강력한 DNA 고립과 표 본관 표본에 대 한 높은 처리량 시퀀싱 도서관 건축

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

이 문서에서는 DNA 분리 및 매우 가난한 품질 DNA의 구조를 포함 하 여 식물 표본 상자 물자에서 높은 처리량 시퀀싱 도서관 건축을 위한 상세한 프로토콜을 보여 줍니다.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria는 다양 한 생물 학적 연구에에서 사용할 수 있는 공장 설비 재료의 귀중 한 소스. 표 본관 표본을 사용 하 여 샘플 보존 품질, 성능이 저하 된 DNA 및 희귀 표본의 파괴적인 샘플링을 포함 하 여 과제의 번호와 연결 됩니다. 큰 시퀀싱 프로젝트에서 식물 표본 상자 물자를 더 효과적으로 사용 하려면 DNA 고립과 라이브러리 준비는 신뢰할만 하 고 확장 가능한 방법 필요 합니다. 이 종이 DNA 분리 및 높은 처리량 도서관 건설 표 본관 표본에서 개별 샘플에 대 한 수정 요구 하지 않는 대 한 강력 하 고, 시작-투-엔드 프로토콜을 보여 줍니다. 이 프로토콜은 기존 방법의 낮은 질 건조 식물 재료와 소요 장점에 대 한 최적화, 조직 분쇄 라이브러리 크기 선택, 수정 하 고 낮은 수율 라이브러리에 대 한 선택적 reamplification 단계를 도입 하 여 지어진 다. 낮은 수익률 DNA 라이브러리의 reamplification 샘플 인지할 시퀀싱 바이어스 공통에 대 한 소개 없이 추가 파괴적인 샘플링에 대 한 필요성을 negating 대신할 및 잠재적으로 귀중 한 식물 표본 상자 견본에서 파생 된 구조 수 있습니다. 계통 발생 응용 프로그램입니다. 프로토콜 잔디 종, 수백에서 테스트 되었습니다 하지만 확인 후 다른 식물 계보에 사용 하기 위해 적응 될 것으로 예상 된다. 이 프로토콜 어디 조각 원하는 크기로 범위에 존재 하지 않는, 매우 저하 DNA와 보조 metabolites 일부 공장 설비 재료에 깨끗 한 DNA 분리를 억제 하는 제한 될 수 있습니다. 전반적으로,이 프로토콜 DNA 분리 및 활성 실습 시간 최소한의 수정만 8 h 13 h 24 샘플 라이브러리 준비 수 신속 하 고 포괄적인 방법을 소개 합니다.

Introduction

표 본관 컬렉션은 종 및 계통학1,2,3, 인구 유전학4,5, 보존을 포함 하 여 연구에 대 한 게놈 다양성의 잠재적으로 귀중 한 소스 생물학6, 침략 적인 종의 생물학7, 그리고 특성 진화8. 다양 한 종, 인구, 지리적 위치, 및 시간 포인트를 얻을 수 있는 식물 표본 상자 "보물 상자"9 를 강조 표시 합니다. 역사적으로, 표 본관 파생 DNA의 저하 자연 PCR 기반 프로젝트, 종종 높은 복사, 엽록체 게놈 또는 ribosomal의 내부 베낀된 스페이서 (ITS)의 지역 등에 마커를 사용 하 여 연구자를 일하고 방해 했다 RNA입니다. 표본 및 DNA의 품질 보존9,10, 더블-좌초 나누기와 손상의 가장 흔한 형태 되 고, 건조 과정에서 사용 되는 열에서 조각화의 방법에 광범위 하 게 따라 다는 소위 90 %DNA 잠금 업 된 PCR 기반 연구11지 장 있다. 조각화, 외 표 본관 유전체학에서 두 번째로 가장 널리 퍼진 문제는 오염, 그13 endophytic 균 류 파생 된 또는 수집 후 하지만 그래도 표 본관12에 장착 하기 전에 곰 팡이 사후 인수 이 문제 해결된 bioinformatically 바로 곰 팡이 데이터베이스 (아래 참조) 제공 될 수 있습니다. 세 번째, 및 보다 적게 일반적인 문제는 비록 표 본관 표본11(~ 0.03%) 낮은 것으로 추정 된다 시 토 신 탈 (C/G→T/A)14, 통해 시퀀스 수정 이다. 높은 처리량 시퀀싱 (HTS)의 출현, 조각의 문제는 짧은 읽기 및 시퀀싱 깊이12,15, 낮은 질을 가진 수많은 표본에서 게놈 수준의 데이터 수집을 허용으로 극복할 수 있습니다. DNA, 그리고 때로는 심지어 전체 게놈 시퀀싱15허용.

식물 표본 상자 견본 더 자주 사용 되 고 있으며 계통 발생 프로젝트16의 큰 구성 요소. HTS에 대 한 식물 표본 상자 견본을 사용 하 여 현재 도전 개인에 대 한 메서드를 최적화 하지 않고도 충분 한 더블 좌초 DNA 시퀀싱 프로토콜에 대 한 필요한 필수 적절 한 시기에 수많은 종에서 얻는 지속적으로 표본입니다. 이 논문에서는, DNA 추출 및 표 본관 표본 라이브러리 준비에 대 한 프로토콜을 기존의 방법의 활용 및 결과 신속 하 고 복제할 수 있도록 그들을 수정 시연입니다. 이 방법은 완전 한 13 h 8 h 실습 시간, 또는 9 h 실습 시간 때 옵션 reamplification 단계는 필요와 함께 16 h 24 샘플 라이브러리에 견본에서 처리 수 있습니다. 더 많은 샘플의 동시 처리는 달성, 비록 제한 요소는 원심 분리기 용량 및 기술. 프로토콜은 DNA를 전단에 대 한만 전형적인 실험실 장비 (thermocycler, 원심 분리기, 마그네틱 스탠드) 대신 분무기 또는 sonicator, 특수 장비를 요구 하도록 설계 되었습니다.

DNA 품질, 조각 크기 및 수량 표 본관 표본 높은 처리량 시퀀싱 실험에서의 사용에 대 한 요인 제한. 식물 표본 상자 DNA를 분리 하 고 높은 처리량 시퀀싱 라이브러리를 만들기 위한 다른 방법을 10 만큼 약간을 사용 하 여 유틸리티를 증명 하고있다 ng의 DNA16; 그러나 라이브러리 준비에 필요한 사이클 그들은 실험적으로 PCR의 최적 수를 결정 해야 합니다. 이것은 된다 허무 다루는 상당히 적은 양의 가능한 더블 좌초 DNA (dsDNA) 때 일부 표 본관 표본 단일 라이브러리 준비에 대 한 충분 한 DNA를 생산. 여기에 제시 된 방법 아무 DNA 라이브러리 최적화 단계에서 분실 된다 그래서 샘플 품질에 사이클의 단일 번호를 사용 합니다. 대신, reamplification 단계 라이브러리 시퀀싱에 필요한 최소 금액을 충족 하지 않는 경우 호출 됩니다. 많은 식물 표본 상자 견본 드물다 고 많은 경우에 파괴적인 샘플링을 정당화 하기 어려운 작은 재료를가지고. 이 카운터, 제시 프로토콜 허용 dsDNA 입력 크기 미만 1.25 ng 도서관 준비 과정, 높은 처리량 시퀀싱 및 표본의 파괴적인 샘플링에 대 한 필요를 최소화에 대 한 실행 가능한 샘플의 범위를 확대.

다음 프로토콜 잔디에 최적화 되었고 비록 우리가 기대 하는 다른 많은 식물 그룹에 프로토콜을 적용할 수 있는 식물 표본 상자 견본에서 다른 종의 수백에 테스트. 그것은 낮은 품질 및 희귀 표본 저장 하는 데 사용할 수 있는 선택적 복구 단계를 포함 합니다. 이상 2 백 표 본관 표본 테스트에 따라,이 프로토콜 표본 낮은 조직 입력 및 품질, 최소한의 파괴적인 샘플링을 통해 희귀 한 표본의 보존에 대 한 허용에 작동 합니다. 여기이 프로토콜 phylogenomics 기반 프로젝트에 대 한 시퀀싱 할 수 있는 높은 품질 라이브러리를 제공할 수 있습니다 표시 됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 시작 하기 전에

  1. 신선한 cetyl trimethylammonium 브 로마 이드 (CTAB) 버퍼17 CTAB, polyvinylpyrrolidone (PVP) 40, 100.0 mL 1 M 트리 스 8.0, 0.5 M ethylenediaminetetraacetic 산 (EDTA) pH 8.0 280.0 mL 40 mL의 pH 5의 10 g의 20 g을 추가 하 여 확인 M NaCl, 그리고 시 약 물 400.0 mL 함께, 물 1 l 시 약-등급을 사용 하 여 전체 볼륨을가지고. PH 8.0에 조정 합니다.
    참고: 추가 시 약 수에 추가 될 CTAB 개별 taxa에 보조 화합물에 따라. 알 렌 그 외 참조 18 첨가제 시 약의 철저 한 목록에 대 한.
  2. β-mercaptoethanol CTAB 버퍼의 5 mL 당 10 µ L를 추가 합니다.
    참고:이 수 수 50 mL의 일괄에서 준비 및 3-4 주 동안 실내 온도에 저장.
    1. 65 ° C 물 욕조에 CTAB 솔루션을 열.
  3. 박격포와 적어도 20 분 동안-20 ° C에 pestles 진정.
  4. N 2 mL 튜브 x 2의 4 세트를 레이블 (여기서 n = 샘플의 수). 얼음에 레이블이 튜브의 1 세트를 넣어.
  5. 소 프로 파 놀 얼음에 또는-20 ° C 냉장고에 침착 해.
  6. 단단한 단계의 가역 immobilization (SPRI) 구슬 ( 재료의 표참조), 냉장고에서 제거 하 고 실내 온도 (적어도 30 분)에 equilibrate 수 있도록.
  7. 80% 에탄올을 준비 합니다.
  8. 표 본관 표본 추출에 대 한 선택 하 고 ~ 1 cm2또는 10 mg, 견본, 잎 소재 선호 당 조직의 검색.

2. DNA 추출

  1. 갈아 ~ 1 cm2 미리 표 본관 조직 prechilled 박격포 및 pestles를 사용 하 여. 액체 질소와 30-50 밀리 그램 소독 모래를 추가 합니다. 조직 미세 분말으로 변할 때까지 갈아.
    참고: 10 밀리 그램 또는 더 많은 조직이 바람직합니다, 하지만 덜 또한 경우에 따라 왔다. 액체 질소의 증발, 일단 조직을 완전히 접지 될 때까지 필요에 따라 더 추가 합니다. 세포 및 조직에 대 한 또 다른 일반적인 방법은 비드 때리는의 사용 이다. 그러나,이 방법은이 실험에 사용 된 견본을 위해 잘 작동 하지 발견 됐다.
  2. (더 이상 튜브의 볼륨의 절반을 추가) 하는 두 2 mL 튜브 냉동된 분말을 전송 합니다. 각 관에 따뜻한 CTAB 솔루션의 600 µ L을 추가 하 고 철저 하 게 역전과 vortexing에 의해 튜브를 혼합.
    참고: 이후 식물 표본 상자 물자의 품질과 수량 종종 낮은, 높은 수익률을 얻을 수 있습니다 두 번 반복에 DNA 격리를 수행.
  3. 1-1.5 h, vortexing 매 15 분을 위한 65 ° C 물 욕조에 샘플을 품 어.
  4. 5 분에 대 한 10000 x g에서 원심 분리기 샘플 분류 관 (~ 500 µ L)의 신선한 세트는 상쾌한 전송. 펠 릿 표준 비 염화 처리 절차를 사용 하 여 삭제 합니다.
  5. 각 관에 RNase A (10 mg/mL)의 4 µ L을 추가 하 고 반전 또는 pipetting으로 혼합. 15 분 동안 열 블록 또는 물 목욕에서 37 ° C에서 샘플을 품 어.
  6. 튜브에는 실내 온도 도달 했습니다 일단 25:24:1 페 놀: 클로 프롬: isoamyl 알콜 혼합물의 동일한 볼륨 (~ 500 µ L)를 추가 합니다. 믹스 철저 하 게 아래로 pipetting으로 그리고/또한 반전. 12000 x g 15 분에서 튜브의 신선한 세트를 수성 층 (상위 계층)을 전송 하는 원심 분리기 튜브 (~ 400 µ L) 표시. 염화 폐기물 컨테이너에 유기 레이어를 삭제 합니다.
    참고: 단계 2.6 반복 될 수 있습니다 보조 화합물의 대량으로 예상 되는 경우에 나무 재질.
  7. 24:1 클로 프롬: isoamyl 알콜 혼합물의 동일한 볼륨 (~ 400 µ L)를 추가 합니다. 믹스 철저 하 게 아래로 pipetting으로 그리고/또한 반전. 원심에서 12000 x g 15 분 전송에 대 한 튜브 prechilled, 레이블 튜브 (~ 300 µ L)의 신선한 세트를 수성 층 (상위 계층). 염화 폐기물 컨테이너에 유기 레이어를 삭제 합니다.
  8. 각 튜브를 prechilled 소 프로 파 놀과 아세트산 나트륨 2.5 M의 12 µ L의 동일한 볼륨 (~ 300 µ L)를 추가 합니다. 30-60 분 동안-20 ° C에서 샘플을 품 어.
    참고: 보육 시간 (야간 보육)까지 확장 될 수 있습니다 하지만 DNA 품질 샘플 품 어 더 이상 줄일 것 이다.
  9. 냉장고와 12000 x g 15 분에서 튜브를 제거 하 고는 펠 렛을 방해 하지 않고 부드럽게는 상쾌한 삭제 원심 분리기 샘플을 가져가 라. 신선한 70% 에탄올 (약 300-500 µ L)으로 서 스 펜 션으로 펠 릿을 세척. 각 배 샘플에 대 한 에탄올을 동반 하나에 두 개의 개별 펠 릿을 통합 합니다.
    참고: 샘플 먼저 에탄올을 사용 하 여 하나의 관으로 통합 해야 하 고 진행. 에탄올과 각 샘플을 따로 세척 필요는 없습니다.
  10. 12000 x g 10 분 제거에서 튜브 원심 고는 펠 렛을 방해 하지 않고 부드럽게는 상쾌한 삭제. 공기 건조는 펠 릿.
    참고: 샘플 수 건조 빨리 건조 열 블록을 사용 하 여 (65 ° C를 초과 하지 않는). 샘플-건조 하지 않는 다는 것을 확인,이 DNA의 최종 수익률을 줄일 수 있다.
  11. 1 x 테의 50 µ L에서 고립 된 DNA를 일시 중단 합니다. 장기 저장을 위한-20 ° C 냉동 고 또는 다음 주에 사용 하기 위해 4 ° C에 저장 합니다.

3입니다. 품질 관리 (QC)

  1. 품질 검사는 agarose 젤을 실행 합니다.
    1. 시 약 급료 물을 사용 하 여 5 l 총 볼륨을 데리고 disodium 소금 54 g 트리 스 베이스, 27.5 g 붕 소 산, 그리고 3.75 g EDTA를 추가 하 여 1 x 트리/Borate/EDTA (TBE) 버퍼를 준비 합니다.
    2. 1의 100 mL를 1 g agarose를 추가 하 여 1 %agarose 젤 준비 x TBE. 아무 agarose 표시 될 때까지 솔루션을 전자 레인지. 0.01% 핵 산 젤 추가 얼룩 ( 재료의 표참조). 그것은 터치에 따뜻한 때까지 플라스 크 쿨을 하자. 교 반에 의해 잘 혼합. Agarose 젤 트레이에 부 어 하 고 그것은 굳은 때까지 앉아 보자.
    3. 샘플의 3 µ L, 시 약 급료 물, 2 µ L 및 염료 로드 x 6의 1 µ L를 혼합. 그들의 순서를 지적 하는 젤 매트릭스에 샘플을 로드 합니다.
    4. 60-70 분에 대 한 샘플에서 실행 60-70 대 이미지 아래 자외선 젤 정확한 노출과 초점.
      얼룩은 일반적으로 DNA 저하를 표시 하는 동안 참고: 분명 높은 분자량 밴드의 존재, 고품질 DNA의 표시 이다. 대부분 표 본관 표본 저하 됩니다.
  2. 실행 dsDNA의 부 량 분석 (재료의 표 참조) 더블의 수량을 결정 하는 DNA를 좌초.
    1. 샘플의 2 µ L를 사용 하 여 분석을 위해.
      참고: 희석 필요 하지 않습니다 식물 표본 상자 물자의 정량화 분석을 위해 그들은 최소한의 금액에 있을 하는 경향이. 이 단계에서 작은 1.26 ng 총 dsDNA에서 성공적인 라이브러리 만들어졌다.

4입니다. DNA 전단

참고: 이것은 상업적인 더블-좌초 fragmentase의 최적화 된 버전 프로토콜 ( 재료의 표참조).

  1. 얼음 3는 vortexing 후에 장소 dsDNA 조각화 효소 s.
  2. 살 균 0.2 mL 중 합 효소 연쇄 반응 (PCR) 튜브, 믹스 1-16 µ L 조각화 반응 버퍼의 2 µ L로 DNA를 고립. Nuclease 무료 수를 추가 하 여 총 볼륨 18 µ L을가지고. 추가 dsDNA 조각화 효소와 소용돌이 3 혼합물의 2 µ L s.
    참고: 필요한 DNA의 양은 DNA 농도 (200 ng 총 튜브에 대 한 목표)에 따라 다릅니다.
  3. 8.5 분 동안 37 ° C에서 샘플을 품 어. 튜브에 0.5 M EDTA의 5 µ L를 추가 합니다.
    참고:이 단계 마자 잠복기 동안 반응 종료-전단에서 DNA 샘플을 방지를 수행 해야 합니다.

5. 비드 정리

  1. SPRI 구슬 vortexing에 의해 균질.
  2. Nuclease 무료 물 25 µ L을 추가 하 여 50 µ L을 깎인된 DNA의 총 볼륨을 가져와. 깎인 DNA와 섞어 50 µ L를 45 µ L 실내 온도 SPRI 구슬 (90% 볼륨)의 추가 철저 하 게 아래로 pipetting으로 합니다.
    참고: 전체 샘플 볼륨의 90%에서 구슬을 추가 200 기본 쌍 아래 종종 DNA 파편의 작은 제거 수행 됩니다.
  3. 샘플 5 분 자기 접시에 튜브를 넣어 하 고 신중 하 게 5 분 동안 앉아 그들을 품 어 보자 제거와 삭제는 상쾌한.
    참고: 수 그들은 원하는 DNA 표적을 포함 구슬, 방해 하지 않도록 주의 하십시오.
  4. 마그네틱 스탠드에 튜브를 신선한 80% 에탄올의 200 µ L를 추가 합니다. 30 실 온에서 품 어 s 다음 신중 하 게 제거 하 고 삭제는 상쾌한. 일단이 단계를 반복 합니다. 공기 튜브의 뚜껑을 열어 마그네틱 스탠드에는 5 분 동안 구슬 건조.
    참고:-비즈를 건조 하지 마십시오. 이 DNA의 낮은 복구 될 수 있습니다.
  5. 자석에서 튜브를 제거 합니다. 구슬에서 DNA의 0.1 x TE 55 µ L에 elute 고 아래로 pipetting으로 철저 하 게 혼합. 마그네틱 스탠드에 5 분 장소 튜브에 대 한 실 온에서 품 어와 솔루션을 위한 대기 (~ 2 분) 합니다.
  6. 상쾌한의 52 µ L 해 내. 복구 및 라이브러리 준비에 들어가는 초기 농도 확인 하는 샘플에서 DNA 정량화 분석을 실행 합니다.
    참고: 라이브러리 만들어진 총 dsDNA 1.25 미만 추정으로 ng, 그러나 각 케이스 reamplification에 필요 했다.

6. 라이브러리 준비

참고: 이것은 상업적으로 사용 가능한 라이브러리 키트의 수정된 된 버전 ( 재료의 테이블 프로토콜 참조).

  1. 최종 준비
    1. Endonuclease 및 인산 효소, 미행 3 µ L 및 청소, 전단 DNA의 50 µ L를 반응 버퍼의 7 µ L를 추가 합니다. 아래로 pipetting으로 철저 하 게 혼합. 거품을 제거 하는 튜브를 회전 합니다.
      참고: 총 볼륨 60 µ L 이어야 한다.
    2. 다음 프로그램 thermocycler 샘플 배치: 20 ° C, 65 ° C에서 30 분에서 30 분 후 4 ° c.에서 개최
      참고: 온수 뚜껑 ≥75 ° C로 설정 했다
  2. 어댑터 결 찰
    1. 어댑터 25-50 배 희석 (작업 어댑터 농도 0.6-0.3 µ M). 튜브를 결 찰 마스터 믹스의 30 µ L, 1 µ L의 결 찰 증강, 및 높은 처리량 짧은 읽기 시퀀싱에 대 한 어댑터의 2.5 µ L를 추가 합니다.
      참고: 총 볼륨 93.5 µ L 이어야 한다.
    2. 아래로 pipetting으로 철저 하 게 혼합. 거품을 제거 하는 튜브를 회전 합니다. 15 분 동안 20 ° C에서 튜브를 품 어.
    3. 3 µ L uracil DNA glycosylase (UDG)와 DNA glycosylase lyase Endonuclease VIII의 상업 혼합물의 추가 ( 재료의 표참조) 관에. 총 볼륨 96.5 인지 확인 µ L. 철저 하 게 혼합 그리고 thermocycler는을 사용 하 여 15 분 동안 37 ° C에서 품 어.
      참고: 뚜껑은 ≥47 ° c.로 설정 되어야 합니다. 원래 버전의 상용 프로토콜 어댑터 결 찰 단계, 마지막 단계로 구슬 정리 뒤 후 크기 선택이 있다. 높은 수익률을 달성,이 프로토콜의 이러한 단계는 순서를 전환 하 고 마지막 단계로 크기 선택을 구현 합니다.
  3. 효소와 작은 조각을 제거 하는 정리
    1. Vortexing에 의해 자석 구슬 균질.
    2. SPRI 자석 구슬 (80% 볼륨)의 78 µ L을 추가 하 고 아래로 pipetting으로 철저 하 게 혼합.
      참고: 전체 샘플 볼륨의 80%에 구슬을 추가 250 기본 쌍 보다는 작은 DNA 조각을 제거 수행 됩니다. 작은 DNA 파편의 더 엄격한 제거 (i) 잉여 어댑터를 제거 하 고 (ii) 다음 단계에서 더 큰 파편의 확대를 강조 하는 것입니다.
    3. 샘플 5 분 넣어 5 분에 대 한 자기 접시에 튜브는 신중 하 게 제거 하 고 원하는 크기 범위 밖에 DNA를 포함 하는 상쾌한 삭제에 대 한 품 어 보자.
      참고: 수 원하는 DNA 목표를 포함 하는 비즈를 방해 하지 않도록 주의 하십시오.
    4. 마그네틱 스탠드에 튜브를 신선한 80% 에탄올의 200 µ L를 추가 합니다. 30 실 온에서 품 어 s 다음 신중 하 게 제거 하 고 삭제는 상쾌한. 일단이 단계를 반복 합니다. 공기 튜브 뚜껑 오픈 마그네틱 스탠드에는 5 분 동안 구슬 건조.
      참고: 구슬 건조 이상 하지 마십시오. 이 DNA의 낮은 복구 될 수 있습니다.
    5. 자석에서 튜브를 제거 합니다. 0.1 x TE의 17 µ L을 추가 하 여 구슬에서 DNA 대상 elute 고 아래로 pipetting으로 철저 하 게 혼합.
    6. 마그네틱 스탠드에 5 분 장소 튜브에 대 한 실 온에서 품 어와 솔루션을 위한 대기 (~ 2 분) 합니다.
    7. 15 µ L는 상쾌한의 해 내.
  4. PCR 증폭
    1. 청소 어댑터 출혈 DNA의 15 µ L를 높은 충실도 PCR 마스터 믹스의 25 µ L, 5 µ L의 높은 처리량 짧은 읽기 라이브러리 준비 5' 뇌관, 시퀀싱 및 높은 처리량 짧은 읽기 시퀀싱 라이브러리 준비 3' 뇌관의 5 µ L를 추가 합니다.
      참고: 총 볼륨 50 µ L 이어야 한다입니다.
    2. Vortexing에 의해 잘 혼합. 표 1에 있는 설정을 사용 하 여 thermocycler 샘플 장소: Thermocycler 증폭 설정.
      참고: 많은 사이클 입력된 DNA의 낮은 수량에 따라 필요 합니다.
사이클 단계 임시입니다. 시간 사이클
초기 변성 98 ° C 30 s 1
변성 98 ° C 10 s 12
어 닐 링/확장 65 ° C 75 s 12
마지막 확장 65 ° C 5 분 1
보류 4 ° C

표 1: PCR 프로토콜 변성, 어 닐 링, 및 확장 시간 및 온도. 온도 및 시간 시 약이이 프로토콜에 대 한 최적화 했다. 경우에 변경 되는 시 약, 온도 시간 최적화 되어야 합니다 다시.

  1. 원하는 라이브러리 크기에 대 한 크기 선택
    참고:이 구슬 단계 파편 위에 대상 범위를 제거 합니다.
    1. SPRI 구슬 vortexing에 의해 균질.
    2. 실내 온도 자석 구슬의 25 µ L (50% 볼륨)을 추가 하 고 아래로 pipetting으로 철저 하 게 혼합. 샘플 5 분 자기 접시에 튜브를 넣어 하 고 신중 하 게 5 분 동안 앉아 그들을 품 어 보자 제거 하 고 레이블이 튜브의 새로운 세트에는 상쾌한 전송.
      참고:이 볼륨 조정할 수 있습니다 원하는 라이브러리 크기에 따라. 상쾌한 원하는 크기의 DNA 파편을 포함 되어 있습니다. 첫 번째 구슬 외피에 구슬 큰 도서관 파편 바인딩 됩니다. 이 400-600 기본 쌍 범위에서에 초점을 제거 됩니다. 상쾌한 작은 조각을 포함합니다.
    3. 추가할 실내 온도 SPRI 구슬의 6 µ L 상쾌한 및 혼합 철저 하 게 아래로 pipetting으로. 샘플 5 분 자기 접시에 튜브를 넣어 하 고 5 분 동안 앉아 그들을 품 어 보자.
      참고:이 볼륨 조정할 수 있습니다 단계 6.5.2 따라 원하는 라이브러리 크기에 따라.
    4. 조심 스럽게 제거 하 고 삭제는 상쾌한.
      참고: 수 원하는 DNA를 포함 하는 비즈를 방해 하지 않도록 주의 하십시오. 두 번째 구슬 외피에 구슬은 왼쪽 후 큰 DNA의 초기 제거 파편 조각에 바인딩 됩니다. 파편의이 세트는 일반적으로 원하는 크기 범위에서.
    5. 마그네틱 스탠드에 튜브를 신선한 80% 에탄올의 200 µ L를 추가 합니다. 30 실 온에서 품 어 s, 다음 신중 하 게 제거 하 고 삭제는 상쾌한. 반복 합니다. 공기 튜브 뚜껑 오픈 마그네틱 스탠드에는 5 분 동안 구슬 건조.
      참고:-비즈를 건조 하지 마십시오. 이 DNA의 낮은 복구 될 수 있습니다.
    6. 자석에서 튜브를 제거 합니다. 0.1 x TE의 33 µ L에 구슬에서 DNA 대상 elute 고 아래로 pipetting으로 철저 하 게 혼합.
    7. 마그네틱 스탠드에 5 분 장소 튜브에 대 한 실 온에서 품 어와 솔루션을 위한 대기 (~ 2 분) 합니다. 저장용 2 mL 튜브 ( 재료의 표참조)을 전송 하 고 상쾌한의 30 µ L 해 내.
      참고: 라이브러리 장기 저장을 위한-20 ˚C에 보관 될 수 있습니다.
  2. 품질 관리
    1. DNA 라이브러리에 품질 관리 테스트를 실행 합니다. 3.1 및 3.2 단계를 참조 하십시오.
      참고: DNA 라이브러리 96 V에서 젤 ~ 45 분를 실행합니다.
  3. Reamplification 라이브러리: 라이브러리 수량 충분 한 경우.
    참고: 샘플 10 아래 라이브러리 농도와 nM는 다음 단계를 사용 하 여 reamplified 수 있습니다. 낮은 농도 라이브러리의 reamplification 시퀀싱, 실행 가능한 결과 얻을 수 있습니다. 하지만 수집 데이터 (표 3)는 것이 좋습니다이 특정 통계에 대 한 무시할 수 있지만 reamplification 기본 구성 다양성에 겸손 한 변화를 발생할 수 있습니다. .
    1. 10 배 0.1 x TE를 사용 하 여 범용 reamplification 뇌관을 희석.
    2. 낮은 농도 라이브러리의 15 µ L를 높은 충실도 PCR 마스터 믹스의 25 µ L, 희석된 보편적인 reamplification 뇌관 1 (AATGATACGGCGACCACCGA)의 5 µ L와 희석된 보편적인 reamplification 뇌관 2 (CAAGCAGAAGACGGCATACGA)의 5 µ L를 추가 합니다. 참고: 총 볼륨은 50 µ L에 있어야 합니다.
    3. Vortexing에 의해 잘 혼합. 표 1에 있는 설정을 사용 하 여 thermocycler 샘플 장소: Thermocycler 증폭 설정
      참고: 사이클의 다 수 입력된 DNA의 낮은 양 때문에 필요 합니다.
    4. 비드 정리
    5. SPRI 구슬 vortexing에 의해 균질. 실내 온도 SPRI 구슬 (90% 볼륨)의 45 µ L을 추가 하 고 아래로 pipetting으로 철저 하 게 혼합.
    6. 5 분 자기 접시에 튜브를 넣어 5 분에 대 한 품 어 샘플을 보자.
    7. 조심 스럽게 제거 하 고 원치 않는 DNA를 포함 하는 상쾌한 삭제.
      참고: 수 원하는 DNA 목표를 포함 하는 비즈를 방해 하지 않도록 주의 하십시오.
    8. 마그네틱 스탠드에 튜브를 신선한 80% 에탄올의 200 µ L를 추가 합니다. 30 실 온에서 품 어 s, 다음 신중 하 게 제거 하 고 삭제는 상쾌한. 일단이 단계를 반복 합니다.
    9. 공기 튜브의 뚜껑을 열어 마그네틱 스탠드에는 5 분 동안 구슬 건조.
      참고:-비즈를 건조 하지 마십시오. 이 DNA 대상의 낮은 복구 될 수 있습니다.
    10. 자석에서 튜브를 제거 합니다. 0.1 x TE의 33 µ L에 구슬에서 DNA 대상 elute 고 아래로 pipetting으로 철저 하 게 혼합.
    11. 마그네틱 스탠드에 5 분 장소 튜브에 대 한 실 온에서 품 어와 솔루션을 위한 대기 (~ 2 분) 합니다.
    12. 상쾌한의 30 µ L 해 내. 장기 저장을 위한-20 ° C에서 라이브러리를 저장할 수 있습니다.
  4. 품질 관리
    1. DNA 라이브러리에 품질 관리 테스트를 실행 합니다. 3.1 및 3.2 단계를 참조 하십시오. DNA 라이브러리에 대 한 96 V에서 젤 ~ 45 분를 실행 합니다.
      참고: 이중 밴드 젤에 볼 경우 이것은 가능성이 reamplification 단계에서 뇌관 고갈의 결과. 밴드는 6.9, 반복 하지만 표 1에서 묘사 된 PCR 프로그램에서 단 하나의 사이클을 사용 하 여 제거할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA 분리 및 최종 라이브러리 수율
본이 연구에서는 표 본관 DNA의 고립과 고품질 시퀀싱 라이브러리의 복구에 대 한 프로토콜의 효능은 50 다른 샘플을 사용 하 여 1920 년에서 가장 오래 된와 2012 (표 2)에서 최 연소 시연 했다. 각 샘플에 대 한 약 10 mg의 잎 조직 DNA 격리 사용 되었다. 가능한 경우, 녹색 잎 조직이 선호 했다 그리고 확실 한 곰 팡이 오염 없는 조직 선정 되었다. 성공적인 격리 만들 수 있습니다 노란색 또는 갈색 조직를 사용 하 여 비록 낮은 수익률을 예상 한다. 이중 총 3.56에서 ranged 초기 격리에서 DNA (dsDNA) 좌초 2610에 ng ng. 예상 했던 대로, 표 본관 표본에서 얻은 DNA 매우 저하 했다 (그림 1A, Supplemental 그림 1). 이러한 격리의 일부 효소 전단 (1.26-464 ng) 사용 되었다. 식물 표본 상자 DNA 보존 과정을 통해 이미 전단은, 비록 프로토콜의 최적화 전체 라이브러리 수율을 향상 시키기 위해 추가 전단 필요 합니다. DsDNA 후 전단의 총 복구에서 ranged < 1% ~ 51% 미만 1.25의 최소 결과 입력된 dsDNA의 DNA 도서관 준비 및 328의 최대 시작의 ng ng. 일부 샘플에 DNA의 극단적인 손실 효소 전단 (그림 1A, 보충 그림 1) 전에 DNA의 대부분의 이미 작은 조각 크기를 지정할 수 있습니다. 깎인된 DNA에 90% 볼륨 비드 정리를 사용 하 여 의도적으로 더 큰, 더 바람직한 조각 크기에 대 한 풍부 하 게 DNA의 작은 파편 제거. 이 작은 조각 100 기본적인 쌍 마크 (그림 1A)에 강렬한 신호에 의해 표시 된 대로 샘플 TK463, TK657, 및 TK694에서 특히 본 했다.

라이브러리 게시물 크기 선택의 총 수량 1.425에서 ranged 942.5에 ng ng (보충 표 1, 표 2). 샘플의 23에 대 한 초기 추출 및 라이브러리 준비 양보를 하지 않았다 라이브러리의 적절 한 금액 (< 10 nM; 표 2, 표 1 보충), 그래서 이러한 샘플 프로토콜의 reamplification 및 복구 단계를 복종 되었다 14-680 x 결과 총 라이브러리 (보충 표 1, 표 2)에 증가. 최종 라이브러리 ( Supplemental 그림 2,그림 1B) 350, 500 기본 쌍 사이의 대역에서 결과. 때때로, 예상된 라이브러리 크기 보다 큰 두 번째 밴드 보였다 (그림 1B, Supplemental 그림 2). 이 때 reamplification PCR 사용할 수 뇌관을 소진 하 고 어 닐 링 비 동종 DNA 파편의 라이브러리 어댑터 시작 발생 했습니다. 이렇게 하면 끝 (어댑터) 제대로 단련 했다, 그러나 DNA 삽입 하지 않았다 분자를 만들어집니다. 젤 매트릭스를 통해 더 느리게 이동이 "버블링 된" 분자에는 젤 큰 등장 합니다. 이 어 닐 링 오류는 이미 reamplified 라이브러리에서 다른 reamplification 반응 준비 단일 사이클에 대 한 그것을 실행 하 여 고정 했다. 이 단일 사이클 적절 한 어 닐 링 및 증폭, 두 번째 밴드 (보충 그림 3) 제거를 위한 뇌관을 제공.

적어도 10의 최종 라이브러리 농도 촉진 하는 라이브러리의 reamplification nM. 이 농도 몰에서 풀링된 동일한 표현, 불평등 샘플 품질 발현 이라고 하는 문제를 부정 하 고 시퀀싱 라이브러리 수율을 같게 하기 위하여 희석 라이브러리 허용. 프로젝트의 목표는 엽록체 게놈 시퀀싱 시퀀싱의 총 금액은 다른 혈통으로 달라 집니다 필요 그리고 조직 엽록체 DNA19에서 시작 된 읽기의 총 %에서 다. 일반적으로, 엽록체 게놈의 예상된 범위 x 50-100 어셈블리에 대 한 충분 한 이며 시퀀싱 실행 종 및 시퀀싱 방법에 따라 최대 70 개인을 포함 하도록 풀링된 수 있습니다.

오염, 바이어스 및 Reamplification으로 인 한 변화에 대 한 테스트
HTS 시퀀싱에 대 한 주목할 만한 관심사는 광범위 한 PCR 증폭20를 통해 라이브러리에 바이어스의 소개입니다. Reamplification의 효과 테스트 하 고 식물 표본 상자 물자의 잠재적인 바이어스 공통 계통 발생 응용 프로그램을 식별, 우리는 성공적으로 시퀀스 된 라이브러리 (TK686) 같은 라이브러리 희석 1: 5와 reamplified (지정 된 TK686-R) 비교. 둘 다 TK686와 TK686-R 각각 일리노이의 대학으로이 J. 카 버 생명 공학 센터와 미시간 주립 대학 연구 기술 지원 시설, Illumina HiSeq4000에서 시퀀싱 했다, ( 를 참조 하십시오 읽고 짝된 끝 150 기본적인 쌍을 사용 하 여 표 3 시퀀싱 세부 사항을 위해). 원시 읽기 NCBI SRA (SRP128083)에 입금 되어 있다. 읽기 Trimmomatic v.0.3621 코 어댑터 시퀀스, 품질 슬라이딩 윈도우, 10 기본적인 쌍에 대 한 20의 평균 phred 점수에 대 한 필터링을 사용 하 여 어댑터 트리밍 등을 사용 하 여 청소 했다 고 최소 40 기본적인 쌍의 크기를 잘라. 표 본관 표본과 주요 문제 중 하나는 곰 팡이 오염, 오염 JGI MycoCosm 균 게놈 데이터베이스22 (312 핵 게놈 및 79 미토 콘 드리 아 게놈) 부분에 대 한 읽기를 매핑하여 추정 되었다 bowtie2 v를 사용 하 여 . 2.2.923 "매우 민감한 지역" 매개 변수 집합을 사용 하 여. TK686 및 TK686-R 라이브러리 핵 균 오염에서 구별할 수 없었다 (9.24%, 9.68%, 각각)와 미토 콘 드리 아 곰 팡이 오염 (0.94%와 0.8%) (표 3)입니다. 하지만이 단지 하나의 예를 들어, 그것은 않는 것이 좋습니다 표 본관 샘플의 곰 팡이 오염 무시할 수는 표 본관 파생 시퀀스 데이터를 사용 하 여 이전에 제거 되어야 한다. 데이터베이스 및 식별 하 고 곰 팡이 오염 제거 하는 데 사용 하는 명령을 M. R. McKain GitHub 저장소 표 본관 유전체학24에서 찾을 수 있습니다.

엽록체 게놈 시퀀싱은 일반적으로 계통 발생 분석, 사용 그리고 표 본관 표본 점점 소스 재료12로 사용 됩니다. 엽록체 게놈 어셈블리에 reamplification의 품질을 테스트 하려면 TK686 및 TK686-R 엽록체 게놈 bowtie 인덱스 Poales로 설정 된 기본 설정 아래에서 빠른 성형 v.1.2.525 를 사용 하 여 조립 했다. TK686-R에 대 한 전체 엽록체 게놈 얻은 하지만 TK686 엽록체 게놈 7 contigs 낮은 읽기 깊이 때문에 조립 되었다. TK686 contigs McKain 외. 수동으로 다음 조립 했다 26 완벽 하 게 조립된 엽록체 게놈 GUI 기반 정렬 소프트웨어에 서로 게 맞추어 졌다 ( 재료의 표참조) 어셈블리 사이의 변화를 평가 했다. 총 12 Snp와 하나의 indel 엽록체 어셈블리 TK686와 TK686. 사이 발견 했다 각 변형에 대 한 범위는 TK686와 TK686.에서 읽기 세트에 평가 되었다 모든 경우에, 가장 일반적인 이체는 두 개의 라이브러리 간에 동일 했다. TK686 시연 한 T→C, 한 G→A, 1 G→T, 1 G→-, 한 C→A, 한 T→A, 및 4 C→A 이체. 이 이체의 5를 어셈블리에 그들의 법인 시퀀싱 오류 및 낮은 전반적인 검사의 결과 되었을 수 있습니다 제안 단일 중합체 문자열 내에서 발생 했습니다. 다른 엽록체 haplotype 변이, 시퀀싱 오류, 또는 시 토 신 탈의 결과 또는 이러한 요소의 몇 가지 조합이 되었을 수 있습니다. TK686-R 1 C→T, 1 G→T, 그리고 한 A→G 했다. C→T와 G→T 이체는 위와 같이 단일 중합체에서 발견 됐다. 궁극적으로, 동일한 완전 한 엽록체 게놈 모두 읽기 세트에서 확인 되었다. TK686에서 단일 엽록체 게놈 초록빛21 을 사용 하 여 및 Andropogoneae 부족의 다른 멤버에 비해 주석 첨부 했다. 모든 표준 엽록체 기능 했다 주석: 8 rRNAs, 38 tRNAs 그리고 84 단백질 코딩 유전자. 완전 한 엽록체 게놈 은행 (MF170217)와 초록빛27에서 가능 하다.

라이브러리의 reamplification에서 잠재적인 편견 또한 %GC 추정 및 총 예상된 transposon 콘텐츠를 통해 결정 되었다. 백분율 GC24사용자 지정 스크립트 사용 하 여 추정 되었다. 두 샘플의 GC 내용에서 차이 했다 TK686에서 49.7 %GC TK686. gc가 51.2% 무시할 수 Transposon 구성 Transposome28를 사용 하 여 추정 되었다. 두 라이브러리에 대 한 100000 읽기 했다 무작위로 subsampled 하 고 transposon 구성의 90% 정체성, 0.55의 분수 범위, 100, 클러스터 크기를 사용 하 여 추정 되었다 RepBase 21.10 잔디 반복 참조 설정29. 이이 데이터 집합에서 transposon 추정에 부트스트래핑 수행을 100 번을 반복 했다. Transposons의 주요 서브패밀리가 대 한 총 게놈 비율 Transposome 출력에서 추출 되었다 그리고 평균 및 표준 편차 100 복제에 대 한 이러한 추정 했다. M. R. McKain Github 저장소 Transposons30, 이러한 출력을 생성 하는 데 사용 하는 모든 스크립트를 찾을 수 있습니다 그리고 모든 결과 드리 아 드 (doi:10.5061/dryad.r8t2m)에 입금 되었습니다. 두 개의 가장 널리 퍼진 transposon 서브패밀리가 사용 하 여 표시기 (Copia집시 긴 터미널 반복 retrotransposons)로, 결과 거의 동일 했다 복사 와 33.52 ± 4.00 %31.68 ± 2.94%와 집시 24.83 ±에서 2.72% 및 TK686에 TK686-R 24.00 ± 2.35% 각각 (표 3). 이러한 테스트 결과이 프로토콜의 reamplification 단계 높은 수준의 게놈 통계에 대 한 의미 있는 시퀀싱 바이어스를 만들지 않은 것이 좋습니다. 그러나,이 하나의 예제는 모든 reamplified 라이브러리의 완전히 대표 하지 않을 수 있습니다 주목 해야한다. 이 단일 테스트 reamplification 단계는 본질적으로 게놈 통계 TK686/TK686-r에서을 바이어스 하지 하는 것을 보여 줍니다. 도입된 바이어스 엽록체 게놈 시퀀싱의 충분 한 적용을 주어진 어셈블리에 영향을 주지 것 이다 하지만 그 실험, TK686/TK686-r,이 연구에 제시 된으로 실시 하는 바이어스 인지 확인 하려면 대상 계보에 하는 것이 좋습니다. transposable 요소 다양성을 조사 연구 하는 동안 발생 합니다.

Figure 1
그림 1: A의 Agarose 젤 이미지) DNA 고립과 10 표 본관 표본에서 B) 최종 시퀀싱 라이브러리. 각 레인에 대 한 3 µ L DNA 또는 라이브러리의 사용 되었다. 일반 얼룩에 의해 보이는 것과 같이 (A) DNA 모든 표 본관 격리에 타락 했다. (B) 최종 시퀀싱 라이브러리 묘사 200-1, 000의 기본적인 쌍;의 넓은 분포와 300-500의 기본적인 쌍의 기본 밴드 후자는 reamplified 라이브러리에서 더 널리 퍼지다입니다. 레인 모두 (A)와 (B) 샘플에 의해 확인 되었다 고 표 2의 결과를 비교할 수 있습니다. 사다리 크기는 기본적인 쌍 (bp)에 묘사 했다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 원형 작의 Schizachyrium scoparium (TK686) 엽록체 게놈 주석으로. 표 본관 파생 DNA의 샷건 시퀀싱에서 완벽 하 게 조립된 게놈 전시 139,296 기본적인 쌍 (bp), 81,401의 큰 단일 복사본 영역 (LSC)의 총 길이 22,669의는 거꾸로 반복 영역 (IR), bp 혈압, 그리고 12,557의 작은 단일 복사본 영역 (SSC) bp입니다. 모든 표준 단백질 코딩 유전자, tRNAs, 그리고 rRNAs Andropogoneae 부족의 구성원에 대 한 주석에서 확인 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

표 2: 10 표 본관 샘플 및 4 reamplified 라이브러리에 대 한 DNA 추출 및 라이브러리 준비 결과. 다양 한에서 총 두 배 좌초 된 DNA 프로토콜에서 단계 시연된 어떻게 변수 품질 수, 특히 크기에 대 한 필터링. 이 테이블을 다운로드 하려면 여기를 클릭 하십시오.

표 3: TK686 및 reamplified TK686R에 대 한 통계를 시퀀싱. Reamplification 곰 팡이 게놈 오염, GC 콘텐츠 추정, transposon 구성 추정, 또는 전체 엽록체 게놈을 조립 하는 능력의 전반적인 발생률에 영향을 미치지 않습니다. 이 테이블을 다운로드 하려면 여기를 클릭 하십시오.

보충 표 1: 20 reamplified 라이브러리를 포함 하 여 40 추가 표 본관 샘플에 대 한 DNA 추출 및 라이브러리 준비 결과. 다양 한에서 총 두 배 좌초 된 DNA 프로토콜에서 단계 시연된 어떻게 변수 품질 수, 특히 크기에 대 한 필터링. 이 테이블을 다운로드 하려면 여기를 클릭 하십시오.

보충 그림 1: 40 추가 DNA 격리 표 본관 표본에서의 Agarose 젤 이미지. 모두 (A)와 (B) 20 별도 DNA 격리 묘사와 표 본관 파생 DNA의 특성 저하를 보여 줍니다. 각 레인에 대 한 DNA의 3 µ L 사용 되었다. 레인 모두 (A)와 (B) 샘플에 의해 확인 되었다 고 보충 표 1에 결과를 비교할 수 있습니다. 사다리 크기는 기본적인 쌍 (bp)에 묘사 된다. 화이트 이미지에 부스러기는 청소와 제거할 수 없습니다 젤 영상에서 인공 물. 이 그림을 다운로드 하려면 여기를 클릭 하십시오.

보충 그림 2: 표 본관 파생 DNA에서 40 추가 시퀀싱 라이브러리의 Agarose 젤 이미지. 각 레인에 대 한 도서관의 3 µ L 사용 되었다. 최종 시퀀싱 라이브러리 모두 (A)에서 발견 되 고 (B) 300-500의 기본적인 쌍의 평균 크기. 증폭된 샘플에서 본 보조 밴드 "버블링" 라이브러리의 것이 좋습니다. 레인 모두 (A)와 (B) 샘플에 의해 식별 되 고 보충 표 1에 결과를 비교할 수 있습니다. 사다리 크기는 기본적인 쌍 (bp)에 묘사 된다. 이 그림을 다운로드 하려면 여기를 클릭 하십시오.

보충 그림 3: 추가 단일 사이클 PCR 단계 보조 밴드 제거의 Agarose 젤 이미지. 이 그림을 다운로드 하려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

여기에 제시 된 프로토콜 DNA 고립과 말린된 식물 견본에서 라이브러리 준비 시퀀싱에 대 한 포괄적이 고 강력한 방법입니다. 방법과 그것을 변경 하는 최소한의 필요가 일관성 기반 견본 품질에 큰 표 본관 기반 시퀀싱 프로젝트에 대 한 확장 가능한 그것. 낮은 수익률 라이브러리에 대 한 선택적 reamplification 단계 포함을 낮은 품질, 낮은 수량, 드문, 또는 시퀀싱에 적합 되지 않을 역사적으로 중요 한 샘플의 포함을 허용 한다.

초기 DNA 수율의 중요성
표 본관 파생 DNA 종종 저하 초기 견본 보존11, dna 견본의 결과로 미만 300 년 오래 된 동물 남아 있는 몇 백 년 된31 의 수천에서 고립 된 DNA로 저하 때문 , 32. 따라서, 초기 DNA 수율의 최적화는 성공적인 시퀀싱 라이브러리 준비에 대 한 충분 한 높은-품질 dsDNA를 얻기에 중요 한. 잔디 종에 대 한 최적의 수율 소독된 모래의 사용을 통해 달성 하 고 초기 연 삭에 액체 질소 단계, 세포 벽의 더 철저 한 파괴 및 핵 산의 자료를 제공 하. 이 방법은 증가 바람직한 더 큰 dsDNA과 바람직하지 않은 작은 조각 (그림 1, 그림 1과 보충, 보충 표 1, 표 2). 후속 비드 청소 단계 분리 하 고 시퀀싱 (300-500의 기본적인 쌍), 크게 복구 감소 하지만 또한 풍부 하 게 더 긴 조각 (보충 표 1, 표 2)에 대 한 적절 한 크기의 조각에 대 한 풍부. 초기 DNA 분리 단계로 변경 다운스트림 처리18에 2 차 대사 산물의 효과 감소 시키기 위하여 샘플링 되는 혈통에 따라 필요할 수 있습니다.

라이브러리 어댑터의 최적화
결 찰에 사용 되는 어댑터의 농도 완료 라이브러리에서 어댑터 이합체의 금액에 직접적인 영향을 있다. 어댑터 이합체 어댑터 각자 결 찰에서 부족 한 예제 있으면 고 시퀀싱 실행33오염. 표 본관 표본에서 사용할 수 있는 상대적으로 낮은 총 dsDNA 결 찰 하기 전에 어댑터의 희석을 필요로합니다. 어댑터 50-fold 희석 수 있습니다 15 µ M의 재고 농도에서 개별적으로 측정 하 고 각 샘플 (표 2, 추가 테이블에 대 한 어댑터를 희석 필요 하지 않고 ( 프로토콜 섹션참조) 촉진 높은 처리량 라이브러리 준비 1). 비록 어댑터의 채도 수 원리에서 전체 라이브러리 수확량 감소, 표 본관 표본 어댑터의 같은 초과에서 dsDNA 보장할 가능성이 크다.

높은 수익률에 대 한 단계 청소 구슬에서 변형
준비 시퀀싱 라이브러리의 크기 선택은 일반적으로 어댑터 결 찰, 원하는 크기 범위; 내 주로 파편의 확대를 위한 허용 후 완료 이 모두 더 큰 대상 크기 보다 더 작은 파편을 제거 하 여 이루어집니다. 라이브러리 준비를 위해 표 본관 파생 dsDNA의 낮은 금액은이 단계에서 unworkably 낮은 총 dsDNA 인 크기 선택 후 악화 하 고 궁극적으로 최종 라이브러리에서 수확량을 낮은. 결 찰 후 90% 볼륨 비즈를 사용 하 여 표준 구슬 청소 단계를 실시 함으로써 더 많은 총 dsDNA 증폭 단계에서 농축에 대 한 남아 있습니다. 매우 작은 DNA 파편 우선적으로 90% 볼륨 비즈를 사용 하 여 제거 됩니다. 크기 선택 원하는 조각 크기의 농축을 보장 하는 증폭된 라이브러리에 마지막 단계에서 실시 됩니다. 구슬의 총 볼륨 25 µ L와 구슬의 6 µ L의 2 단계 볼륨은 400-500 기지 쌍 삽입 (그림 1B, 보충 그림 2)이이 프로토콜 내에서 라이브러리를 검색 하도록 최적화 되어 있지만 원하는 범위를 선택 조정할 수 있습니다.

라이브러리의 Reamplification 통해 샘플 구조
DNA 분리 및 라이브러리 준비에 모범 사례에도 불구 하 고 시퀀싱 라이브러리의 최종 농도 더 시퀀싱에 대 한 적절 한 수 있습니다. 표 본관 표본에서 샘플링 하 고 종종 한정 된 소모품 자료의 파괴적인 성격은 항상 반복 DNA 격리 허용 하지 않습니다. 라이브러리를 최대 reamplifying에 의해 12 추가 PCR 주기, 심지어 매우 가난한 라이브러리 저장할 수 있습니다. 표준 뇌관 쌍 증폭, 이중 또는 단일 색인된 도서관 프로토콜 중 하나에 호환 되는 사용 됩니다. Reamplification에 대 한 주요 관심사 게놈20의 GC 풍부한 부분에서 감소를 통해 자주 바이어스의 도입 이다. 높은 중 합 효소를 사용 하 여 ( 재료의 표참조), 이러한 잠재적인 편견을 잠재적으로 피할 수 있습니다. 이 TK686 및 TK686-R (표 3) 시퀀스 라이브러리의 GC 내용의 최소한의 변화를 통해 보여 줍니다. 두 번째 검증으로 TK686와 TK686-R의 transposon 콘텐츠는 추정 하 고 인지할 수 차이가 (표 3)을 보였다. 마지막으로, 전체 엽록체 게놈이이 취득의 TK686 및 TK686-R, 귀착되 었 다 (그림 2, 표 3) 두 어셈블리 간의 SNP 변이의 가까운 검사 후 동일한 시퀀스에서 조립 되었다. 이러한 테스트 GC 내용과 transposon 구성, 및 완전 한 엽록체 게놈을 조립 수 있습니다 영향을 받지 않습니다 reamplification와 같은 그 표준 게놈 통계를 제안 합니다. 이 표 본관 표본 너무 저하 될 것으로 생각을 통합 또는 PCR 통해 소개 된 바이어스에 대 한 우려 없이 phylogenomic 연구로 자료에서 부족의 가능성을 엽니다. SNP 호출 편향 되어 있는지 여부를 테스트 하는 데 필요한 것이 reamplified 라이브러리도 시퀀스 캡처34를 사용할 수 있습니다. 바이어스 시퀀싱 라이브러리에 도입 되지 확인 하려면 각 프로젝트와 바이어스의 소규모 테스트를 실시 하는 것이 좋습니다.

제한 및 가능한 수정
이 프로토콜에 왔다 비록 수백 표 본관 표본, 제대로 조직 보존 여전히 어떤 단계에서 실패할 수 있습니다. 그러나 그것은,, reamplification 통해 라이브러리 구조 후 특히 성공적인 DNA 추출, 조직에서 실패 하는 라이브러리에 대 한 매우 드문. 크기 선택 단계 다른 크기의 조각을 대상으로 하거나 마지막 라이브러리에서 파편의 넓은 범위를 줄이기 위해 수정할 수 있습니다. 마찬가지로 모든 추출 식물 기반 프로토콜 단계 전체 프로토콜을 방해 할 수 있는 리니지 관련 보조 화합물을 제거 하려면 필요할 수 있습니다. 제시,이 프로토콜 잔디 표 본관 표본에 대 한 DNA 분리 및 높은 처리량 라이브러리 준비에 대 한 표준 메서드를 제공 하 고 검증 및 실험을 통해 다른 식물 계보를 amendable 될 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자 들은 아무 경쟁 관심사를 선언 합니다.

Acknowledgments

우리는 테일러 AuBuchon-엘 더, 요르단 Teisher, 및 샘플링 표 본관 표본에 크리스티나 Zudock와 미주리 식물원 표 본관 표본에 파괴적인 샘플링에 대 한 액세스에 대 한 감사합니다. 이 작품은 국립 과학 재단 (뎁-1457748)에서 교부 금에 의해 지원 이었다.

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics