Isolement d’ADN robuste et Construction de bibliothèque de séquençage haut-débit pour les spécimens d’herbier

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Cet article illustre un protocole détaillé pour l’isolement de l’ADN et construction de bibliothèque de séquençage haut-débit de matériel d’herbier dont le sauvetage de l’ADN de très mauvaise qualité.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les herbiers sont une source inestimable de matériel végétal qui peut être utilisé dans une variété d’études biologiques. L’utilisation de spécimens d’herbier est associé liée un certain nombre de défis, y compris la qualité de conservation des échantillons ADN dégradé et échantillonnage destructif des spécimens rares. Afin d’utiliser plus efficacement le matériel d’herbier dans les projets de séquençage de grand, il faut une méthode fiable et évolutive de préparation d’ADN d’isolement et de la bibliothèque. Cet article démontre un protocole robuste, début à la fin pour ADN isolement et haut débit bibliothèque construction de spécimens d’herbier qui ne nécessite pas de modification pour des échantillons individuels. Ce protocole est adapté pour la plante basse qualité séchée matériel et prend l’avantage des méthodes existantes en optimisant les tissus meulage, modification de sélection de la taille de bibliothèque et en introduisant une étape facultative de reamplification pour les bibliothèques de faible rendement. Reamplification de bibliothèques d’ADN avec un faible rendement peut sauver des échantillons provenant de spécimens d’herbier potentiellement précieux et irremplaçable, niant la nécessité pour un échantillonnage destructeur additionnel et sans introduire un biais de séquençage discernable pour common applications de la phylogénétiques. Le protocole a été testé sur des centaines d’espèces de graminées, mais devrait être adaptable pour utilisation dans les autres lignées de plantes après vérification. Ce protocole peut être limité par l’ADN extrêmement dégradé, où des fragments n’existent pas dans la gamme de taille désirée, et de métabolites secondaires présents dans une substance végétale qui inhibent l’isolement d’ADN propre. Dans l’ensemble, ce protocole présente une méthode complète et rapide qui permet l’isolement d’ADN et préparation de la bibliothèque des 24 échantillons en moins de 13 h, avec seulement 8 h de la période de pratique active avec des modifications minimes.

Introduction

Collections de l’herbier sont une source potentiellement utile des deux espèces et la diversité génomique d’études y compris phylogénétique1,2,3, génétique des populations,4,5, conservation biologie6espèces envahissantes biologie7et trait evolution8. La possibilité d’obtenir une riche diversité d’espèces, populations, lieux géographiques et points dans le temps met en lumière le « treasure chest »9 qui est de l’herbier. Historiquement, la nature dégradée de l’ADN dérivé herbier a entravé les projets axés sur la PCR, reléguant souvent les chercheurs à utiliser uniquement les marqueurs trouvés à élevé de copies, comme les régions du génome chloroplastique ou l’espaceur interne transcrit (ITS) de le ribosomique ARN. Qualité des spécimens et ADN varient largement basé sur les méthodes de préservation9,10, avec des cassures double-brin et la fragmentation de la chaleur utilisée dans le processus de séchage étant les formes les plus courantes des dommages, la création du ce que l'on appelle 90 % ADN de lock-up qui a grevé les études basées sur la PCR11. En dehors de la fragmentation, deuxième plus répandu en génomique de l’herbier s’agit de contamination, telles que cette dérivée de champignons endophytes13 ou champignons acquis post mortem après la collecte mais avant de monter dans l’herbier12, bien que ce problème peut être résolu bioinformatically compte tenu de la base de données droit fongique (voir ci-dessous). Un troisième problème, moins fréquents, est la modification de séquence par le biais de cytosine désamination (C/G→T/A)14, bien qu’on estime être faible (~ 0,03 %) à l’herbier spécimens11. Avec l’avènement de séquençage haut débit (HTS), la question de la fragmentation peut être surmontée avec quelques lectures et séquençage profondeur12,15, permettant l’acquisition des données génomiques des nombreux spécimens de faible qualité L’ADN et parfois même permettre de séquençage du génome entier15.

Des échantillons d’herbier sont devenant plus fréquemment utilisés et sont une plus grande partie des projets phylogénétique16. Un défi actuel de l’utilisation de spécimens d’herbier pour HTS est systématiquement obtenir suffisamment ADN bicaténaire, indispensable pour les protocoles de séquençage, de nombreuses espèces dans un délai raisonnable, sans avoir besoin d’optimiser des méthodes pour l’individu spécimens. Dans cet article, un protocole d’extraction d’ADN et préparation de la bibliothèque de spécimens d’herbier démontre qui tire profit des méthodes existantes et modifie leur permettant des résultats rapides et reproductibles. Cette méthode permet complète transformation du spécimen dans une bibliothèque de 24 échantillons à 13 h, avec temps de pratique 8 h, ou 16 h, avec le temps de pratique 9 h, quand l’étape facultative reamplification est nécessaire. Traitement simultané de plusieurs échantillons est réalisable, même si le facteur limitant est la capacité de centrifugeuse et de compétences techniques. Le protocole vise à exiger uniquement matériel de laboratoire typique (thermocycleur, centrifugeuse et supports magnétiques) au lieu de l’équipement spécialisé, comme un nébuliseur ou un sonicateur, pour la tonte de l’ADN.

Qualité de l’ADN, taille du fragment et la quantité sont des facteurs d’utilisation des spécimens d’herbier dans les expériences de séquençage haut débit limitant. Autres méthodes pour isoler l’ADN de l’herbier et création de bibliothèques de séquençage haut débit ont démontré l’utilité d’utiliser aussi peu que 10 ng d’ADN16; Cependant ils ont besoin de déterminer expérimentalement le nombre optimal de PCR cycles requis pour la préparation de la bibliothèque. Cela devient impraticable lorsque traitant de très petites quantités de double viable stranded DNA (ADN double brin), car certains spécimens d’herbier produisent seulement assez ADN pour une préparation de bibliothèque unique. La méthode présentée ici utilise un numéro unique de cycles indépendamment de la qualité de l’échantillon, donc aucun ADN ne se perd dans les étapes d’optimisation de bibliothèque. Au lieu de cela, une étape de reamplification est appelée lorsque les bibliothèques ne respectent pas les montants minimums nécessaires pour l’ordonnancement. De nombreux échantillons d’herbier sont rares et possèdent peu de matériel rendant difficile de justifier l’échantillonnage destructeur dans de nombreux cas. Pour contrer cela, le protocole présenté permet de dsDNA entrée tailles moins de 1,25 ng dans le processus de préparation de bibliothèque, élargit la portée des échantillons viables pour haut débit séquençage et réduisant au minimum la nécessité d’échantillonnage destructeur des spécimens.

Le protocole suivant a été optimisé pour les graminées et testé sur des centaines d’espèces différentes des échantillons d’herbier, même si nous attendons que le protocole peut être appliqué à beaucoup d’autres groupes de plantes. Il comprend une étape de récupération en option qui peut être utilisée pour enregistrer la basse qualité et/ou des spécimens rares. Après plus de deux cents spécimens d’herbier testés, ce protocole fonctionne sur des spécimens avec faible tissu d’entrée et de qualité, permettant la préservation des spécimens rares par échantillonnage destructeur minime. Ici, il est démontré que ce protocole peut fournir des bibliothèques de haute qualité qui peuvent être séquencés pour projets axés sur la phylogénomique.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. avant de démarrer

  1. Faire frais cétyl triméthylammonium bromure (CTAB) tampon17 en ajoutant 20 g de CTAB, 10 g de polyvinylpyrrolidone (PVP) 40, 100,0 mL 1 M Tris pH 8,0, 40 mL de 0,5 M tétraacétique (EDTA) l’acide pH 8,0, 280,0 mL de 5 M de NaCl et 400,0 mL d’eau à réactif ensemble et porter le volume total de 1 L en utilisant le réactif de qualité de l’eau. Ajuster le pH à 8.0.
    NOTE : Réactifs supplémentaires peuvent être ajoutés à la CTAB selon des composés secondaires chez les taxons individuels. Voir Allen et al. 18 pour obtenir la liste complète des réactifs additives.
  2. Ajouter 10 µL de β-mercaptoéthanol par 5 mL de tampon CTAB.
    Remarque : Ceci peut être préparé par lots de 50 mL et stocké à température ambiante pendant 3 à 4 semaines.
    1. Chauffer la solution CTAB dans un bain d’eau de 65 ° C.
  3. Faites refroidir les mortiers et pilons à-20 ° C pendant au moins 20 min.
  4. Étiqueter les 4 sets de 2 tubes de 2 mL n (où n = le nombre d’échantillons). Mettre 1 ensemble des tubes marqués sur la glace.
  5. Isopropanol froid sur la glace ou dans un congélateur à-20 ° C.
  6. Enlever les cordons d’immobilisation réversible (SPRI) en phase solide (voir Table des matières) dans le frigo et leur permettre de s’équilibrer à température ambiante (au moins 30 min).
  7. Préparer l’éthanol à 80 %.
  8. Sélectionner des spécimens d’herbier pour l’extraction et récupérer ~ 1 cm2, ou 10 mg, des tissus par spécimen, de préférence le matériel foliaire.

2. Extraction d’ADN

  1. Meulez ~ 1 cm2 de tissu herbier présélectionnés à l’aide de pilons et mortiers prérefroidies. Ajouter de l’azote liquide et sable de 30 – 50 mg stérilisé. Broyer jusqu'à ce que le tissu se transforme en poudre fine.
    Remarque : 10 mg ou plus de tissu est souhaitable, mais moins a également travaillé dans certains cas. Une fois que l’azote liquide s’évapore, en rajouter au besoin jusqu'à ce que le tissu est complètement broyé. Une autre méthode commune pour perturber les cellules et les tissus est l’utilisation d’un batteur de perle. Toutefois, cette méthode s’est avérée ne fonctionne pas bien pour les spécimens utilisés dans ces expériences.
  2. Transférer la poudre congelée dans deux tubes de 2 mL (ajouter non plus de la moitié du volume du tube). Ajouter 600 µL de solution chaude de CTAB dans chaque tube et mélanger les tubes soigneusement par inversion et mélangé au vortex.
    Remarque : Étant donné que la quantité et la qualité du matériel d’herbier est souvent faible, effectuent l’isolement de l’ADN en deux répétitions permet d’obtenir des rendements plus élevés.
  3. Incuber les échantillons dans un bain-marie à 65 ° C pendant 1 – 1,5 h, Vortex toutes les 15 min.
  4. Centrifuger les échantillons à 10 000 g pendant 5 min. transférer le liquide surnageant à une nouvelle série de tubes étiquetés (~ 500 µL). Jeter la pastille à l’aide d’une procédure standard élimination non chlorés.
  5. Ajouter 4 µL de RNase-A (10 mg/mL) dans chaque tube et mélanger par inversion ou de pipetage. Incuber les échantillons à 37 ° C dans un bain de chaleur bloc ou de l’eau pendant 15 minutes.
  6. Ajouter un volume égal (~ 500 µL) d’un mélange d’alcool de phénol : chloroforme : isoamyle 25:24:1 une fois que les tubes ont atteint la température ambiante. Bien mélanger en pipettant également en haut et en bas et/ou avec inversion. Centrifuger de que les tubes à 12 000 g pendant 15 min. transférer la phase aqueuse (couche supérieure) sur une nouvelle série étiqueté tubes (~ 400 µL). Jeter la couche organique dans un conteneur de déchets chloré.
    NOTE : Étape 2.6 peut être répété si des grandes quantités de composés secondaires sont prévues en matériel végétal.
  7. Ajouter un volume égal (~ 400 µL) d’un mélange d’alcool 24:1 chloroforme : isoamylique. Bien mélanger en pipettant également en haut et en bas et/ou avec inversion. Centrifuger les tubes à 12 000 g pendant 15 min. transfert de la phase aqueuse (couche supérieure) pour une nouvelle série de tubes prérefroidies, étiquetés (~ 300 µL). Jeter la couche organique dans un conteneur de déchets chloré.
  8. Ajouter un volume égal (~ 300 µL) d’isopropanol prérefroidie et 12 µL d’acétate de sodium 2,5 M dans chaque tube. Incuber les échantillons à-20 ° C pendant 30 à 60 min.
    NOTE : Les temps d’incubation peuvent être prolongées (jusqu'à une nuit d’incubation), mais la qualité d’ADN diminuera plus Incuber les échantillons.
  9. Effectue les prélèvements hors du congélateur et centrifuger les tubes à 12 000 g pendant 15 min. Retirer et jeter le surnageant doucement sans déranger le culot. Laver le culot en suspension avec frais 70 % éthanol (environ 300 – 500 µL). Pour chaque échantillon doublé, consolider les deux boulettes individuels en un seul, accompagné de l’éthanol.
    Remarque : Les échantillons devraient être regroupées dans un tube à l’aide d’éthanol tout d’abord et continuez. Il n’est pas nécessaire de laver chaque échantillon avec de l’éthanol séparément.
  10. Centrifuger les tubes à 12 000 x g pendant 10 min. enlever et jeter le surnageant doucement sans déranger le culot. Sécher à l’air des granulés.
    Remarque : Les échantillons peuvent être séchés au plus vite en utilisant un bloc de chaleur sèche (ne pas dépasser 65 ° C). S’assurer que les échantillons ne séchez pas trop, car cela peut diminuer le rendement final de l’ADN.
  11. Suspendre l’ADN isolé dans 50 µL de TE 1 x. Conserver dans le congélateur-20 ° C pour un stockage prolongé ou 4 ° C, pour la semaine suivante.

3. contrôle de la qualité (CQ)

  1. Exécuter un gel d’agarose pour le contrôle de la qualité.
    1. Préparer, tampon 1 x Tris/Borate/EDTA (TBE) en ajoutant la base Tris 54 g, 27,5 g d’acide borique et 3,75 g EDTA sel disodique, ce qui porte le total à 5 L à l’aide de l’eau de qualité réactif.
    2. Préparer un gel d’agarose à 1 % en ajoutant 1 g d’agarose dans 100 mL de 1 x TBE. La solution au micro-ondes jusqu'à ce qu’aucun gel d’agarose n’est visible. Ajouter 0,01 % acide nucléique gel détachant (voir Table des matières). Laissez refroidir le flacon jusqu'à ce qu’il est chaud au toucher. Bien mélanger en remuant. Verser un plateau de gel d’agarose et laisser reposer jusqu'à ce qu’elle se solidifie.
    3. Mix 3 µL de l’échantillon, 2 µL d’eau de qualité réactif et 1 µL de 6 x chargement colorant. Charger les échantillons dans la matrice du gel, en notant leur ordre.
    4. Exécuter les exemples de 60 – 70 min à 60 – 70 V. Image le gel sous UV avec mise au point et l’exposition correcte.
      Remarque : Présence d’une bande claire de haut poids moléculaire est un signe de l’ADN de haute qualité, tandis que les frottis indiquent généralement la dégradation de l’ADN. La plupart des herbiers sont dégradés.
  2. Exécuter une analyse de quantification d’ADN double brin (voir Table des matières) pour déterminer la quantité de double brin d’ADN.
    1. Utiliser 2 µL de l’échantillon pour analyse.
      Remarque : Les Dilutions ne sont pas nécessaires pour l’analyse de la quantification de matériel d’herbier car ils ont tendance à être en quantités minimes. Bibliothèques de succès ont été faites d’aussi peu que 1,26 ng dsDNA total de cette opération.

4. l’ADN de cisaillement

Remarque : Il s’agit d’une version optimisée d’un fragmentase double-brin commercial du protocole (voir Table des matières).

  1. Place dsDNA fragmentation enzymatique sur la glace après agitation pendant 3 s.
  2. Dans un tube stérile 0,2 mL de réaction en chaîne (PCR) polymérase, mix 1-16 µL isolé ADN avec 2 µL de tampon de réaction de fragmentation d’accompagnement. Porter le volume total à 18 µL par adjonction d’eau libre nucléase. Ajouter 2 µL d’enzyme fragmentation ADN double brin et vortex le mélange pendant 3 s.
    Remarque : La quantité d’ADN nécessaire varie selon la concentration d’ADN (objectif pour 200 total ng dans le tube).
  3. Incuber les échantillons à 37 ° C pendant 8,5 min. Puis ajouter 5 µL de EDTA 0,5 M pour les tubes.
    Remarque : Cette étape doit être effectuée dès que la période d’incubation est plus pour mettre fin à la réaction et prévenir des échantillons d’ADN de tonte trop.

5. perle Clean-up

  1. Homogénéiser les perles SPRI au vortex.
  2. Porter le volume total de l’ADN cisaillé à 50 µL en ajoutant 25 µL d’eau libre nucléase. Ajouter 45 µL de perles de température ambiante SPRI (90 % du volume) à 50 µL de coulissage ADN et mélanger soigneusement par pipetage de haut en bas.
    NOTE : Ajouter des perles à 90 % du volume total de l’échantillon est fait pour enlever le plus petit des fragments d’ADN, souvent en dessous de 200 paires de bases.
  3. Laissez les échantillons incuber pendant 5 min. mettre les tubes sur une plaque magnétique et laissez-les reposer pendant 5 min. soigneusement retirer et jeter le surnageant.
    Remarque : Veillez à ne pas déranger les perles, car ils contiennent les cibles d’ADN désirées.
  4. Ajouter 200 µL d’éthanol à 80 % frais aux tubes tandis que sur le support magnétique. Incuber à température ambiante pendant 30 s puis soigneusement retirer et jeter le surnageant. Répétez cette opération une fois. Sécher à l’air les perles pendant 5 min alors que le tube est à la barre magnétique avec son couvercle ouvert.
    Remarque : Éviter de trop sécher les perles. Cela peut entraîner plus faible récupération de l’ADN.
  5. Retirer les tubes de l’aimant. Éluer l’ADN provenant des perles dans 55 µL de 0,1 x TE et homogénéiser par pipetage de haut en bas. Incuber à température ambiante pendant 5 min. tubes de Place sur le support magnétique et attendez que la solution mettre claire (environ 2 min).
  6. Retirer 52 µL du liquide surnageant. Exécuter une analyse de quantification de l’ADN sur les échantillons pour vérifier la récupération et la concentration initiale qui entre dans la préparation de la bibliothèque.
    NOTE : Les bibliothèques ont été faites avec dsDNA totale estimée à moins de 1,25 ng, bien que dans chaque cas reamplification soit nécessaire.

6. Bibliothèque préparation

Remarque : Il s’agit d’une version modifiée d’un kit de bibliothèque disponibles dans le commerce (voir protocole de Table des matières ).

  1. Préparation de la fin
    1. Ajouter 3 µL d’endonucléase et phosphate de décantation des enzymes et 7 µL de tampon de réaction d’accompagnement à 50 µL d’ADN purifié, cisaillé. Bien mélanger en pipettant également de haut en bas. Faites tourner les tubes pour enlever les bulles.
      Remarque : Le volume total doit être 60 µL.
    2. Placer les échantillons dans un thermocycleur avec le programme suivant : 30 min à 20 ° C, 30 min à 65 ° C, puis maintenez à 4 ° C.
      NOTE : Couvercle chauffant a été fixé à ≥ 75 ° C
  2. Ligature de l’adaptateur
    1. Diluer l’adaptateur 25 – 50 pli (travail de concentration adaptateur de 0,6 à 0,3 µM). Ajouter 30 µL du mélange maître ligature, 1 µL de renforceur de ligature et 2,5 µL de l’adaptateur pour l’ordonnancement de lecture courte haut débit dans les tubes.
      Remarque : Le volume total doit être 93,5 µL.
    2. Bien mélanger en pipettant également de haut en bas. Faites tourner les tubes pour enlever les bulles. Incuber les tubes à 20 ° C pendant 15 min.
    3. Ajouter 3 µL du mélange commercial d’uracile DNA glycosylase (UDG) et le DNA glycosylase-lyase endonucléase VIII (voir Table des matières) pour les tubes. Assurez-vous que le volume total est 96,5 µL. bien mélanger et laisser incuber à 37 ° C pendant 15 min à l’aide d’un thermocycleur.
      Remarque : Le couvercle doit être réglé à ≥47 ° C. La version originale du protocole commercial a la sélection de la taille après l’étape de ligature adaptateur, suivie d’un nettoyage de perles comme la dernière étape. Ce protocole, qui permet d’obtenir des rendements plus élevés, intervertit l’ordre de ces étapes et implémente la sélection de la taille comme une étape finale.
  3. Nettoyage pour enlever les Enzymes et les petits Fragments
    1. Homogénéiser les billes magnétiques au vortex.
    2. Ajouter 78 µL de billes magnétiques SPRI (80 % du volume) et bien mélanger en pipettant également de haut en bas.
      NOTE : Ajouter des perles à 80 % du volume total de l’échantillon est fait pour enlever les plus petits fragments d’ADN, qui sont souvent moins de 250 paires de bases. Le retrait plus strict de petits fragments d’ADN consiste à (i) supprimer les adaptateurs excédentaires et (ii) mettre l’accent sur l’amplification des fragments plus grands dans les étapes suivantes.
    3. Laisser qu'incuber les échantillons pendant 5 min. Placer les tubes sur une plaque magnétique pendant 5 min. Retirer soigneusement et jeter le surnageant qui contient de l’ADN à l’extérieur de la gamme de taille souhaitée.
      Remarque : Veillez à ne pas déranger les billes qui contiennent les cibles d’ADN désirées.
    4. Ajouter 200 µL d’éthanol à 80 % frais aux tubes tandis que sur le support magnétique. Incuber à température ambiante pendant 30 s puis soigneusement retirer et jeter le surnageant. Répétez cette opération une fois. Sécher à l’air les perles pendant 5 min alors que le tube est à la barre magnétique avec le couvercle ouvert.
      Remarque : Éviter les perles de séchage. Cela peut entraîner plus faible récupération de l’ADN.
    5. Retirer les tubes de l’aimant. Éluer la cible de l’ADN de la Perle en ajoutant 17 µL de 0,1 x TE et homogénéiser par pipetage de haut en bas.
    6. Incuber à température ambiante pendant 5 min. tubes de Place sur le support magnétique et attendez que la solution mettre claire (environ 2 min).
    7. Retirer 15 µL du liquide surnageant.
  4. Amplification par PCR
    1. Ajouter 25 µL du mélange maître de la haute fidélité PCR, 5 µL de haut débit lecture courte séquençage bibliothèque prép 5' apprêt et 5 µL de séquençage lecture courte haut débit bibliothèque prép 3' primer, à 15 µL de l’ADN purifié adaptateur-ligaturé.
      Remarque : Le volume Total doit être 50 µL.
    2. Mélangez bien au vortex. Placer les échantillons dans un thermocycleur en utilisant les paramètres trouvés dans le tableau 1: réglage d’amplification thermocycleur.
      Remarque : Un grand nombre de cycles est nécessaire en raison de la faible quantité d’ADN d’entrée.
Étape du cycle Temp. Temps Cycles
Dénaturation initiale 98 ° C 30 s 1
Dénaturation 98 ° C 10 s 12
Recuit/Extension 65 ° C 75 s 12
Extension finale 65 ° C 5 min 1
Maintenez 4 ° C

Tableau 1 : Protocole de PCR températures et durées de dénaturation, recuit et extension. Température et temps ont été optimisés pour les réactifs présentés dans le présent protocole. Si les réactifs sont altérées, températures et durées doivent être optimisées encore une fois.

  1. Sélection de la taille pour la taille de la bibliothèque souhaitée
    Remarque : Cette étape perle supprimera les fragments au-dessus et en dessous de la fourchette cible.
    1. Homogénéiser les perles SPRI au vortex.
    2. Ajouter 25 µL (50 % du volume) de billes magnétiques température ambiante et mélanger soigneusement par pipetage de haut en bas. Laissez les échantillons incuber pendant 5 min. mettre les tubes sur une plaque magnétique et laissez-les reposer pendant 5 min. soigneusement retirer et de transférer le surnageant dans un nouvel ensemble de tubes étiquetés.
      Remarque : Ce volume peut être réglé selon la taille désirée bibliothèque. Le surnageant contient des fragments d’ADN de la taille désirée. Dans la première incubation de perle, les perles sont contraignantes plus grands fragments de bibliothèque. Ceux-ci sont retirés pour se concentrer sur ceux de la gamme de paires de bases 400 – 600. Le surnageant contient des fragments plus petits.
    3. Ajouter 6 µL de perles SPRI température ambiante au surnageant et mélanger soigneusement par pipetage de haut en bas. Laissez que les échantillons incuber pendant 5 min. mettre les tubes sur une plaque magnétique et laissez-les reposer pendant 5 min.
      Remarque : Ce volume peut être réglé selon la taille désirée bibliothèque conformément à l’étape 6.5.2.
    4. Soigneusement, enlever et jeter le surnageant.
      Remarque : Veillez à ne pas déranger les billes qui contiennent l’ADN désirée. Dans la seconde incubation de perle, les perles sont contraignantes aux fragments subsistant après que la suppression initiale de l’ADN de plus grand fragments. Cet ensemble de fragments est habituellement dans la gamme de taille souhaitée.
    5. Ajouter 200 µL d’éthanol à 80 % frais aux tubes tandis que sur le support magnétique. Incuber à température ambiante pendant 30 s, puis soigneusement retirer et jeter le surnageant. Répéter les étapes. Sécher à l’air les perles pendant 5 min alors que le tube est à la barre magnétique avec le couvercle ouvert.
      Remarque : Éviter de trop sécher les perles. Cela peut entraîner plus faible récupération de l’ADN.
    6. Retirer les tubes de l’aimant. Éluer la cible de l’ADN de la Perle en 33 µL de 0,1 x TE et homogénéiser par pipetage de haut en bas.
    7. Incuber à température ambiante pendant 5 min. tubes de Place sur le support magnétique et attendez que la solution mettre claire (environ 2 min). Retirer 30 µL du liquide surnageant et transfert à tubes de 2 mL (voir Table des matières) pour le stockage.
      Remarque : Les bibliothèques peuvent être conservés à-20 ° c pour le stockage à long terme.
  2. Contrôle de la qualité
    1. Exécutez un test de contrôle de la qualité sur les bibliothèques d’ADN. Se référer aux étapes 3.1 et 3.2.
      Remarque : Pour les bibliothèques de l’ADN, couler le gel pour ~ 45 min à 96 V.
  3. Reamplification de la bibliothèque : facultatif si quantité de bibliothèque n’est pas suffisante.
    Remarque : Les échantillons avec des concentrations de bibliothèque inférieure à 10 nM peut être réamplifié en procédant comme suit. Reamplification des bibliothèques de faible concentration peut obtenir des résultats exploitables pour le séquençage, mais reamplification peut provoquer un léger changement dans la diversité de la composition en bases, bien que se sont réunis les résultats (tableau 3) suggèrent que c’est négligeable pour certains paramètres .
    1. Diluer les amorces universelles reamplification 10 fois à l’aide de 0,1 x TE.
    2. Ajouter 25 µL du mélange maître de la haute fidélité PCR, 5 µL d’apprêt reamplification universelle diluée 1 (AATGATACGGCGACCACCGA) et 5 µL d’apprêt 2 (CAAGCAGAAGACGGCATACGA) de la reamplification universelle diluée à 15 µL de bibliothèques de faible concentration. Remarque : Le volume Total doit être à 50 µL.
    3. Mélangez bien au vortex. Placer les échantillons dans un thermocycleur en utilisant les paramètres trouvés dans le tableau 1: réglage d’amplification thermocycleur
      Remarque : Le grand nombre de cycles est nécessaire en raison de la faible quantité d’ADN d’entrée.
    4. Nettoyage perle
    5. Homogénéiser les perles SPRI au vortex. Ajouter 45 µL de perles de température ambiante SPRI (90 % du volume) et bien mélanger en pipettant également de haut en bas.
    6. Laisser les échantillons à incuber pendant 5 min. mettre les tubes sur une plaque magnétique pendant 5 min.
    7. Soigneusement, enlever et jeter le surnageant qui contient l’ADN non désiré.
      Remarque : Veillez à ne pas déranger les billes qui contiennent les cibles d’ADN désirées.
    8. Ajouter 200 µL d’éthanol à 80 % frais aux tubes tandis que sur le support magnétique. Incuber à température ambiante pendant 30 s, puis soigneusement retirer et jeter le surnageant. Répétez cette opération une fois.
    9. Sécher à l’air les perles pendant 5 min alors que le tube est à la barre magnétique avec son couvercle ouvert.
      Remarque : Éviter de trop sécher les perles. Cela peut entraîner plus faible recouvrement de la cible de l’ADN.
    10. Retirer les tubes de l’aimant. Éluer la cible de l’ADN de la Perle en 33 µL de 0,1 x TE et homogénéiser par pipetage de haut en bas.
    11. Incuber à température ambiante pendant 5 min. tubes de Place sur le support magnétique et attendez que la solution mettre claire (environ 2 min).
    12. Retirer 30 µL du liquide surnageant. Les bibliothèques peuvent être conservés à-20 ° C pour le stockage à long terme.
  4. Contrôle de la qualité
    1. Exécutez un test de contrôle de la qualité sur les bibliothèques d’ADN. Se référer aux étapes 3.1 et 3.2. Pour les bibliothèques de l’ADN, exécutez le gel pour ~ 45 min à 96 V.
      Remarque : Si une double bande est visibles dans le gel, c’est probablement une conséquence de l’épuisement des amorces de l’étape de reamplification. Les bandes peuvent être enlevées en répétant 6,9, mais en utilisant seulement un cycle dans le programme PCR représenté dans le tableau 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolement d’ADN et le rendement Final de bibliothèque
Dans cette étude, l’efficacité du protocole pour l’isolement de l’ADN de l’herbier et la récupération des bibliothèques de séquençage de haute qualité a été démontrée à l’aide de cinquante différents échantillons avec la plus ancienne de 1920 et le plus jeune de 2012 (tableau 2). Pour chaque échantillon, environ 10 mg de tissus foliaires a été utilisé pour l’isolement de l’ADN. Les tissus foliaires plus verte a été favorisée si disponible, et aucun tissu avec évidente de la contamination fongique a été sélectionné. Isolement de succès peut être faite à l’aide de tissu jaune ou brun, bien que le rendement est censée être plus faible. Total double stranded DNA (dsDNA) dès l’isolement initial varie de 3,56 ng à 2 610 ng. Comme prévu, ADN obtenu à partir de spécimens d’herbier a été fortement dégradé (Figure 1 a, Supplement , Figure 1). Une partie de ces cas ont été utilisés pour enzymatique de cisaillement (GN 1,26 – 464). Bien que l’ADN de l’herbier est cisaillé déjà à travers le processus de préservation, optimisation du protocole exige cisaillement supplémentaires afin d’améliorer le rendement global de bibliothèque. Variait entre le recouvrement total de dsDNA après cisaillement < 1 à 51 % de l’ADN double brin d’entrée, résultant en un minimum de moins de 1,25 ng d’ADN de départ pour la préparation de bibliothèque et d’un maximum de 328 ng. La perte extrême de l’ADN dans certains échantillons peut être attribuée à la taille déjà petit fragment d’une grande partie de l’ADN avant enzymatique cisaillement (Figure 1 a, la Figure 1). L’utilisation d’un nettoyage de perle de 90 % du volume sur l’ADN cisaillé délibérément supprimé les plus petits fragments d’ADN d’enrichir pour les tailles de fragments plus gros et plus désirable. Ces petits fragments ont été surtout observés dans des échantillons TK463, TK657 et TK694, comme indiqué par un signal intense au niveau du repère de 100 paires de bases (Figure 1 a).

La quantité totale de la sélection de taille de message de bibliothèque variait entre 1,425 ng à 942,5 ng (tableau 2, la Table 1). Pour 23 des échantillons, la préparation initiale de l’extraction et la bibliothèque n’a donné une quantité adéquate de bibliothèque (< 10 nM ; Supplemental tableau 1 tableau 2), donc ces échantillons ont été soumis aux mesures reamplification et récupération du protocole, ayant pour résultat un x 14 – 680 augmenter dans la bibliothèque totale (tableau 2, la Table 1). Les bibliothèques finales a entraîné une bande comprise entre 350 et 500 paires de bases (Figure 1 b, Supplement , Figure 2). Parfois, une deuxième bande qui était supérieure à la taille attendue de bibliothèque a été observée (Figure 1 b, Supplement , Figure 2). Cela s’est produit quand la reamplification PCR épuisé des apprêts disponibles et mit à recuit adaptateurs bibliothèque de fragments d’ADN non homologue. Cela crée une molécule où les extrémités (les adaptateurs) ont été correctement recuit, mais l’insert d’ADN n’a pas. Cette molécule « propagée » est apparu plus grande sur un gel, qu’il se déplaçait plus lentement à travers la matrice du gel. Ces erreurs recuits ont été fixés par la préparation d’une nouvelle réaction de reamplification de la bibliothèque déjà reamplified et il fonctionne pour un seul cycle. Ce cycle unique prévue amorces recuit approprié et amplification, enlevant la deuxième bande (Supplemental Figure 3).

Reamplification des bibliothèques a facilité la concentration finale de bibliothèque d’au moins 10 nM. Ces concentrations autorisées des bibliothèques à diluer pour égaler la molarité et regroupées dans une représentation égale, aidant à nier les problèmes qui seraient survenu avec une qualité inégale échantillon et le séquençage de rendement de la bibliothèque. Si l’objectif d’un projet est génome chloroplastique séquençage, alors le montant total de séquençage nécessaires variera comme différentes lignées et tissus diffèrent dans le pourcentage total de lectures qui proviennent de l’ADN chloroplastique19. En règle générale, 50 – 100 x couverture projetée du génome chloroplastique est suffisante pour l’assemblage, et pistes de séquençage peuvent être mises en commun afin d’inclure autant de 70 personnes, selon les espèces et la méthode de séquençage.

Test de Contamination, de partialité et de Variation causée par Reamplification
Une préoccupation notable pour l’ordonnancement de l’HTS est introduction de biais dans les bibliothèques par le biais de vastes PCR amplification20. Pour tester les effets de reamplification et identifier les éventuelles biais applications phylogénétiques en commun de matériel d’herbier, nous avons comparé une bibliothèque avec succès séquencée (TK686) avec la même bibliothèque dilué 1:5 et réamplifié (désigné TK686-R). Les deux TK686 et TK686-R ont été séquencées sur un Illumina HiSeq4000 le centre de biotechnologies de l’Université de l’Illinois Roy J. Carver et la Michigan State University recherche technologie Support Facility, respectivement, à l’aide de 150 paires de bases appariées fin lit (voir Tableau 3 pour plus de détails de séquençage). Lectures brutes ont été déposés dans le NCBI SRA (SRP128083). Lectures ont été nettoyés à l’aide de Trimmomatic v.0.3621 y compris coupe d’adaptateur à l’aide de la séquence adaptateur de NEB, qualité de filtrage pour une note moyenne de REDSP de 20 pour une paire de bases 10 coulissante, et moins coupés de la taille de 40 paires de bases. Comme l’un des problèmes principaux avec des spécimens d’herbier est une contamination fongique, la contamination a été estimée en mappant lectures contre une partie de la MycoCosm de JGI génome fongique de base de données22 (312 génomes nucléaires et des génomes mitochondriaux 79) à l’aide de bowtie2 v . 2.2.923 en utilisant le jeu de paramètres « très-sensible-local ». Bibliothèques TK686 et TK686-R étaient indiscernables dans nuclear contamination fongique (9,24 % et 9,68 %, respectivement) et la contamination fongique mitochondriale (0,94 % et 0,8 %) (Tableau 3). Si ce n’est qu’un exemple, elle laisse entendre que la contamination fongique des échantillons d’herbier n’est pas négligeable et doit être retirée avant d’utiliser les données de séquences dérivées herbier. Les commandes permettant de repérer et d’éliminer la contamination fongique et la base de données se trouvent dans le dépôt GitHub de M. R. McKain génomique de l’herbier24.

Le séquençage du génome chloroplastique est couramment utilisé pour les analyses phylogénétiques, et spécimens d’herbier sont de plus en plus utilisés comme source de matière12. Afin de tester la fidélité de reamplification dans l’assemblage du génome chloroplastique, génomes chloroplastiques pour TK686 et TK686-R ont été assemblés à l’aide de Fast-Plast v.1.2.525 sous paramètres par défaut avec l’index du nœud papillon Poales la valeur. Un génome chloroplastique complète a été obtenu pour TK686-R, mais le génome chloroplastique TK686 a été assemblé en sept contigs en raison de la plus faible profondeur. Les contigs de TK686 ont été assemblés manuellement après McKain et al. 26 les génomes chloroplastiques entièrement assemblé étaient alignés les uns aux autres dans un logiciel d’alignement basé sur l’interface (voir Table des matières) et la variation entre les assemblées a été évaluée. Un total de 12 SNP et un indel ont été identifiées entre les assemblages de chloroplaste pour TK686 et TK686-R. Pour chaque variante, la couverture a été évaluée dans des jeux de lecture à la fois TK686 et TK686-R. Dans tous les cas, la variante la plus courante est la même entre les deux bibliothèques. TK686 a démontré un T→C un G→A, un G→T, un G→-, un C→A, un T→A et quatre variantes C→A. Cinq de ces variantes s’est produite dans la chaîne homopolymère, suggérant que leur incorporation dans l’Assemblée pourrait être le résultat d’une erreur de séquençage et de faible taux de couverture globale. Les autres peuvent avoir été le résultat de la variation de haplotype chloroplastique, erreur de séquençage ou désamination de la cytosine, ou une combinaison de ces facteurs. TK686-R avait un C→T, un G→T et un A→G. Les variantes C→T et G→T ont été trouvés dans un homopolymère comme ci-dessus. En fin de compte, les génomes chloroplastiques complète identiques ont été identifiées dans les deux ensembles de lecture. Un génome chloroplastique unique de TK686 a été annoté à l’aide de verdure21 et par rapport aux autres membres de la tribu des Andropogoneae. Toutes les fonctionnalités standard de chloroplastes ont été annotées : 8 rRNA, 38 ARNt et 84 gènes de codage de protéine. Le génome chloroplastique complet est disponible chez GenBank (MF170217) et verdoyant27.

Les biais potentiels de la reamplification des bibliothèques a aussi déterminé par l’estimation du pourcentage de GC et le transposon estimatif total contenu. Pourcentage GC a été estimée à l’aide d’un script personnalisé24. Différences dans le contenu en GC des deux échantillons étaient négligeables, avec 49,7 % GC à TK686 et 51,2 % GC TK686-r Composition du transposon a été estimée à l’aide de Transposome28. Pour les deux bibliothèques, 100 000 lectures étaient aléatoirement échantillonnées et composition du transposon a été estimée à l’aide d’une identité pourcentage de 90, une couverture de fraction de 0,55, une taille de cluster de 100 et la référence de répéter herbe RepBase 21.1029. Cela a été répété 100 fois pour effectuer l’amorçage sur l’estimation de transposon de ces ensembles de données. Pourcentages de génome total pour grandes sous-familles de transposons ont été extraites de sortie de Transposome, et la moyenne et l’écart de ces pour les 100 répétitions ont été estimées. Tous les scripts utilisés pour générer ces sorties se trouvent dans le dépôt Github de M. R. McKain Transposons30, et tous les résultats ont été déposés dans la dryade (doi:10.5061/dryad.r8t2m). En utilisant les deux sous-familles de transposon plus répandus comme indicateurs (terminal longCopia et gitane Répétez les rétrotransposons), les résultats étaient presque identiques avec Copia à 33,52 ± 4.00 % et de 31,68 Gypsy -± 2,94 % à ± 24.83 2,72 % et ± 24.00 2,35 % à TK686 et TK686-R, respectivement (tableau 3). Ces résultats suggèrent que l’étape reamplification du présent protocole ne créait pas de biais de séquençage significatif pour mesures de génome de haut niveau. Toutefois, il est à noter que cet exemple unique ne peut pas être pleinement représentatif de toutes les bibliothèques reamplified. Ce test unique montre que l’étape reamplification n’était pas intrinsèquement biaisant métrique de génome en TK686/TK686-R. Partialité introduite n’affecterait pas l’assemblage du génome chloroplastique donné une couverture suffisante de séquençage, mais il est recommandé que, tel que présenté dans cette étude avec TK686/TK686-R, s’expérimente sur des lignées de cible pour vérifier que la partialité n’est pas survenant au cours d’études portant sur la diversité de l’élément transposable.

Figure 1
Figure 1: images de gel d’Agarose de A) isolement d’ADN et les bibliothèques de séquençage B) final de dix spécimens d’herbier. Pour chaque voie, 3 µL d’ADN ou de la bibliothèque a été utilisée. (A) l’ADN a été dégradé dans tous les isolements de herbier comme en témoigne le frottis en général. Bibliothèques de séquençage Final (B) représentent un groupe primaire de 300 à 500 paires de bases avec une distribution plus large de 200-1 000 paires de bases ; ce dernier est plus répandu dans les bibliothèques réamplifiés. Voies pour les deux (A) et (B) ont été identifiés par exemple et peut être comparé aux résultats dans le tableau 2. Taille de l’échelle a été dépeint en paires de bases (PB). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Placettes circulaires de Schizachyrium scoparium Génome chloroplastique (TK686) avec annotation. Le génome entièrement assemblé de séquençage de fusil de chasse de l’ADN dérivé herbier présentait une longueur totale de 139 296 paires de bases (PB), une région de grand exemplaire unique (LSC) de 81 401 bp, une région de répétition inversée (IR) de 22 669 bp et une petite copie unique région (SSC) de 12 557 BP. Tous les standards gènes codant des protéines, ARNt et ARNr pour les membres de la tribu des Andropogoneae ont été identifiés dans l’annotation. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Tableau 2 : Résultats de préparation d’extraction et de la bibliothèque de l’ADN pour dix échantillons d’herbier et quatre bibliothèques réamplifiés. Le total ADN bicaténaire à diverses étapes dans le protocole a démontré comment variable qualité peut être, surtout quand filtré pour la taille. S’il vous plaît cliquez ici pour télécharger ce tableau.

Tableau 3 : séquençage des statistiques pour TK686 et le TK686R reamplified. Reamplification n’affecte pas l’incidence globale de contamination fongique génome, GC contenue estimation, estimation de composition transposon ou la capacité d’assembler les génomes chloroplastiques ensemble. S’il vous plaît cliquez ici pour télécharger ce tableau.

Supplémentaire tableau 1 : résultats d’ADN extraction et bibliothèque préparation pour quarante échantillons d’herbier supplémentaires, y compris les vingt bibliothèques réamplifiés. Total ADN bicaténaire à diverses étapes dans le protocole a démontré comment variable qualité peut être, surtout quand filtré pour la taille. S’il vous plaît cliquez ici pour télécharger ce tableau.

Supplémentaire Figure 1 : images de gel d’Agarose de quarante supplémentaires isolement de l’ADN de spécimens d’herbier. Les deux (A) et (B) met en scène vingt isolement d’ADN distinctes et démontrer la dégradation caractéristique de l’ADN dérivé herbier. Pour chaque voie, 3 µL de l’ADN a été utilisé. Voies pour les deux (A) et (B) ont été identifiés par exemple et peut être comparé aux résultats dans la Table 1. Taille de l’échelle est représentée en paires de bases (PB). Blanc taches sur l’image sont en raison des artéfacts de l’imageur de gel qui ne peut pas être supprimé avec nettoyage. S’il vous plaît cliquez ici pour télécharger ce chiffre.

Supplémentaire Figure 2 : images de gel d’Agarose de quarante bibliothèques supplémentaires de séquençage d’ADN dérivé de herbier. Pour chaque voie, 3 µL de bibliothèque a été utilisée. Bibliothèques de séquençage final sont trouvent dans les deux (A) et (B) avec une taille moyenne de 300 à 500 paires de bases. Bandes secondaires vus dans certains échantillons amplifiés suggèrent « bulles » des bibliothèques. Voies pour les deux (A) et (B) sont identifiés par exemple et peut être comparé aux résultats dans la Table 1. Taille de l’échelle est représentée en paires de bases (PB). S’il vous plaît cliquez ici pour télécharger ce chiffre.

Supplémentaire Figure 3 : image de gel d’Agarose de retrait de la bande secondaire avec une étape PCR cycle unique supplémentaire. S’il vous plaît cliquez ici pour télécharger ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le protocole présenté ici est une méthode complète et robuste pour l’isolement de l’ADN et le séquençage de préparation de la bibliothèque de spécimens de plantes séchées. La cohérence de la méthode et de la nécessité minimale de l’altérer basé sur spécimen qualité fais il évolutive pour les projets de grand séquençage axée sur l’herbier. L’inclusion d’une étape de reamplification en option pour les bibliothèques de faible rendement permet l’inclusion de basse qualité, faible quantité, rare ou des échantillons historiques importants qui autrement, ne serait pas appropriés pour le séquençage.

Importance du rendement d’ADN Initial
ADN dérivé herbier est souvent dégradée par suite de préservation spécimen initial11, avec l’ADN de spécimens moins de 300 ans vieux non-commercialisé dégradées que l’ADN isolé à partir des restes d’animaux qui sont plusieurs centaines à des milliers d’ans31 , 32. par conséquent, optimisation du rendement d’ADN initial est vitale à obtenir assez dsDNA de haute qualité pour la préparation de bibliothèque de séquençage réussi. Pour les espèces de graminées, un rendement optimal est atteint grâce à l’utilisation combinée de sable stérilisé et azote liquide dans la mouture initiale étape, fournissant une destruction plus complète des parois cellulaires et la libération des acides nucléiques. Cette approche augmente dsDNA plu désirable et indésirables plus petits fragments (Figure 1, la Figure 1, tableau 2, la Table 1). Étapes de nettoyage subséquent perle isoler et enrichissent des fragments d’une taille appropriée pour le séquençage (300 – 500 paires de bases), réduisant considérablement la récupération mais aussi enrichissante pour les fragments plus longues (tableau 2, la Table 1). Modifications des premières mesures d’isolement ADN peuvent être nécessaires, issu de la lignée à échantillonner afin de réduire les effets de métabolites secondaires, le traitement en aval,18.

Optimisation des adaptateurs de bibliothèque
La concentration des adaptateurs utilisé pour la ligature a une incidence directe sur le montant du dimère de l’adaptateur dans les bibliothèques de fini. Adaptateur dimères résultent d’individu-ligature adaptateur lorsque l’échantillon insuffisant est présent et contaminent le séquençage pistes33. Le dsDNA total relativement faible disponible à partir de spécimens d’herbier nécessite la dilution des adaptateurs avant la ligature. Adaptateurs se dilués 50 fois de la concentration en stock de 15 µM (voir la Section protocole) facilitation préparation de bibliothèque haut débit sans avoir besoin de mesurer individuellement et de diluer adaptateur pour chaque échantillon (tableau 2, tableau supplémentaire 1). bien qu’en principe saturation des adaptateurs pourrait diminuer le rendement des bibliothèque globale, il est peu probable que les spécimens d’herbier donnera ADN double brin dans ces excès d’adaptateur.

Variation en perle étapes de nettoyage pour des rendements plus élevés
Sélection de la taille en préparation des bibliothèques de séquençage se faite généralement après ligature de l’adaptateur, ce qui permet l’amplification de fragments principalement au sein de la gamme de taille désirée ; Cela se fait en retirant les fragments qui sont plus grandes et plus petites que la taille de la cible. La faible quantité de dérivés herbier dsDNA pour la préparation de la bibliothèque est exacerbée après sélection de la taille à cette étape, résultant en ADN double brin total trop faible et en fin de compte à faible rendement dans la bibliothèque de la finale. En procédant à une étape de perle-nettoyage standard à l’aide de perles de volume 90 % après ligature, plus dsDNA total reste pour l’enrichissement dans l’étape d’amplification. Très petits fragments d’ADN sont supprimés préférentiellement à l’aide de perles de volume de 90 %. Sélection de la taille est réalisée dans la dernière étape sur la bibliothèque amplifiée, ce qui assure l’enrichissement des tailles de fragment désiré. Le volume total de perles peut être ajusté pour sélectionner la plage souhaitée, bien que les volumes en deux étapes de 25 µL et 6 µL de perles sont optimisés pour récupérer des bibliothèques de 400 à 500 paires de bases insertions au sein de ce protocole (Figure 1 b, supplémentaire Figure 2).

Sauvetage d’échantillon par Reamplification de bibliothèques
Malgré les pratiques exemplaires dans l’isolement de l’ADN et préparation de la bibliothèque, la concentration finale de bibliothèques de séquençage peut être inadéquate de séquençage d’autres. Le caractère destructeur du matériel d’échantillonnage et souvent limité de spécimens d’herbier ne permet pas toujours répéter l’isolement d’ADN. Par reamplifying de la bibliothèque jusqu'à 12 cycles PCR supplémentaires, même exceptionnellement mauvaises bibliothèques peuvent être sauvegardés. Une paire d’amorces standard est utilisée pour l’amplification, qui est compatible avec les protocoles de chaque bibliothèque indexée double ou simple. Une préoccupation majeure pour les reamplification est l’introduction de partialité, souvent par le biais de réduction dans les parties riches en GC du génome20. En utilisant une polymérase de haute fidélité (voir Table des matières), ces biais potentiels sont potentiellement évités. Cela est démontré par la variation minimale du contenu en GC des bibliothèques séquencées TK686 et TK686-R (tableau 3). Comme une deuxième vérification, le contenu de transposon de TK686 et de TK686-R a été estimé et ne montre aucune différence perceptible (tableau 3). Enfin, le génome chloroplastique entier de cette adhésion a été assemblé à partir TK686 et TK686-R, qui a donné lieu à des séquences identiques après une inspection minutieuse de la variation de SNP entre les deux assemblées (Figure 2, tableau 3). Ces tests suggèrent que métriques génomique standard, tels que le contenu en GC et la composition du transposon et la capacité d’assembler les génomes chloroplastiques complète, ne peuvent pas être affectées par reamplification. Cela ouvre la possibilité d’intégrer herbier spécimens semblent être trop dégradée ou manque de matériel dans des études de phylogenomic sans souci pour les biais introduits par PCR. Ces bibliothèques reamplified peuvent également être utilisés pour la séquence de capture34, même s’il serait nécessaire de vérifier si l’appel du SNP est biaisée. Il est recommandé qu’effectuer des essais à petite échelle de partialité avec chaque projet afin de vérifier que partialité n’est pas introduite dans les bibliothèques de séquençage.

Limitations et Modifications éventuelles
Même si ce protocole a travaillé sur des centaines de spécimens d’herbier, mal conservés des tissus peuvent encore échouer à n’importe quelle étape. Toutefois, il est extrêmement rare pour les bibliothèques à l’échec des tissus avec les extractions d’ADN réussies, surtout après le sauvetage de la bibliothèque par l’intermédiaire de reamplification. Les étapes de sélection de taille peuvent être modifiées pour cibler les différents fragments de tailles ou de réduire l’éventail des fragments vus dans quelques bibliothèques finales. Comme avec tous les protocoles d’extraction végétale, étapes peuvent être nécessaires pour éliminer lignée spécifique des composés secondaires qui peuvent entraver le protocole global. Tel que présenté, ce protocole fournit une méthode standard pour la préparation d’ADN d’isolement et de haut débit bibliothèque pour les spécimens d’herbier de gazon et par le biais de vérification et d’expérimentation est susceptible d’être amendable d’autres lignées de plantes.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun intérêt concurrentes.

Acknowledgments

Nous remercions Taylor AuBuchon-Elder, Jordan Teisher et Kristina Zudock d’assistance dans les herbiers d’échantillonnage et le jardin botanique du Missouri pour l’accès aux spécimens d’herbier pour échantillonnage destructeur. Ce travail a été prise en charge par une subvention de la Fondation nationale des sciences (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics