SB100X, transposición de lo GOI (p. ej., proteína verde fluorescente, GFP) en el genoma de la célula objetivo sigue los eventos moleculares claramente esquematizados por Bak y Mikkelsen21. Un tercer IDLV vector llevar un casete de expresión para el GOI clonado entre el IRs transposon T2 (IDLVT2) tiene que ser construido y empaquetado como se mencionó anteriormente. Por último, los tres vectores IDLV pueden utilizarse para transducir las células humanas (por ejemplo, queratinocitos primarios) en vitro e integrar el GOI en presencia de doxiciclina18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. los plásmidos empleados

Nota: Plásmido pCCL-PGKrtTA2S-M2 fue amablemente proporcionado por Prof. Zappavigna (Universidad de Modena y Reggio Emilia, Módena, Italia). El plásmido de pCMVSB100X llevando la secuencia de codificación de la transposasa hiperactiva y el plásmido de transposon pT2/BH fueron amablemente proporcionadas por Prof Z. Ivics (Instituto de Paul Ehrlich, Langen, Alemania) y Prof. Z. Izvak (Max Delbruck centro de Medicina Molecular, Berlín, Alemania).

  1. De todo clonado en Escherichia Coli (e. coli), siga la estrategia de clonación del proceso de elección y enzima de la restricción o amplificación por PCR del fragmento a ser clonados.
    Nota: La tabla 1 resume todos la plásmidos empleada en el presente Protocolo. Se ofrecen una descripción y las referencias de cada plásmido.

2. producción del vector viral

Nota: Todos los vectores virales se producen en una campana de biohazard en un nivel de contención de bioseguridad BSL2, según normas institucionales.

  1. Células HEK293T adherentes en cultivo en medio de Eagle modificado de Dulbecco suplementado con 10% de suero HyClone, 100 U/mL de penicilina-estreptomicina y glutamina 2 mM.
  2. Día 0: Preparar cinco preparación viral placas de 15 cm y semilla 5.5x106 células en 30 mL de medio.
  3. Día 1: transfección
    1. Antes de comenzar la transfección, preparar 100 mL de solución salina 2 x HEPES buffer (HBS):
      NaCl (5 M) 5,6 mL
      HEPES (1 M) 10,0 mL
      Na2HPO4 (0,5 M) 0,3 mL
      Estéril de agua mL 84,1
      Ajustar el pH a 7.1 con 37% HCl.
      Nota: 2 x HBS pueden almacenarse a 4 ° C. Un pH exacto es muy importante para la transfección eficiente. El rango de pH óptimo es de 7.10 a 7.12.
    2. Retirar el medio y añadir 22,5 mL/placa de fresco mediano 4 h antes de la transfección.
    3. Transfectar las células HEK293T con el plásmido de la transferencia, el plásmido de empaquetado de pMD.Lg/pRRE.D64VInt, el plásmido pMD2.G de codificación envolvente y pRSV-Rev (tabla 1) según la siguiente cantidad/placa:
      transferencia de μg de plásmido 25.00
      pMD.Lg/pRRE.D64VInt 16.25 μg
      pMD2.G 8.75 μg
      pRSV-Rev 6,25 μg
      Nota: El plásmido DNAs se preparan según el protocolo de CsCl descrito por Maniatis22 o mediante un kit de purificación del plásmido libre de endotoxinas.
      1. Suspender 56.25 μg de DNA (mezcla de 4 plásmidos) de 1,125 mL de agua estéril y añadir 125 μl de 2.5 M CaCl2 (solución A).
      2. Añadir a un tubo de centrífuga cónico de 15 mL estéril (solución B) 1,250 mL de 2 x HBS.
      3. Añadir solución un 1,250 mL a B (1,250 mL) gota a gota mientras burbujea con una pipeta de 1 ó 2 mL (solución de transfección, volumen total 2,500 mL).
      4. Incubar por 20 min a temperatura ambiente (RT).
      5. Usando una micropipeta P1000, distribuir todo de la solución de transfección (2,500 mL) a la monocapa celular gota a gota.
    4. Incubar durante una noche en una incubadora de cultivo celular a 37 ° C, 5% CO2.
  4. Día 2: Quite el medio y añadir 15 mL de medio fresco (vea el paso 2.1).
  5. Día 3: Recoger y concentrar el sobrenadante que contiene partículas lentivirales.
    1. Recoger sobrenadante (~ 70 mL) de todos (n = 5) placas de células transfected, filtrar a través de un 0.45 μm PESS filtrar y llenar 2 tubos de polyallomer (1 pulgadas x 3.5 pulgadas) / viral preparación.
    2. Concentrar las partículas de vector por ultracentrifugación a 106.000 g x 2,5 h, a 15 ° C con freno.
    3. Inmediatamente después de dejar la ultracentrifugación (para evitar la resuspensión del precipitado en el tubo), suavemente Vierta el sobrenadante en un recipiente que contiene 10% de lejía y suspender las pastillas apenas visibles 2 en 100 μl de PBS 1 x (+ 1% BSA). Esto es normal como el pellet es claro y muy pequeñas. Utilizar el vector concentrado recién preparado o alícuota y almacenar las preparaciones virales a-80 ° C.
      PRECAUCIÓN: El sobrenadante contiene partículas lentivirales que deben ser blanqueadas minuciosamente antes de deshacerse de los residuos de riesgo biológico.
  6. Para valorar la preparación de vectores virales, utilice un kit de Inmunocaptura p24 Gag de VIH-1 según protocolo del fabricante.
    Nota: Para estandarizar la producción de vectores virales, podrían emplearse reactivos basados en liposomas. Sin embargo, el título del vector viral es altamente dependiente en la eficiencia de transfección y pureza del ADN del plásmido.

3. transducción de líneas celulares humanas (por ejemplo, las células HeLa)

Nota: Las células HeLa son cultivadas en medio modificado Eagle de Dulbecco suplementado con 10% de suero fetal de ternera, 100 U/mL de penicilina-estreptomicina y 2 mM glutamina. La tabla 1 resume todos los vectores empleados en el presente Protocolo. Se proporciona una descripción para cada vector. Transducción de células HeLa permite la verificación de la regulación transcripcional de la transposasa de SB en la mejor combinación de dosis de los dos vectores IDLV. Variación de dosis IDLV puede estar relacionado con vector valoración de partícula y tipo de la célula blanco.

  1. Día 0: Semilla 2 x 105 células en 3 mL de medio para cada pocillo de una placa de 6 pozos. Preparar 4 pozos.
  2. Día 1: Transducción de células HeLa.
    1. Para cada condición, diluir vectores lentivirales para un volumen final de 1 mL medio (ver nota anterior) en presencia de 10 μL de polibreno (concentración final 8 μg/mL):
      Dilución para el pozo #1: burlarse de células transduced (control negativo).
      Dilución para el pozo #2: vector IDLVTKSB (2.600 ng de p24).
      Dilución para los pozos #3, #4: vector IDLVTKSB (2.600 ng de p24) + IDLVrtTA2s-vector M2 (9.600 ng de p24).
    2. Retire el medio de cada pozo donde las células HeLa fueron plateadas en el día 0 y agregar diluciones de vectores lentivirales para el correspondiente bien.
    3. Spinoculate la placa de 6 pozos en 754 x g durante 45 minutos a 20-25 ° C y entonces traslado la placa de 6 pozos a una incubadora de cultivo celular en 37 ° C y 5% CO2.
    4. Después de 6 h, sustituir los vectores que contienen medio por medio fresco en todos los pozos y añadir doxiciclina a 1 μM en el pozo #4. Poner la placa en una célula cultura la incubadora a 37 ° C durante 48 h.
  3. Día 3: Preparación de pellets celulares para extracción de RNA.
    1. Antes de desmontar las células, prepare una solución de trabajo de tripsina (1 x):
      2.5% tripsina (10 x) 5,0 mL
      500 mM EDTA (concentración final = 5 mM) 0,5 mL
      1 x PBS 44,5 mL
    2. Solución de trabajo de tripsina caliente a 37 ° C antes de usar. Solución de trabajo de tripsina a 4 ° C.
    3. Medio de quitar y lavar las células con PBS 1 x. Agregar 0,5 mL de solución de trabajo de tripsina con 37 ° C en cada pocillo e incubar a 37 ° C por 7 min (en una incubadora de cultivo celular).
    4. Después de la incubación, Añadir 0,5 mL de suero que contienen media a cada pocillo para inactivar células recogemos en un tubo de centrífuga y tripsina. Enjuagar bien una vez con 3 mL de PBS 1 x y Centrifugue la suspensión celular por 5 min a 240 x g.
    5. Lavar las células con 5 mL de 1 x PBS, centrifugar durante 5 min a 240 x g y descartar el sobrenadante. Use perdigones recién recogidos de la célula o almacenar a-80 ° C. Extraer ARN de pellets para realizar RT-PCR semicuantitativa (ver paso 6).

4. transducción de células primarias humanas (por ejemplo, queratinocitos)

Nota: Keratinocytes humanos primarios se siembran sobre 3T3-J2 irradiados letalmente células (capa de alimentador)23, un amable regalo de Yan Barrandon (EPFL, Lausana, Suiza).

  1. Crecer células de ratón Swiss 3T3-J2 en modificado Eagle suplementado de Dulbecco con 10% suero bovino de donantes, 50 U/mL de penicilina-estreptomicina y glutamina 4 mM (3T3 medio).
  2. Crecimiento de queratinocitos plateado en células 3T3-J2 irradiados letalmente cFAD, medio de Eagle modificado de Dulbecco y mezcla de medios Ham F12 (3:1) que contenga suero fetal bovino (10%), penicilina-estreptomicina (1%), glutamina (2%), insulina (5 μg/mL), adenina ( de 0.18 m m), hidrocortisona (0,4 μg/mL), la toxina del cólera (0.1 nanómetro) y la triyodotironina (2 nM).
  3. Día 0: Semilla 3 x 105 letalmente irradiadas las células 3T3-J2, previamente diluidas en medio 3T3 a una concentración final de 1 X 105 células/mL, en cada pocillo de la placa de 6 pozos. Preparar 9 pozos.
  4. Día 1: Transducción de los queratinocitos primarios
    Nota: Transducción de keratinocytes permite cuantificación de la regulación transcripcional de la transposasa de SB en la mejor combinación de dosis de los dos vectores IDLV (qRT-PCR) y verificar la integración de GOI (GFP) en las células diana (cytofluorimetric Análisis).
    1. Antes de desmontar las células, preparar la solución de trabajo de la tripsina:
      0.5% tripsina-EDTA (10 x) 5,0 mL
      500mM EDTA (concentración final = 5 mM) 0,5 mL
      1 x PBS 44,5 mL
    2. Solución de trabajo de tripsina caliente a 37 ° C antes de usar. Solución de trabajo de tripsina a 4 ° C.
    3. Para desasociar subconfluente queratinocitos en cultivo, quiten medio las células con PBS 1 x y añadir 1 mL de solución de trabajo de tripsina precalentado a cada pocillo. Incubar a 37 ° C durante 15 min en la incubadora de la cultura de célula.
    4. Después de la incubación, resuspender las células de un pozo bien y transferir la suspensión de células a un tubo de centrífuga que contiene 2 mL de suero que contiene medio (si muchas células estén fijadas, incubar durante un minuto adicional a 37 ° C). Enjuagar bien una vez con 3 mL de 1 x PBS o medio fresco y añadir la solución de enjuague para el tubo de centrífuga con la suspensión de células.
    5. Centrifugar durante 5 min a 580 x g y descartar el sobrenadante.
    6. Lavar las células con 5 mL de 1 x PBS, centrifugar durante 5 min a 580 x g y descartar el sobrenadante.
    7. En un tubo de polipropileno de 15 mL, diluir 1.6x105 keratinocytes en 1 mL de medio de cFAD, una dilución para cada condición.
    8. Diluir vectores lentivirales en 1 mL de medio de cFAD en presencia de 20 μL de polibreno (concentración final de 8 μg/mL en un volumen final de 2 mL):
      Diluciones para los pozos #1, #2, #3: burlarse de células transduced (control negativo sin vectores).
      Diluciones para los pozos #4, #5: vectores IDLVTKSB (13.000 ng de p24) + IDLVrtTA2s-vector M2 (48.000 ng de p24).
      Diluciones para los pozos #6, #7, #8, #9: vector IDLVTKSB (13.000 ng de p24) + IDLVrtTA2s-vector M2 (48.000 ng de p24) + vector IDLVT2 (9.160 ng de p24).
    9. Transducir las células en suspensión mediante la adición de cada dilución de vectores lentivirales (1 mL) a la correspondiente suspensión de queratinocitos (1.6x105 keratinocytes en 1 mL).
    10. Retire el medio de las células 3T3-J2 irradiados letalmente sembradas en el día 0 y placa transduced queratinocitos (1.6x105 keratinocytes en 2 mL) en ellos. Después transducing bien proceder con la siguiente.
    11. Incubar a 25 ° C por 30 min y luego se transfieren las células a 37 ° C en la incubadora de cultivo celular de 6 h.
      Nota: No spinoculate queratinocitos primarios, como la viabilidad y proliferación serán fuertemente afectados.
    12. Después de 6 h, añadir 1 mL de medio de cFAD a cada pocillo. Añadir doxiciclina μM 1 (concentración final) en los pozos #5, #8 y #9. Volver a las células a 37 ° C.
  5. Día 2: Reemplazar cFAD mediano con 3 mL de medio KC con EGF de 10 ng/mL.
  6. Día 3: Trypsinize y lavar las células de los pozos #1, #4 y #5 como se describe antes (véase 4.4.1 a 4.4.6). Congelación de gránulos de la célula a-80 ° C para extraer ARN total para análisis de qRT-PCR (ver paso 7).
  7. Trypsinize células de pozo #2, #6 y #8 como se describe en pasos 4.4.1 a 4.4.5 y realizar análisis cytofluorimetric para la expresión de GFP (ver paso 5).
  8. Mantener la cultura de los pozos #3, #7 y #9 para doblajes de al menos 3-4, suficientes para diluir no integrados IDLVT2 vector (5 días de keratinocytes humanos primarios sobre capa de alimentador).
  9. Día 6: Aproximadamente 5 días post transducción, trypsinize las células (ver pasos 4.4.1 a 4.4.5) de los pozos #3, #7 y #9 para realizar análisis de cytofluorimetric para la expresión de GFP (ver paso 5).
    Nota: Eficiencia de sincronización y transducción de experimento están influenciados altamente por tipo la célula primaria y por la variabilidad de muestras colectadas.

5. Cytofluorimetric análisis de transduced queratinocitos primarios

Nota: Un citómetro de flujo configurado un láser azul (488 nm), un láser rojo (633 nm) y filtros para la detección de la fluorescencia de GFP y APC es empleada (véase Tabla de materiales).

  1. Discriminar los queratinocitos de la capa de alimentador 3T3-J2, etiqueta transduced queratinocitos separados en día 3 y 6 (ver pasos 4.7 y 4.9) con mouse APC monoclonal-anticuerpo conjugado de anti-alimentador.
    1. Preparar 4 mL de buffer para cada muestra la coloración:
      5% FBS 200 ΜL
      500 mM EDTA (concentración final = 2.5 mM) 20 μL
      ΜL de PBS 1 x 3780
    2. Lavar las células separadas con 1 mL de tampón de tinción. Centrifugar durante 5 min a 580 x g y descartar el sobrenadante.
    3. En un tubo para la adquisición de la citometría de flujo, suspender 5 x 104 células en 100 μL de tampón de tinción y añadir 2 μL de anticuerpo anti-alimentador (1:50). Mezclar bien e incubar durante 30 min en hielo en la oscuridad.
    4. Después de 30 min, lavar con 2 mL de tampón de tinción. Centrifugar durante 5 min a 580 x g y descartar el sobrenadante. Resuspender en 200 μL de tampón de tinción.
    5. Adquirir señales de APC y GFP por cytofluorimetric análisis18. La fracción de células GFP+ de la población de células APCindica queratinocitos transduced.
      Nota: Si se desea, fijar la muestra teñida antes de citometría de flujo con paraformaldehído al 2% en PBS 1 x y almacenar a 4 ° C en la oscuridad hasta la ejecución.
  2. Analizar datos de citometría de flujo mediante el trazado de la relación entre el porcentaje de GFP+las células en el extremo (5 días) y el porcentaje de GFP+células 2 días post transducción, normalizado a nivel residual de IDLVT2-transduced células.

6. semi-cuantitativa de RT-PCR

Nota: Use un termociclador PCR.

  1. Extracto total de RNA de transduced o controlar las células usando un kit de purificación de RNA, según protocolo del fabricante.
    Nota: El ARN Total se puede almacenar a-80 ° C.
  2. Sintetizar el cDNA en una reacción de 20 μl usando 100 ng de RNA total y un kit de la transcriptasa reversa, según protocolo del fabricante.
    Nota: cDNA puede ser almacenado a-20 ° C.
  3. Diseño de cebadores específicos para SB100X, rtTA2s-M2 y GAPDH (un gen de la limpieza).
    Diseños sugeridos:
    SB hacia delante la cartilla: 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB inversa cartilla: 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 hacia delante la cartilla: 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 inversa cartilla: 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH adelante cartilla: 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH inversa cartilla: 5'CCACCACCCTGTTGCTGTAG 3'
  4. Realizar PCR en un volumen final de reacción de 50 μl. En particular, montar en cada tubo PCR la reacción siguiente:
    cDNA (dilución 1:5) (desde el paso 6.2) 1.00 μl
    Adelante la cartilla (stock de 10 μm) 1.00 μl
    Revertir la cartilla (stock de 10 μm) 1.00 μl
    dNTPs (10 acciones de μm) 1.00 μl
    Buffer (+ MgCl2) (10 x stock) 5,00 μl
    Taq polimerasa (stock de 5 U/μL) 0.25 μl
    Μl de agua estéril 40,75
  5. Utilizar el siguiente programa en el termociclador: 1 ciclo a 95 ° C por 5 min luego proceder a 95 ° C por 30 s, 58 ° C por 30 s y 72 ° C por 30 s para 34 ciclos de SB100X, 32 ciclos de rtTA2s-M2 y 25 ciclos de GAPDH.
  6. Preparar el gel de agarosa al 1%. Disolver 1 g de agarosa en 100 mL de TBE 1 x (10 x población diluido en agua estéril), en un vaso de precipitados o matraz. Derretir en el microondas, se arremolinan cada minuto hasta que la agarosa se disuelva completamente. Enfriar la agarosa fundida hasta que llegue aproximadamente a 50 ° C y luego añadir 5 μl de bromuro de etidio (bolsa de 10 mg/mL). Verter la agarosa fundida en una bandeja de gel montado con un peine, gel de fundición de.
  7. Muestras (10 μl) de la carga en el gel de agarosa y realizar la electroforesis.
  8. Si lo desea, adquirir imagen de gel y realizar análisis densitométrico en las bandas PCR.

7. RT-PCR cuantitativa (qRT-PCR)

Nota: Se emplea un sistema comercial de detección de secuencia. Cebadores PCR y sonda 6-carboxyfluorescein (FAM) para el gliceraldehído 3-fosfato deshidrogenasa (GAPDH) son adquiridos comercialmente.

  1. Para retro-transcripción, vea paso 6.2.
  2. Utilizar software para diseño de primers y sondas específicas para SB100X.
    Diseño sugerido:
    SB.2 hacia delante la cartilla: 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 inversa cartilla: 5'-CCCCATGTGCAGTTGCAA-3'
    sonda de SB FAM: 5'-CATAAGAAAGCCAGACTACGG-3'
  3. Realizar PCR en tiempo real en placas de 96 pocillos con un PCR Master Mix y mezcla de cebadores + sonda, en un volumen final de reacción de 25 μl. En particular, considere la siguiente reacción para cada bien:
    cDNA (1:10 dilución en agua estéril) 1.00 μl
    2 μl de la Master Mix 12.50
    Cebadores + sonda x 20 1.25 μl de la mezcla
    Μl de agua estéril 10.25
    Nota: Realice todas las reacciones por triplicado. Para evitar errores de pipeteo, preparar una mezcla de por lo menos n + 3 reacciones (sin cDNA). Alicuotar con una pipeta multicanal.
  4. Ejecutar mediante el siguiente programa PCR en tiempo real: 1 ciclo a 95 ° C por 10 minutos, luego de 40 ciclos de 95 ° C por 15 s y 60 ° C durante 1 min y mantener a 4 ° C.
  5. Analizar datos de qRT-PCR, normalizando la expresión relativa (valor RQ) de la SB100X al nivel de la GAPDH de la misma muestra de cDNA por la cuantificación de 2CT ΔΔ, utilizando el software de análisis de datos típicos.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Utilizando el procedimiento presentado aquí, tres vectores IDLV llevar los componentes regulados de SB (SB100X, rtTA2S-transposon M2 y T2-GFP) eran empaquetados y brindar de manera eficiente y regular bien el sistema de SB en células humanas. Figura 1A se muestra un esquema para en vitro la transducción de las células HeLa, que fue realizada para evaluar la regulación transcripcional de la transposasa de SB con la mejor combinación de dosis de los dos vectores IDLV (reportado en el cuadro 2). La regulación transcripcional de SB100X se midió mediante qRT-PCR (figura 1B) y graficada como un valor de cantidad relativa (RQ) en relación con el estado (IDLVTKSB solo RQ = 1). En células HeLa transduced, se obtuvo una activación (+ dox) 8-fold de SB100X de expresión sobre el fondo (IDLVTKSB). En particular, cotransduced las células HeLa en ausencia de dox mostraron transposasa expresión similar a los Estados apagados, indicando un estricto control del promotor de TetTK por rtTA2s-modulador M2.

Figure 1
Figura 1: Transducción de HeLa células para la expresión de la transposasa SB regulado transcripcionalmente por vectores IDLV. (A) un esquema para la transducción en vitro de las células HeLa con IDLVs para la expresión de la transposasa. (B) análisis de qRT-PCR de las células HeLa transduced con IDLVTKSB (2.600 ng de p24) en la presencia (+) o ausencia (-) de IDLVrtTA2S-M2 (9.600 ng de p24) y 1 μm doxiciclina (dox). La línea punteada conecta muestras significativamente diferentes valores (*** P < 0.005). El experimento se realizó por triplicado. Significa S.E.M se muestra como barras de error. (Figura modificada de Cocchiarella, F. et al., 201618). Haga clic aquí para ver una versión más grande de esta figura.

Por ejemplo, la figura 2 muestra la dosis que van de experimento para llegar a la óptima regulación transcripcional de la transposasa. Las células HeLa fueron transduced con el aumento de dosis (130, 260 y 2.600 ng de p24) de IDLVTKSB en combinación con IDLVrtTA2s-M2 (960 y 9.600 ng de p24), en la presencia o ausencia de dox. Análisis de RT-PCR semicuantitativo claramente muestran que dosis altas de ambos IDLVs debían fuertemente inducen la expresión de SB100X. Tipo de células diferentes y variaciones en la titulación de vector viral pueden resultar en sup-óptima expresión de SB, y por lo tanto se recomienda realizar experimentos de ajuste de dosis.

Figure 2
Figura 2: experimento de ajuste de dosis IDLV en células HeLa para definir la combinación de dosis óptima de los dos IDLVs. Análisis semicuantitativo de RT-PCR en células HeLa transduced conjuntamente con diferentes dosis de vector IDLVTKSB (130, 260 y 2.600 ng de p24) en la ausencia o presencia de IDLVrtTA2s-vector M2 (960 y 9.600 ng de p24) y dox. Se amplificó la GAPDH como control estándar. SB100X transposasa y rtTA2s-expresión M2 se reportan en todas las condiciones probadas; NC = control negativo. (Figura modificada de Cocchiarella, F. et al., 201618). Haga clic aquí para ver una versión más grande de esta figura.

El sistema transcripcional de SB regulado podría utilizarse también en células primarias, particularmente en las células resistentes a varios métodos de transfección, como keratinocytes humanos primarios. La figura 3 muestra un esquema para la transducción de primarios keratinocytes cultivados en letalmente irradiados 3T3-J2 capa del alimentador, con vectores IDLV lleva los componentes regulados de SB, en la presencia o ausencia de dox para inducir la expresión de SB100X.

Figure 3
Figura 3: transducción de señales en suspensión de keratinocytes humanos primarios con IDLV vectores para la expresión de regulado transcripcionalmente SB transposasa y transposon. Un esquema para la transducción en vitro de keratinocytes humanos primarios con IDLVs expresar regulada transcripcionalmente SB transposasa y transposones, en la presencia o ausencia de 1 μm dox. Haga clic aquí para ver una versión más grande de esta figura.

El análisis de qRT-PCR en la Figura 4A muestra que la mejor dosis de combinación de vectores transposasa y modulador, registrados en la tabla 2, dio lugar a activación 15 dobleces de SB expresión sobre el estado (-dox). Se realizó el experimento de transposición en keratinocytes transduced con los tres vectores IDLV (IDLVTKSB, IDLVrtTA2s-M2 y IDLVT2) en la presencia o ausencia de dox. Expresión de la GOI (GFP) soportado por T2-transposones, en el compartimiento del APC , se midió por flujo citometría análisis 2 días post-transducción de señales (dpt) y en el endopoint de la cultura (5 días de keratinocytes humanos primarios). El punto final fue alcanzado cuando incómoda transposon T2-GFP se redujo a un nivel apenas perceptible (un promedio de 0.6%) debido a la dilución de dependiente de la división celular. Figura 4B se muestra la relación entre el porcentaje de GFP+ las células en el compartimiento del APC en el punto final y los 2 días post transducción, normalizada el nivel residual de los transposones solo. Esto indica el porcentaje de células alojamiento al menos 1 ejemplar de GOI expresado estable integrado en su genoma, evaluado en 12% de keratinocytes humanos primarios.

Figure 4
Figura 4: Análisis de la expresión de la transposasa y GFP en queratinocitos primarios humanos transduced. (A) ensayo de qRT-PCR en queratinocitos primarios transduced con IDLVTKSB y IDLVrtTA2S M2 en la presencia o ausencia de dox de 1 μm. (B) la transducción de los queratinocitos primarios con transposon IDLVT2 y IDLVs para la expresión de la transposasa en presencia o ausencia de dox. En el eje y, % GFP+ células 5dpt / %+ de GFP células 2 dpt * 100 (media ± SEM de dos experimentos). ** mostrar valores significativamente diferentes (P < 0,05). (Figura modificada de Cocchiarella, F. et al., 201618). Haga clic aquí para ver una versión más grande de esta figura.

Plásmido Descripción Referencias
pCCL-TetOTKSB La transferencia de plásmido utilizado para generar el vector IDLVTKSB. Este plásmido se deriva de pTetOTKSB, después TetOTKSB la clonación en la columna vertebral de pCCL lentivirales. 18, 20
pCCL-PGKrtTA2S-M2 Transferencia de plásmido utilizado para generar IDLVrtTA2s-vector M2. proporcionada por el Prof. V. Zappavigna
pCCL-T2GFP La transferencia de plásmido utilizado para generar el vector de IDLVT2. Este plásmido derivado de pT2GFP, después de la clonación la GFP entre el IRs transposon T2 en la columna vertebral de pCCL lentivirales. 18, 20
pMD.Lg/pRRE.D64VInt Presentación plásmido para generar vectores IDLV. 19
pMD2.G Plásmido codifica para que sobres de VSV-G generar vectores lentivirales. 20
pRSV-Rev Rev el plásmido para generar vectores lentivirales. 20
Vector de Descripción
IDLVTKSB Vectores lentivirales defectuoso de integración para la expresión de la SB100X bajo el control del promotor TK sensible al TTE.
IDLVrtTA2s-M2 Vectores lentivirales defectuoso de integración para la expresión de la rtTA2s-modulador M2 bajo el control del promotor PGK.
IDLVT2 Vectores lentivirales defectuoso de integración para la expresión de la GOI clonan entre el IRs T2 transposon.

Tabla 1: plásmidos y vectores emplean en el presente Protocolo. Se proporcionan descripciones y referencias.

Vectores de HeLa (2 x 105 células) Queratinocitos (células de5 1.6x10)
IDLVTKSB 2.600 ng p24 13.000 ng p24
IDLVrtTA2s-M2 9.600 ng p24 48.000 ng p24
IDLVT2 9.160 ng p24

Tabla 2: Dosis de vector optimizado para la transducción de células HeLa y keratinocytes humanos primarios.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aquí, describimos una metodología ampliamente accesible para integrar estable un GOI en el genoma de las células de la blanco de La bella durmiente-mediada por transposición. Aunque el sistema de SB fue desarrollado para proporcionar un método nonviral para la edición del genoma, una entrega eficiente de la maquinaria de integración (transposasa y T2 transposon) es obligatoria. Por lo tanto, para utilizar el sistema de SB en células primarias apenas transfectable, una entrega viral de los componentes del SB fue perseguida en los últimos años10,12,15. Sin embargo, ninguno de los vectores virales empleados hasta ahora abordar el tema de la expresión constitutiva de la transposasa que podría resultar en el riesgo de rehopping incontrolable de los transposones.

Para transcripcionalmente regulan la expresión de la transposasa, aprovechamos un modificado Tet-ON system16. El promotor mínimo de TK fusionado al elemento de TetO, en Unión a la rtTA2s-modulador M2 en presencia de dox, confiere un ajuste fino de la transposasa activación sobre el fondo (de estado, en ausencia de dox). El desempeño de las regulaciones depende el IDLVs apropiados (IDLVTKSB y IDLVrtTA2s-M2) vector combinación de dosis y tipos de la célula (por ejemplo, las células HeLa y keratinocytes humanos primarios). Independientemente de las células diana, la dosis de vector debe garantizar el máximo nivel de la transducción de las células diana sin afectar la viabilidad celular por lo tanto una combinación de dosis escalada, experimente, en células HeLa (o en otras líneas celulares) para definir las dosis óptima, RT-PCR semicuantitativa, se sugiere fuertemente.

Transposición de la GOI fue evaluada en células primarias. Keratinocytes humanos primarios sembrados en capa de alimentador 3T3-J2 letalmente irradiados fueron transduced con 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 y IDLVT2) a las dosis experimental definidas. Por qRT-PCR demostró una activación claro dox-depende de la transposasa. Por otra parte, la integración estable de lo GOI fue demostrada por cytofluorimetric análisis de la expresión de GFP en células transduced en la presencia o ausencia de dox, indicando la posibilidad de emplear la plataforma IDLV al vehículo la SB transcripcionalmente regulada componentes de las células primarias y la integración exitosa de un GOI en el genoma de las células diana.

Los pasos críticos en el protocolo son producción del vector IDLV y transducción de las células Diana en la eficacia óptima y una combinación de dosis de vector. Eficacia baja de la transfección de células HEK293T puede resultar en rendimiento bajo vector. La definición de dosis de IDLVTKSB y IDLVrtTA2s-M2 es necesario para evitar un desequilibrio de los componentes de Tet-ON que puede resultar en alta filtración en ausencia del modulador o pliegue bajo la inducción del promotor TetOTK sobre el tratamiento de dox. Estos pasos críticos podrían abordarse por modificaciones menores. Por ejemplo, el protocolo de la transfección puede estandarizarse usando reactivos de transfección comercial. El protocolo de transducción de señales debe ser adaptado según el tipo de la célula de interés, sobre todo teniendo en cuenta si spinoculation aumenta la eficiencia de la transducción de señales sin afectar la viabilidad celular. Vectores de polibreno podría añadido al medio de cultivo de las células diana y reemplazado con medio fresco después de la incubación de 6 horas o durante la noche. También cabe señalar que el porcentaje de GFP+ las células 5 días después de transducción puede verse afectada por la integración del fondo de IDLVs.

Una menor limitación de este método es que los vectores IDLV se producen transitoriamente por la transfección de células HEK293T. Según el vector de dosis a utilizar, repitió vector producciones son necesarias. Una segunda limitación se relaciona con la longitud del GOI, como la capacidad de carga del vector IDLV es aproximadamente 8 kb.

En conclusión, este método permite la integración de un GOI a través de componentes de SB transcripcionalmente regulados en vectores IDLV, que, entre los métodos existentes para ofrecer sistema de SB, con una amplia gama de tropismo y transducción de señales alta eficiencia. Por otra parte, el sistema modificado de Tet-ON permite una regulación transcripcional de la expresión de SB100X, un tema relevante en el riesgo de volver a salto del transposon o en múltiples eventos de transposición serial si son necesarios. Posibles aplicaciones de este método incluyen ingeniería del genoma de líneas celulares (por ejemplo, las células HeLa, células HEK293) para establecer células de embalaje estable para vectores virales e integración de genes terapéuticos en la clínicas células primarias pertinentes.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a Prof. Zappavigna, Universidad de Módena y Reggio Emilia, Módena, Italia por facilitarnos el pCCL-PGKrtTA2S-plásmido M2. También reconocemos Prof Z. Ivics (Instituto de Paul Ehlrich, Langen, Alemania) y Prof. Z. Izvak (Max Delbruck centro de Medicina Molecular, Berlín, Alemania) para plásmidos pCMVSB100X y pT2/BH. Este trabajo fue apoyado por DEBRA internacional y Ministerio de Universidad e investigación.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics