Une méthode de Transposition efficace In Vitro par un système de beauté dormir transcriptionnellement réglementé empaquetée dans un vecteur Lentiviral défectueux de l’intégration

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ce protocole décrit une méthode pour réaliser l’intégration stable d’un gène d’intérêt dans le génome humain par le système transcriptionnellement réglementé de la Belle au bois dormant . Préparation de l’intégration des vecteurs LENTIVIRAUX défectueux, la transduction in vitro des cellules humaines et l’analyse moléculaire sur les cellules transduits sont signalés.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le transposon de Belle au bois dormant (SB) est un système intégrant non viraux avec une efficacité prouvée pour transfert génétique et la génomique fonctionnelle. Pour optimiser les machines de transposon SB, une transposase hyperactif transcriptionnellement réglementé (SB100X) et le transposon axée sur le T2 sont employés. En règle générale, la transposase et transposons sont fournis transitoirement par transfection de plasmide et expression SB100X est pilotée par un promoteur constitutif. Nous décrivons ici une méthode efficace pour fournir les composants SB aux cellules humaines qui sont résistantes à plusieurs méthodes de transfection physiques et chimiques, pour contrôler l’expression SB100X et stablement intégrer un gène d’intérêt (IGE) à travers un « copier / coller » SB mécanisme. L’expression de la transposase hyperactif est étroitement contrôlée par le système Tet-ON, largement utilisé pour contrôler l’expression des gènes depuis 1992. Le gène d’intérêt est flanqué des séquences inversées répétées (IR) du transposon T2. Les deux composantes de SB sont emballés dans l’intégration des vecteurs LENTIVIRAUX défectueux transitoirement produites dans les cellules HEK293T. Les cellules humaines, les lignées cellulaires ou cellules primaires provenant de tissus humains, sont en vitro transitoirement transduites avec des vecteurs viraux. Lors de l’addition de la doxycycline (dox, tétracycline analogique) dans le milieu de culture, un réglage fin de l’expression de la transposase est mesurée et se traduit par une intégration durable du gène d’intérêt dans le génome des cellules traitées. Cette méthode est efficace et applicable à la lignée cellulaire (par exemple, les cellules HeLa) et les cellules primaires (p. ex., les kératinocytes humains primaires) et représente donc un outil précieux pour le génie génétique et transfert de gènes thérapeutiques.

Introduction

La transposase SB100X hyperactive, couplée à du transposon axée sur le T2 a déjà été utilisée dans le gène précliniques thérapie demandes1,2,3, génome modifications4,5, et cellules souches pluripotentes induites (iPSC) reprogrammation6,7. En règle générale, les éléments de SB sont transitoirement fournis par transfection de plasmide et un promoteur constitutif fort conduit à l’expression de la transposase. Toutefois, malgré l’amélioration des nouvelles méthodes de transfection, livraison du système bi-composant demeure un défi pour de nombreuses applications. Ainsi, le développement d’un nouveau protocole de livraison a un intérêt croissant. En plus de méthodes de transfection pour plasmide ARNm et8 9, livraison viral basé sur adénoviraux10,11, adeno-associated virus (AAV)12, Baculovirus13, gammaretroviral14 et vecteurs LENTIVIRAUX15 a été proposé dans le passé. Notamment, le système de choix doit garantir une prestation transitoire des composants SB sans intégration du vecteur viral. Néanmoins, l’expression constitutive de la transposase soulève des questions de sécurité en raison du risque de rehopping incontrôlable du transposon.

Par conséquent, la régulation transcriptionnelle de SB100X par un système raffiné de Tet-ON est le premier défi. Mis à jour le promoteur Tet-sensible, obtenu en remplaçant le promoteur développés minime cytomégalovirus (CMV) original avec le promoteur minimal (-81) du gène du Virus Herpès Simplex 1 (HSV1)16, Timidine Kinase (TK) par est cloné en amont de la SB100X ADNc (pTetOTKSB100X). La mutation inverse-tétracycline-transactivateur rtTA2s-M217 est exprimée sous le contrôle du promoteur constitutif fort (promoteur phosphoglycérate, PGK) cloné dans un plasmide différent (VR-PGKrtTA2S-M2). Lors de l’ajout au milieu de culture, dox lie la rtTA2s-modulateur M2 et longes le promoteur Tet ou complex, consistant en une induction étroitement réglementée de SB100X expression18.

Le deuxième grand défi découle de l’inefficacité transfection de cellules humaines primaires par plusieurs méthodes physiques et chimiques. Pour délivrer efficacement la transposase dans les cellules humaines résistants à la transfection, les SB100X et les rtTA2s-cassettes d’expression M2 sont emballés dans deux intégration des vecteurs LENTIVIRAUX défectueux (IDLVs)19: IDLVTKSB et IDLVrtTA2s- M2. Vecteurs viraux sont transitoirement produits des vecteurs troisième génération de cellules HEK293T20 et Pseudo avec la glycoprotéine G du Virus de la stomatite vésiculeuse (VSV-G), qui lui confère un large spectre de l’infection. Particules de vecteur sont concentrées par ultracentrifugation et titrés par immunocapture de p24 VIH-1 Gag. Pour transmettre des lignées cellulaires et les cellules primaires, particules de vecteur sont complexés avec polybrene et sont incubés avec cellules cibles en présence ou en absence de dox. Activation de toxicomanes de SB100X expression dans les cellules transduits est mesurée par quantitative RT-PCR (qRT-PCR)18.

Une fois que l’expression SB100X Tet réglementés est démontrée, transposition des IgE (p. ex., protéine fluorescente verte, GFP) dans le génome de cellule cible suit les événements moléculaires clairement schématisées par Bak et Mikkelsen21. Une troisième jusque vecteur transportant une cassette d’expression pour les pouvoirs publics indiens cloné entre l’IRs T2-transposon (IDLVT2) doit être construit et conditionnés comme indiqué ci-dessus. Enfin, les trois vecteurs jusque peuvent être utilisés efficacement transduce (p. ex., les kératinocytes primaires) des cellules humaines in vitro et intégrer le gouvernement de l’Inde en présence de doxycycline,18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. les plasmides employées

NOTE : Plasmide VR-PGKrtTA2S-M2 a été aimablement fournie par Prof. Zappavigna (Université de Modène et Reggio Emilia, Modène, Italie). Le plasmide de pCMVSB100X portant la séquence codante de la transposase hyperactif et plasmide transposon pT2/BH ont été gracieusement fournis par Prof Z. Ivics (l’Institut Paul Ehrlich, Langen, Allemagne) et le Prof. Z. Izvak (Centre Max Delbrück de médecine moléculaire, Berlin, (Allemagne).

  1. Pour tout clonage dans Escherichia Coli (e. coli), suivre la stratégie de clonage de la procédure de choix et d’enzymes de restriction ou amplification par PCR du fragment à être cloné.
    Remarque : Le tableau 1 résume l’ensemble des plasmides employées dans le présent protocole. Une description et les références pour chaque plasmide sont fournis.

2. production de vector virale

Remarque : Tous les vecteurs viraux sont produites sous une hotte biologique à un niveau de confinement de biosécurité BSL2, conformément aux règles institutionnelles et les règlements.

  1. Cellules HEK293T adhérentes de la culture dans un milieu d’Eagle modifié de Dulbecco additionné de 10 % de sérum de HyClone, 100 U/mL de pénicilline-streptomycine et 2 mM de glutamine.
  2. Jour 0 : Préparer cinq préparation virale des plaques de 15 cm et semences 5.5x106 cellules dans 30 mL de milieu.
  3. Jour 1 : Transfection
    1. Avant de commencer la transfection, préparation de 100 mL de sérum de tampon 2 x HEPES (HBS) :
      NaCl (5 M) 5,6 mL
      HEPES (1 M) 10,0 mL
      Na2HPO4 (0,5 M) 0,3 mL
      Stérile 84,1 mL d’eau
      Ajuster le pH 7.1 avec 37 % HCl.
      Remarque : 2 x HBS peuvent être stockés à 4 ° C. Un pH exact est extrêmement important pour la transfection efficace. Le pH optimal se situe entre 7.10 à 7.12.
    2. Éliminer le milieu et ajouter 22,5 mL/plaque de frais moyen 4 h avant la transfection.
    3. Transfecter de cellules HEK293T avec le plasmide de transfert, le plasmide d’emballage de pMD.Lg/pRRE.D64VInt, le plasmide pMD2.G de codage à l’enveloppe et le pRSV-Rev (tableau 1) selon la montant/plaquette :
      transfert plasmidique 25.00 µg
      pMD.Lg/pRRE.D64VInt 16,25 µg
      pMD2.G 8,75 µg
      pRSV-Rev 6,25 µg
      NOTE : Plasmide DNAs sont préparés selon le protocole de CsCl décrit par Maniatis22 ou en utilisant un kit de purification de plasmide exempte d’endotoxine.
      1. Resuspendre 56,25 µg d’ADN (mélange de 4 plasmides) à 1,125 mL d’eau stérile et ajoutez 125 µL de 2,5 M CaCl2 (solution A).
      2. Ajouter 1,250 mL de 2 x HBS dans un tube à centrifuger conique stérile de 15 mL (solution B).
      3. Ajouter un (1,250 mL) à B (1,250 mL) quelques gouttes tout en bulles avec une pipette de 1 ou 2 mL (solution de transfection, volume total 2,500 mL).
      4. Incuber pendant 20 min à température ambiante (RT).
      5. À l’aide d’une micropipette P1000, distribuer toute la solution de transfection (2,500 mL) à la monocouche cellulaire goutte à goutte.
    4. Incuber pendant la nuit dans un incubateur de culture cellulaire à 37 ° C, 5 % de CO2.
  4. Jour 2 : Enlever le milieu et ajouter 15 mL de milieu frais (reportez-vous à l’étape 2.1).
  5. Jour 3 : Rassembler et concentrer le surnageant contenant des particules lentiviral.
    1. Recueillir le surnageant (environ 70 mL) de tout (n = 5) plaques de cellules transfectées, filtrer à travers un 0,45 µm SPE filtre et remplissage les 2 tubes de polyallomère (1po x 3,5 pouces) / viral préparation.
    2. Concentrer les particules de vecteur par ultracentrifugation à 106 000 x g pendant 2,5 h, à 15 ° C avec frein.
    3. Immédiatement après l’arrêt de l’ultracentrifugation (pour éviter la remise en suspension de la pastille dans le tube), doucement, transvaser le surnageant dans un récipient contenant 10 % eau de Javel et de suspendre les 2 granules à peine visibles dans 100 µL de PBS 1 x (+ 1 % BSA). Ceci est normal car la pastille est claire et très petit. Utiliser le vecteur concentré fraîchement préparé ou aliquot et stocker les préparations virales à-80 ° C.
      ATTENTION : Le surnageant contient des Particules Lentivirales qui doivent être blanchis soigneusement avant de le jeter dans les poubelles de biohazard.
  6. Pour titrer la préparation de vecteurs viraux, utiliser un kit d’immunocapture p24 VIH-1 Gag selon le protocole du fabricant.
    Remarque : Afin de normaliser la production de vecteurs viraux, réactifs à base de liposomes pourraient être employés. Néanmoins, le titre de vecteur viral est fortement tributaire de l’efficacité de transfection et la pureté de l’ADN de plasmide.

3. transduction des lignées cellulaires humaines (par exemple, les cellules HeLa)

Remarque : Les cellules HeLa sont cultivées dans un milieu d’aigle modifié de Dulbecco additionné de 10 % de sérum de veau foetal, 100 U/mL de pénicilline-streptomycine et 2 mM de glutamine. Le tableau 1 résume l’ensemble des vecteurs utilisés dans le présent protocole. Une description pour chaque vecteur est fournie. Transduction de cellules HeLa permet la vérification de la régulation transcriptionnelle de transposase SB dans la meilleure combinaison de dose des deux vecteurs jusque. Variation des doses jusque peut être liée à vector titrage de la particule et le type de cellule cible.

  1. Jour 0 : 2 x 105 cellules dans 3 mL de milieu pour chaque puits d’une plaque 6 puits de graines. Préparer 4 puits.
  2. Jour 1 : Transduction des cellules HeLa.
    1. Pour chaque condition, diluer les vecteurs LENTIVIRAUX pour un volume final de 1 mL de milieu (voir la Note ci-dessus) en présence de 10 μL de polybrene (concentration finale 8 μg/mL) :
      Dilution pour puits #1 : se moquer des cellules transduits (témoin négatif).
      Dilution pour bien #2 : vecteur IDLVTKSB (2 600 ng de p24).
      Dilution pour puits #3, #4 : vecteur IDLVTKSB (2 600 ng de p24) + IDLVrtTA2s-M2 vectoriel (9 600 ng de p24).
    2. Retirer le support de chaque puits où les cellules HeLa ont été plaqués au jour J0 et ajoutez des dilutions de vecteur lentiviral au bien correspondant.
    3. Spinoculate la plaque 6 puits à 754 x g pendant 45 min à 20-25 ° C et puis changer la plaque 6 puits dans un incubateur de culture cellulaire à 37 ° C et 5 % de CO2.
    4. Après 6 h, remplacer les vecteurs contenant moyens avec un milieu frais dans tous les puits et ajouter la doxycycline à 1 μM de bien #4. Mettre la plaque dans un incubateur de culture cellulaire à 37 ° C pendant 48 h.
  3. Jour 3 : Préparation du culot pour extraction de l’ARN.
    1. Avant de détacher les cellules, préparer une solution de travail de la trypsine (1 x) :
      2,5 % trypsine (x 10) 5,0 mL
      500 mM EDTA (concentration finale = 5 mM) 0,5 mL
      1 x mL de PBS 44,5
    2. Solution de travail de la trypsine chaud à 37 ° C avant utilisation. Stocker la solution de travail de la trypsine à 4 ° C.
    3. Éliminer le milieu et laver les cellules avec du PBS 1 x. Ajouter 0,5 mL de solution de travail de la trypsine préchauffé 37 ° C à chaque puits et incuber à 37 ° C pendant 7 min (dans un incubateur de culture cellulaire).
    4. Après l’incubation, ajouter 0,5 mL de sérum contenant moyen dans chaque puits pour inactiver la trypsine et recueillir les cellules dans un tube à centrifuger. Rincer bien une fois avec 3 mL de PBS 1 x et centrifuger la suspension cellulaire pendant 5 min à 240 x g.
    5. Laver les cellules avec 5 mL de solution 1 PBS x, centrifuger pendant 5 min à 240 x g et jeter le surnageant. Utilisez les granules des cellules fraîchement prélevés ou stocker à-80 ° C. Extraire l’ARN total de pastilles à réaliser la RT-PCR semi-quantitative (voir étape 6).

4. transduction de cellules humaines primaires (p. ex., les kératinocytes)

Remarque : Des kératinocytes humains primaires sont ensemencées sur 3 t 3-J2 mortellement irradiés cellules (couche de conducteur)23, un gentil cadeau de Yan Barrandon (EPFL, Lausanne, Suisse).

  1. La croissance de cellules 3 t 3-J2 souris Swiss Eagle modifié de Dulbecco milieu additionné de 10 % de sérum de bovin donneur, 50 U/mL de pénicilline-streptomycine et 4 mM de glutamine (moyenne de 3 t 3).
  2. Croissance des kératinocytes ensemencés sur cellules 3 t 3-J2 mortellement irradiés dans un milieu DMFC, milieu d’Eagle modifié d’un Dulbecco et mélange de médias F12 du jambon (3:1) contenant du sérum de veau fœtal (10 %), la pénicilline-streptomycine (1 %), glutamine (2 %), l’insuline (5 µg/mL), adénine ( 0.18 mM), hydrocortisone (0,4 µg/mL), la toxine cholérique (0,1 nM) et la triiodothyronine (2 nM).
  3. Jour 0 : Semences 3 x 105 mortellement irradié cellules 3 t 3-J2, préalablement diluées dans un milieu à une concentration finale de 1 X 105 cellules/mL, dans chaque puits de la plaque 6 puits 3 t 3. Préparer 9 puits.
  4. Jour 1 : Transduction de kératinocytes primaires
    NOTE : Transduction de kératinocytes permet la quantification de la régulation transcriptionnelle de transposase SB dans la meilleure combinaison de dose des deux vecteurs jusque (par qRT-PCR) et de vérifier l’intégration de la GOI (GFP) dans les cellules cibles (par cytofluorométrique analyse).
    1. Avant de détacher les cellules, préparer la solution de travail de la trypsine :
      0,5 % trypsine-EDTA (x 10) 5,0 mL
      500mM EDTA (concentration finale = 5 mM) 0,5 mL
      1 x mL de PBS 44,5
    2. Solution de travail de la trypsine chaud à 37 ° C avant utilisation. Stocker la solution de travail de la trypsine à 4 ° C.
    3. Pour détacher les kératinocytes sont en culture, éliminer le milieu, laver les cellules avec du PBS 1 x et ajouter 1 mL de solution de travail de la trypsine préchauffé dans chaque puits. Incuber à 37 ° C pendant 15 minutes dans l’incubateur de culture cellulaire.
    4. Après l’incubation, remettre en suspension les cellules d’un puits soigneusement et transférer la suspension de cellules dans un tube à centrifuger contenant 2 mL sérum contenant du milieu (si plusieurs cellules sont encore attachés, incuber pendant une minutes supplémentaires à 37 ° C). Rincez bien une fois avec 3 mL de 1 x PBS ou un milieu frais et ajouter la solution de rinçage dans le tube à centrifuger la suspension cellulaire.
    5. Centrifuger pendant 5 min à 580 x g et éliminer le surnageant.
    6. Laver les cellules avec 5 mL de solution 1 PBS x, centrifuger pendant 5 min à 580 x g et éliminer le surnageant.
    7. Dans un tube de 15 mL en polypropylène, diluer 1.6x105 kératinocytes dans 1 mL de milieu DMFC, une dilution pour chaque condition.
    8. Diluer les vecteurs LENTIVIRAUX dans 1 mL de milieu DMFC en présence de 20 μL de polybrene (concentration finale de 8 µg/mL à un volume final de 2 mL) :
      Les dilutions pour puits #1, #2, #3 : se moquer des cellules transduits (témoin négatif sans vecteurs).
      Les dilutions pour puits 4 #, 5 # : vecteur IDLVTKSB (13 000 ng de p24) + IDLVrtTA2s-vecteur M2 (48 000 ng de p24).
      Les dilutions pour puits #6, #7, #8, #9 : vector IDLVTKSB (13 000 ng de p24) + IDLVrtTA2s-vecteur M2 (48 000 ng de p24) + IDLVT2 vector (9 160 ng de p24).
    9. Transmettre les cellules en suspension en ajoutant chaque dilution vecteur lentiviral (1 mL) à la suspension de kératinocytes correspondante (1.6x105 kératinocytes dans 1 mL).
    10. Retirer le support de cellules 3 t 3-J2 mortellement irradiés injectées à jour 0 et plaque transduite kératinocytes (1.6x105 kératinocytes dans 2 mL) sur eux. Bout de transduction d’un puits procéder à celle qui suit.
    11. Incuber à 25 ° C pendant 30 min et ensuite transférer les cellules à 37 ° C dans l’incubateur de culture cellulaire pendant 6 h.
      Remarque : Ne spinoculate pas les kératinocytes primaire, comme la viabilité et la prolifération seront fortement touchés.
    12. Après 6 h, ajouter 1 mL de milieu DMFC dans chaque puits. Ajouter 1 doxycycline μM (concentration finale) dans les puits #5, #8 et #9. Retourner les cellules à 37 ° C.
  5. Jour 2 : Remplacer les DMFC moyen avec 3 mL de milieu KC 10 ng/ml EGF.
  6. Jour 3 : Trypsinize et laver les cellules provenant de puits #1, #4 et #5 comme indiqué auparavant (voir 4.4.1 à 4.4.6). Congeler des boulettes de cellule à-80 ° C pour extraire l’ARN total pour analyse qRT-PCR (voir étape 7).
  7. Trypsinize cellules de bien #2, #6 et #8 comme indiqué aux paragraphes 4.4.1 à 4.4.5 et effectuer une analyse cytofluorométrique pour l’expression de la GFP (voir étape 5).
  8. Maintenir la culture des puits #3, #7 et #9 au moins 3-4 doublements, suffisantes pour diluer non intégrée des vecteurs IDLVT2 (5 jours pour les kératinocytes primaires plaqués sur la couche de conducteur).
  9. Jour 6 : Environ 5 jours après transduction, trypsinize des cellules (voir étapes 4.4.1 à 4.4.5) provenant de puits #3, #7 et #9 pour réaliser une analyse cytofluorométrique pour l’expression de la GFP (voir étape 5).
    NOTE : Efficacité de cadencement et de transduction expérience sont fortement influencé par type de cellules primaires et par la variabilité des échantillons recueillis.

5. cytofluorométrique analyse sur les kératinocytes primaires transduits

Remarque : Un cytomètre en flux configuré avec un laser bleu (488 nm), un laser rouge (633 nm) et filtres pour la détection de la fluorescence GFP et APC est employée (voir la Table des matières).

  1. Pour discriminer les kératinocytes de la couche de conducteur 3 t 3-J2, étiquette transduite kératinocytes détachés au jour 3 et jour 6 (voir étapes 4.7 et 4.9) avec la souris monoclonal APC-anticorps anti-Feeder conjugué.
    1. Préparer 4 mL de tampon pour chaque échantillon de coloration :
      5 % BF 200 ΜL
      500 mM EDTA (concentration finale = 2,5 mM) 20 μL
      Μl de PBS 1 x 3780
    2. Laver les cellules individuelles avec 1 mL de tampon de coloration. Centrifuger pendant 5 min à 580 x g et éliminer le surnageant.
    3. Dans un tube pour l’acquisition de cytométrie en flux, remettre en suspension les cellules4 5 x 10 à 100 μL de tampon de coloration et ajouter 2 μL d’anticorps anti-Feeder (01:50). Bien mélanger et incuber pendant 30 minutes sur la glace dans l’obscurité.
    4. Après 30 min, laver avec 2 mL de tampon de coloration. Centrifuger pendant 5 min à 580 x g et éliminer le surnageant. Resuspendre dans 200 μl de tampon de coloration.
    5. Acquérir des signaux APC et GFP par cytofluorométrique analyse18. La fraction cellulaire GFP+ de la population de cellules APCindique les kératinocytes transduits.
      Remarque : Si vous le désirez, fixer l’échantillon coloré avant la cytométrie en flux avec paraformaldéhyde à 2 % dans du PBS 1 x et conserver à 4 ° C dans l’obscurité jusqu'à ce que la course.
  2. Analyser les données de cytométrie de flux en traçant le rapport entre le pourcentage de GFP+cellules au point de terminaison (5 jours) et le pourcentage de GFP+cellules 2 jours après la transduction, normalisée au niveau résiduel de la IDLVT2-transduites cellules.

6. semi quantitative RT-PCR

Remarque : Utilisez un thermocycleur PCR.

  1. Extrait total RNA de transduites ou contrôlent les cellules à l’aide d’un kit de purification d’ARN, selon le protocole du fabricant.
    Remarque : L’ARN Total peut être stockée à-80 ° C.
  2. Synthèse de cDNA dans une réaction de 20 µL à l’aide de 100 ng d’ARN total et un kit de la transcriptase inverse, selon le protocole du fabricant.
    NOTE : ARNC peut être conservé à-20 ° C.
  3. Conception des amorces spécifiques pour SB100X, rtTA2s-M2 et GAPDH (un gène de ménage).
    Modèles proposés :
    SB en avant apprêt : 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB reverse primer : 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 avant l’apprêt : 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 reverse primer : 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH avant apprêt : 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH reverse primer : 5'CCACCACCCTGTTGCTGTAG3'
  4. Effectuer des PCR dans une finale réactionnel de 50 µL. En particulier, se réunissent dans chaque tube PCR la réaction suivante :
    ADNc (dilution 1:5) (de l’étape 6.2) 1,00 µL
    Avant l’amorce (stock de 10 µM) 1,00 µL
    Inverser l’apprêt (stock de 10 µM) 1,00 µL
    dNTPs (stock de 10 µM) 1,00 µL
    Tampon (+ MgCl2) (10 x stock) 5,00 µL
    Taq polymérase (stock de 5 U/µL) 0,25 µL
    µL d’eau stérile 40,75
  5. Utiliser le programme suivant du thermocycleur : 1 cycle à 95 ° C pendant 5 min puis procéder à 95 ° C pendant 30 s, 58 ° C pendant 30 s et 72 ° C pendant 30 s pour 34 cycles pour SB100X, 32 cycles pour rtTA2s-M2 et 25 cycles pour GAPDH.
  6. Préparer un gel d’agarose à 1 %. Dissoudre 1 g d’agarose dans 100 mL de TBE 1 x (10 x stock dilué dans de l’eau stérile), dans un bécher ou la fiole. Faire fondre au micro-ondes, agitant chaque minute jusqu'à dissolution complète de l’agarose. Refroidir l’agarose fondu jusqu'à ce qu’il atteigne environ 50 ° C et ensuite ajouter 5 µL de bromure d’éthidium (10 mg/mL de bouillon). Verser d’agarose fondu dans un bac à gel assemblé avec un peigne, pour la coulée de gel.
  7. Charger des échantillons (10 µL de chaque) sur le gel d’agarose et effectuer l’électrophorèse.
  8. Si vous le souhaitez, acquérir photo gel et effectuer des analyses densitométriques sur les bandes PCR.

7. RT-PCR quantitative (qRT-PCR)

NOTE : Un système de détection de séquence commerciale est employé. Amorces et 6-carboxyfluorescéine (FAM) sonde de glycéraldéhyde 3-phosphate déshydrogénase (GAPDH) sont achetés dans le commerce.

  1. Pour rétro-transcription, reportez-vous à l’étape 6.2.
  2. Logiciel permet de concevoir des amorces et des sondes spécifiques pour SB100X.
    Conception proposée :
    SB.2 avant l’apprêt : 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 reverse primer : 5'-CCCCATGTGCAGTTGCAA-3'
    sonde de SB FAM : 5'-CATAAGAAAGCCAGACTACGG-3'
  3. Effectuer la PCR en temps réel dans des plaques de 96 puits avec une PCR Master Mix et amorces + sonde mélange, dans un volume de réaction finale 25 µl. En particulier, examiner la réaction suivante pour chaque puits :
    ADNc (01:10 dilution dans l’eau stérile) 1,00 µL
    2 x µL du mélange réactionnel 12,50
    Amorces + 20 sonde x mélange 1,25 ml
    µL d’eau stérile 10,25
    Remarque : Effectuez toutes les réactions en triple exemplaire. Pour éviter les erreurs de pipetage, préparer un mélange d’au moins n + 3 réactions (sans ADNc). Aliquote à l’aide d’une pipette multicanaux.
  4. Exécutez la PCR en temps réel en utilisant le programme suivant : cycle de 1 à 95 ° C pendant 10 min, puis 40 cycles de 95 ° C pour 15 s et 60 ° C pendant 1 min et maintenez à 4 ° C.
  5. Analyser les données qRT-PCR en normalisant l’expression relative (valeur RQ) de la SB100X au niveau de GAPDH du même échantillon ADNc par la quantificationCT deΔΔ2, à l’aide du logiciel d’analyse de données classique.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

À l’aide de la procédure présentée ici, trois vecteurs jusque supportant les composants réglementés de SB (SB100X, rtTA2S-transposon M2 et T2-GFP) ont été emballés et permettant de délivrer efficacement et étroitement réglementer le système SB dans les cellules humaines. Figure 1 a présente un schéma pour in vitro transduction des cellules HeLa, qui a été réalisée pour évaluer la régulation transcriptionnelle de SB transposase avec la meilleure combinaison de dose des deux vecteurs jusque (indiqué dans le tableau 2). La régulation de la transcription de SB100X a été mesurée par qRT-PCR (Figure 1 b) et tracée comme une valeur relative quantité (RQ) à l’égard de l’État (IDLVTKSB RQ seul = 1). Dans les cellules HeLa transduits, une activation 8 fois (+ dox) d’expression de la SB100X sur le fond (IDLVTKSB) a été obtenue. Notamment, les cellules HeLa cotransduced en l’absence de dox a montré l’expression de la transposase comparables aux États off, indiquant un contrôle étroit du promoteur de la TetTK de rtTA2s-modulateur M2.

Figure 1
Figure 1 : Transduction de HeLa cells pour l’expression de la transposase de SB transcriptionnellement réglementés par vecteurs jusque. (A) un système de transduction de in vitro des cellules HeLa avec IDLVs pour l’expression de la transposase. (B) analyse des qRT-PCR de HeLa cellules transduites avec IDLVTKSB (2 600 ng de p24) en présence (+) ou en absence (-) de IDLVrtTA2S-M2 (9 600 ng de p24) et 1 µM doxycycline (dox). La ligne pointillée relie les échantillons présentant des valeurs significativement différentes (*** P < 0,005). L’expérience a été réalisée en trois exemplaires. Moyenne de S.E.M apparaît sous forme de barres d’erreur. (Figure de Cocchiarella, F. et al., 201618). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Par exemple, la Figure 2 illustre la dose allant d’expérience mis en place pour atteindre la régulation transcriptionnelle optimale de transposase. Les cellules HeLa ont été transduites avec doses croissantes (130, 260 et 2 600 ng de p24) de IDLVTKSB en combinaison avec IDLVrtTA2s-M2 (960 et 9 600 ng de p24), en présence ou en absence de dox. Analyse de RT-PCR semi-quantitative montre clairement que les fortes doses de ces deux IDLVs devaient inciter fortement SB100X expression. Type de cellule cible différente et variations de titrage viral vector peuvent entraîner une expression SB sup-optimale, et il est donc recommandé de réaliser des expériences de réglage posologique.

Figure 2
Figure 2 : jusque dose mise en expérimentation dans les cellules HeLa pour définir la combinaison de dose optimale des deux IDLVs. Analyse de RT-PCR semi-quantitative sur HeLa cellules transduites conjointement avec différentes doses de vector IDLVTKSB (130, 260 et 2 600 ng de p24) en l’absence ou la présence de IDLVrtTA2s-M2 vector (960 et 9 600 ng de p24) et dox. La GAPDH a été amplifié comme un contrôle standard. SB100X transposase et rtTA2s-expression M2 sont rapportés dans toutes les conditions testées ; NC = contrôle négatif. (Figure de Cocchiarella, F. et al., 201618). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Le système transcriptionnel de SB réglementé pourrait également servir dans les cellules primaires, en particulier dans ces cellules résistantes à plusieurs méthodes de transfection, tels que des kératinocytes humains primaires. La figure 3 montre un schéma pour la transduction des kératinocytes primaires cultivés sur mortellement irradiés couche de conducteur 3 t 3-J2, avec des vecteurs jusque supportant les composants réglementés de SB, en présence ou en absence de dox pour induire l’expression de SB100X.

Figure 3
Figure 3 : Transduction en suspension des kératinocytes humains de primaires avec jusque vecteurs d’expression de transcriptionally réglementés SB transposase et transposon. Un schéma de in vitro la transduction des kératinocytes humains de primaires avec IDLVs pour exprimer transcriptionnellement réglementés SB transposase et transposon, en présence ou en absence de 1 µM dox. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

L’analyse de qRT-PCR dans Figure 4 a montre que la meilleure dose combinaison de vecteurs transposase et modulateur, rapportés dans le tableau 2, entraîna 15 fois activation d’expression SB au cours de l’État (-dox). L’expérience de transposition a été effectuée dans les kératinocytes transduites avec les trois vecteurs jusque (IDLVTKSB, IDLVrtTA2s-M2 et IDLVT2) en présence ou en absence de dox. Expression de la GOI (GFP) beared par T2-transposon, dans le compartiment de l’APC , a été mesurée par flux cytomètre analyse 2 jours après la transduction (DCT) et à l’endopoint de la culture (5 jours pour les kératinocytes primaires). Le point de terminaison a été atteint lorsque non intégré transposon T2-GFP a chuté à un niveau à peine détectable (une moyenne de 0,6 %) due à la dilution de la division cellulaire dépendante. Figure 4 b montre le rapport entre le pourcentage de GFP+ des cellules dans le compartiment de l’APC au point de terminaison et 2 jours post transduction, normalisée au niveau résiduel du transposon seul. Ceci indique le pourcentage de cellules hébergement au moins 1 exemplaire des IGE expresse intégrée de façon stable dans leur génome, évaluée à 12 % pour les kératinocytes primaires.

Figure 4
Figure 4 : analyse de l’expression de la transposase et GFP dans transduite kératinocytes humains de primaires. (A) qRT-PCR assay sur kératinocytes primaires transduites avec IDLVTKSB et IDLVrtTA2S-M2 en présence ou en absence de 1µm dox. (B) co transduction des kératinocytes primaires avec le transposon IDLVT2 et IDLVs pour l’expression de la transposase en présence ou en absence de dox. Sur l’axe des y, % GFP+ cellules 5dpt / % GFP+ cellules 2 dpt * 100 (moyenne ± et de deux essais). ** indiquent des valeurs significativement différentes (P < 0,05). (Figure de Cocchiarella, F. et al., 201618). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Plasmide Description Références
VR-TetOTKSB Transfert plasmidique utilisé pour générer le vecteur IDLVTKSB. Ce plasmide dérivé de pTetOTKSB, après le clonage de TetOTKSB dans le squelette des gènes de VR. 18, 20
VR-PGKrtTA2S-M2 Transfert plasmidique utilisé pour générer des IDLVrtTA2s-vecteur M2. fournies par le Prof. V. Zappavigna
VR-T2GFP Transfert plasmidique utilisé pour générer le vecteur IDLVT2. Ce plasmide dérivé de pT2GFP, après le clonage de la GFP entre l’IRs T2-transposon dans le squelette des gènes de VR. 18, 20
pMD.Lg/pRRE.D64VInt Emballage de plasmide pour générer le vecteur jusque. 19
pMD2.G Plasmide codant pour l’enveloppe de VSV-G générer le vecteur lentiviral. 20
pRSV-Rev Rev plasmide vecteur lentiviral de générer. 20
Vector Description
IDLVTKSB Vecteur lentiviral défectueux de l’intégration pour l’expression de la SB100X sous le contrôle du promoteur TK Tet-sensible.
IDLVrtTA2s-M2 Vecteur lentiviral défectueux de l’intégration pour l’expression de la rtTA2s-modulateur M2 sous le contrôle du promoteur PGK.
IDLVT2 Vecteur lentiviral défectueux de l’intégration pour l’expression des IGE cloné entre l’IRs T2-transposon.

Tableau 1 : plasmides et les vecteurs utilisés dans le présent protocole. Descriptions et références sont fournis.

Vecteurs HeLa (2 x 105 cellules) Kératinocytes (cellules de5 1.6x10)
IDLVTKSB 2 600 ng p24 13 000 ng p24
IDLVrtTA2s-M2 9 600 ng p24 48 000 ng p24
IDLVT2 9 160 ng p24

Tableau 2 : Les doses de vecteur optimisée pour la transduction des cellules HeLa et des kératinocytes humains primaires.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nous décrivons ici une méthodologie largement accessible pour un GOI stablement intégrer le génome des cellules cibles de la Belle au bois dormant-médiée par transposition. Bien que le système de SB a été développé pour fournir une méthode nonviral pour l’édition de génome, une prestation efficace de la machinerie de l’intégration (transposase et T2 transposon) est obligatoire. Par conséquent, pour utiliser le système SB sur peine transfectable cellules primaires, une livraison virale des composants SB a été reprise dans ces dernières années10,12,15. Toutefois, aucun des vecteurs virus employées jusqu'à maintenant abordé la question de l’expression constitutive de la transposase qui pourrait entraîner le risque de rehopping incontrôlable du transposon.

Pour l’activité de transcription régulent l’expression de la transposase, nous avons profité d’un système de Tet-ON mis à jour le16. Le promoteur minimal de TK fusionnée à l’élément de TetO, lors de la liaison au rtTA2s-modulateur M2 en présence de dox, conféré une mise au point d’activation de la transposase sur le fond (État, en l’absence de dox). La performance réglementaire dépend des IDLVs appropriées (IDLVTKSB et IDLVrtTA2s-M2) vector combinaison de dose et sur les types de cellules (par exemple, les cellules HeLa et des kératinocytes humains primaires). Indépendamment des cellules cibles, la dose de vecteur doit s’assurer le plus haut niveau de la transduction des cellules cibles sans affecter la viabilité cellulaire, donc une association à doses croissante innover dans les cellules HeLa (ou d’autres lignées cellulaires) pour définir les doses optimales, en RT-PCR semi-quantitative est fortement conseillé.

Transposition des IGE a été évaluée dans les cellules primaires. Les kératinocytes primaires graines sur couche de conducteur 3 t 3-J2 mortellement irradiés ont été transduites avec 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 et IDLVT2) aux doses déterminées expérimentalement. Une activation de claire dox-dépendante de la transposase a été démontrée par qRT-PCR. En outre, l’intégration stable des IGE a été démontrée par analyse cytofluorométrique d’expression de la GFP dans les cellules transduites en présence ou en absence de dox, indiquant la possibilité d’utiliser la plate-forme jusqu’au véhicule le SB transcriptionnellement réglementé composants pour les cellules primaires et l’intégration réussie d’un gouvernement de l’Inde dans le génome des cellules cibles.

Les étapes cruciales dans le protocole sont jusque vector production et transduction des cellules cibles à l’efficacité optimale et combinaison de dose de vecteur. Efficacité faible de transfection de cellules HEK293T peut entraîner avec un rendement faible de vecteur. La définition des doses de IDLVTKSB et IDLVrtTA2s-M2 est nécessaire pour éviter un déséquilibre des composants de Tet-ON pouvant entraîner une perméabilité élevée en l’absence du modulateur ou en pli faible induction du promoteur TetOTK traitement par dox. Ces étapes critiques pourraient être résolues par des modifications mineures. Par exemple, le protocole de transfection pourrait être normalisé à l’aide de réactifs commerciaux de transfection. Le protocole transduction devrait être adapté selon le type de cellules d’intérêt, particulièrement si l'on considère que spinoculation augmente l’efficacité de la transduction sans affecter la viabilité des cellules. Vecteurs et polybrene pourraient être ajoutés au milieu de culture des cellules cibles et remplacés par un milieu frais après une incubation de 6 heures ou toute une nuit. Il est également intéressant de noter que le pourcentage de GFP+ cellules de cinq jours qui suivent la transduction pourrait être affectée par l’intégration de fond de IDLVs.

Une limitation mineure de cette méthode est que les vecteurs jusque sont produits transitoirement par transfection de cellules HEK293T. Selon le vecteur doses à utiliser, répétées vecteur productions sont nécessaires. Une autre limite est liée à la longueur des IGE, comme la capacité de chargement du vecteur jusqu’environ à 8 Ko.

En conclusion, cette méthode ici permet l’intégration d’un GOI grâce à des composants SB transcriptionnellement réglementés emballés dans des vecteurs jusque, qui, parmi les méthodes existantes pour fournir le système de SB, présentent un large éventail de tropisme et l’efficacité élevée de transduction. De plus, le système modifié de Tet-ON permet une régulation de la transcription de l’expression de SB100X, une question pertinente du risque de transposon re-saut ou dans plusieurs événements de transposition série si elles sont nécessaires. Applications possibles de cette méthode incluent génie de génome des lignées cellulaires (par exemple, les cellules HeLa, les cellules HEK293) d’établir des cellules d’emballage stable pour les vecteurs viraux et intégration des gènes thérapeutiques dans la cliniques pertinente des cellules primaires.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions le professeur Zappavigna, Université de Modène et Reggio Emilia, Modène, Italie pour nous avoir fourni le VR-PGKrtTA2S-M2 plasmide. Nous remercions également Prof Z. Ivics (l’Institut Paul Ehrlich, Langen, Allemagne) et le Prof. Z. Izvak (Max Delbrück Center for Molecular Medicine, Berlin, Allemagne) pour les plasmides pCMVSB100X et pT2/BH. Ce travail a été soutenu par DEBRA internationale et le ministère italien de l’Université et de la recherche.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics