Robust DNA isolasjon og høy gjennomstrømming sekvensering biblioteket konstruksjon for Herbarium prøver

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Denne artikkelen viser en detaljert protokoll for DNA isolasjon og høy gjennomstrømming sekvensering biblioteket bygging fra herbarium materiale inkludert redning av svært dårlig kvalitet DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria er en uvurderlig kilde til plantemateriale som kan brukes i en rekke biologiske studier. Bruk av herbarium er forbundet med en rekke utfordringer som eksempel bevaring kvalitet, degradert DNA og ødeleggende utvalg av sjeldne eksemplarer. Mer effektivt bruke herbarium materiale i store sekvensering prosjekter, er pålitelig og skalerbar metode DNA isolasjon og biblioteket forberedelser nødvendig. Dette dokumentet demonstrerer en robust, begynnelsen-til-ende protokoll for DNA isolasjon og høy gjennomstrømming biblioteket bygging fra herbarium prøver som ikke krever endringer for individuelle prøver. Denne protokollen er skreddersydd for lav kvalitet tørket plante materiale og tar fordel av eksisterende metoder ved å optimalisere vev sliping, endre biblioteket størrelse utvalg og innføre et valgfritt reamplification trinn for lav yield biblioteker. Reamplification lav yield DNA biblioteker kan redde prøver fra uerstattelige og potensielt verdifulle herbarium prøver, benektende behovet for ytterligere destruktive prøvetaking og uten introdusere merkbar sekvensering bias for vanlig Fylogenetiske programmer. Protokollen er testet på hundrevis av grasarter, men forventes å bli anvendelig for bruk i andre plante linjene etter bekreftelse. Denne protokollen kan begrenses av ekstremt degradert DNA, der fragmentene ikke finnes i området ønsket størrelse, og sekundære metabolitter i noen plantemateriale som hemmer ren DNA isolasjon. Samlet introduserer denne protokollen en rask og omfattende metode som tillater DNA isolasjon og biblioteket utarbeidelse av 24 prøvene i mindre enn 13 h, med bare 8 timer aktiv hands-on tid med minimale endringer.

Introduction

Herbarium samlinger er en potensielt verdifulle arter og genomisk mangfold for studier inkludert phylogenetics1,2,3, Populasjonsgenetikk4,5, konservering biologi6, invasiv Art biologi7og trekk utviklingen8. Muligheten til å få et rikt mangfold av arter, bestander, geografiske steder og tidspunkt høydepunkter "skattekiste"9 som herbarium. Historisk har degradert natur herbarium-avledet DNA hindret PCR-baserte prosjekter, ofte relegating forskere til å bruke bare indikatorer i høy kopien, for eksempel områder chloroplast genomet eller interne transkribert distansestykke (ITS) i ribosomal RNA. Kvaliteten på prøvene og DNA variere mye på metoder for bevaring9,10, med dobbel-strandet pauser og fragmentering av varme i tørking prosessen blir de vanligste formene for skader, skaper den såkalte 90% DNA Lås opp som har encumbered PCR-baserte studier11. Bortsett fra fragmentering er nest vanligste problemet i herbarium genomics forurensning, slik som avledet fra endophytic sopp13 eller sopp ervervet postmortem etter samling, men før montering i den herbarium12, skjønt Dette problemet kan bli løst bioinformatically gitt rett fungal databasen (se nedenfor). En tredje, og mindre vanlig, problemet er sekvensen modifisering gjennom cytosine deamination (C/G→T/A)14, selv om det anslås for å være lav (~ 0,03%) i herbarium prøver11. Med bruk av høy gjennomstrømming sekvensering (HTS), kan spørsmålet om fragmentering overvinnes med kort leser og sekvensering dybde12,15, la genomisk nivå datainnsamling fra mange prøver med lav kvalitet DNA, og noen ganger tillater hele genomet sekvensering15.

Herbarium prøver stadig oftere brukes og er en større del av Fylogenetiske prosjekter16. En gjeldende utfordring å bruke herbarium prøver for HTS er konsekvent få tilstrekkelig double-strandet DNA, en nødvendig forutsetning for sekvensering protokoller, fra mange arter i tide, uten å optimalisere metoder for enkelte prøver. I denne utredningen er en protokoll for DNA utvinning og biblioteket forberedelse av herbarium demonstrert som utnytter eksisterende metoder og modifiserer dem til å tillate rask og repliserbar. Denne metoden gir mulighet for full behandling fra prøven til et bibliotek av 24 prøver i 13 h, med 8 h hands-on tid, eller 16 h, 9 h hands-on tid, når det valgfrie reamplification trinnet kreves. Samtidig behandling av flere prøver er oppnåelig, men den begrensende faktoren er sentrifuge kapasitet og tekniske ferdigheter. Protokollen er utformet krever bare vanlig laboratoriumutstyr (thermocycler, sentrifuger og magnetiske står) i stedet for spesialisert utstyr, som en forstøveren eller sonicator, for shearing DNA.

DNA kvalitet, fragment størrelse og antall er begrensende faktorer for bruk av herbarium høy gjennomstrømming sekvensering eksperimenter. Andre metoder for å isolere herbarium DNA og lage høy gjennomstrømming sekvensering biblioteker har vist verktøyet å bruke så lite som 10 ng DNA16; men de krever eksperimentelt bestemme optimal antall PCR sykluser kreves for biblioteket forberedelse. Dette blir upraktisk når håndtere meget små mengder levedyktig dobbel strandet DNA (dsDNA), som noen herbarium eksemplarer produserer bare nok DNA for en enkelt bibliotek forberedelse. Metoden som presenteres her bruker en enkelt antall sykluser uavhengig av eksempel kvaliteten, så ingen DNA er tapt i biblioteket optimering skritt. I stedet startes et reamplification skritt når biblioteker ikke oppfyller du minimumsbeløpene som kreves for sekvenser. Mange herbarium prøver sjeldne og svært lite stoff vanskelig å rettferdiggjøre destruktive prøvetaking i mange tilfeller. Mot dette presentert protokollen tillater dsDNA inngang størrelser mindre enn 1,25 ng i biblioteket forberedelsesprosessen, utvide omfanget av levedyktig prøver for høy gjennomstrømming sekvensering og minimere behovet for destruktive prøvetaking av prøver.

Følgende protokollen er optimalisert for gress og testet på hundrevis av forskjellige arter fra herbarium prøver, men vi forventer at protokollen kan brukes til mange andre plante grupper. Det inkluderer et valgfritt utvinning skritt som kan brukes til å lagre lav kvalitet og/eller sjeldne eksemplarer. Basert på over to hundre herbarium prøvene testet, fungerer denne protokollen på prøver med lav vev input og kvalitet, slik at for bevaring av sjeldne eksemplarer gjennom minimal destruktive prøvetaking. Her er det vist at denne protokollen kan gi høy kvalitet biblioteker som kan være sekvensert for phylogenomics-baserte prosjekter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. før å starte

  1. Gjør frisk cetyl trimethylammonium bromide (CTAB) buffer17 ved å legge til 20 g CTAB, 10 g polyvinylpyrrolidone (PVP) 40, 100,0 mL 1 M Tris pH 8.0, 40 mL 0,5 M ethylenediaminetetraacetic syre (EDTA) pH 8.0, 280.0 mL 5 M NaCl og 400.0 mL reagens vann sammen, og bringe det totale volumet til 1 L bruker reagens-grade vann. Justere pH til 8.0.
    Merk: Flere reagenser kan legges til CTAB avhengig av sekundær forbindelser i individuelle taxa. Se Allen et al. 18 en grundig liste over additiv reagenser.
  2. Legge til 10 µL av β-mercaptoethanol per 5 mL av CTAB buffer.
    Merk: Dette kan være forberedt i grupper på 50 mL og oppbevares ved romtemperatur for 3-4 uker.
    1. Varme CTAB løsningen i en 65 ° C vannbad.
  3. Chill bombekastere og støtere i 20 ° C i minst 20 min.
  4. Etikett 4 sett med 2 x n 2-mL rør (der n = antall utdrag). Sett 1 sett med merket rørene på is.
  5. Chill isopropanol på isen eller i en 20 ° C fryser.
  6. Fjern solid fase reversibel immobilisering (SPRI) perler (se Tabell for materiale) fra kjøleskapet, og tillate dem å equilibrate til romtemperatur (minst 30 min).
  7. Forberede 80% etanol.
  8. Velg herbarium prøver for utvinning og hente ~ 1 cm2eller 10 mg, vev per prøven, fortrinnsvis blad materiale.

2. DNA utvinning

  1. Grind ~ 1 cm2 forhåndsvalgt herbarium tissue benytter prechilled bombekastere og støtere. Legge til flytende nitrogen og 30-50 mg sterilisert sand. Grind til vev blir til pulver.
    Merk: 10 mg eller mer vev er ønskelig, men mindre har også jobbet i noen tilfeller. Når flytende nitrogen fordamper, legge mer etter behov til vev er fullt bakken. En annen vanlig måte forstyrre celler og vev er bruken av en perle-beater. Men ble denne metoden funnet å ikke fungerer godt for prøvene disse forsøk.
  2. Transfer frosne pulveret inn to 2 mL rør (legge til mer enn halvparten av tuben volum). Legg 600 µL av varm CTAB løsning til hver rør og bland rør grundig av inversjon og vortexing.
    Merk: Siden kvantitet og kvalitet av herbarium materiale er ofte lav, utfører DNA isolasjon på to repetisjoner bidrar til å oppnå høyere avkastning.
  3. Inkuber prøvene i en 65 ° C vannbad for 1-1,5 t, vortexing hvert 15 min.
  4. Sentrifuger eksempler på 10.000 x g for 5 min. overføre nedbryting til et nytt sett med etiketter rør (~ 500 µL). Kast pellet bruker en standard ikke-klorerte fjerning prosedyre.
  5. Legg 4 µL av RNase-A (10 mg/mL) til hver rør og bland invertere eller pipettering. Inkuber prøvene på 37 ° C i en varme blokk eller vann bad i 15 min.
  6. Legge til en like volum (~ 500 µL) av en 25:24:1 fenol: kloroform: isoamyl alkohol blanding når rørene har nådd romtemperatur. Bland godt av pipettering opp og ned / med inversjon. Sentrifuger rørene på 12.000 x g i 15 min. overføre vandig laget (øverste lag) til et nytt sett med merket rør (~ 400 µL). Kast organisk laget i en klorerte avfallsbeholderen.
    Merk: Trinn 2.6 kan gjentas hvis store mengder sekundære forbindelser forventes i plantemateriale.
  7. Legge til en like volum (~ 400 µL) av en 24:1 kloroform: isoamyl alkohol blanding. Bland godt av pipettering opp og ned / med inversjon. Sentrifuge rørene på 12.000 x g i 15 min. overføring vandig laget (øverste lag) til et nytt sett med prechilled, merket rør (~ 300 µL). Kast organisk laget i en klorerte avfallsbeholderen.
  8. Legge til en like volum (~ 300 µL) prechilled isopropanol og 12 µL av 2.5 M natrium acetate hver rør. Inkuber samples ved 20 ° C i 30-60 minutter.
    Merk: Inkubasjon tider kan utvides (til overnatting inkubasjon), men DNA kvaliteten reduseres lenger prøvene ruge.
  9. Ta prøver ut av fryseren og sentrifuger rørene på 12.000 x g i 15 min. fjerne og slette nedbryting forsiktig uten å forstyrre pellet. Vask pellet av suspensjon med fersk 70% etanol (ca 300-500 µL). For hver doblet prøve, konsolidere to individuelle pellets til med tilhørende etanol.
    Merk: Utvalg skal konsolideres i en tube med etanol først og Fortsett. Det er ikke nødvendig å vaske hvert utvalg med etanol separat.
  10. Sentrifuge rørene på 12.000 x g for 10 min. Fjern og kast nedbryting forsiktig uten å forstyrre pellet. Luften tørr pellets.
    Merk: Utvalg kan tørkes raskere med en tørr blokk (ikke overstiger 65 ° C). Kontroller at prøvene ikke over tørr som dette kan redusere siste avkastningen av DNA.
  11. Avbryte isolert DNA 50 µL av 1 x TE. Lagre i 20 ° C fryseren for langtidslagring eller 4 ° C for bruk i neste uke.

3. kvalitetskontroll (QC)

  1. Kjøre en agarose gel for kvalitetskontroll.
    1. Forberede en 1 x Tris/Borate/EDTA (TBE) buffer ved å legge til 54 g Tris base og 27.5 g borsyre 3.75 g EDTA disodium salt, bringe det totale volumet til 5 L bruke reagens klasse vann.
    2. Forberede en 1% agarose gel ved å legge 1 g agarose til 100 mL 1 x TBE. Mikrobølgeovn løsningen til ingen agarose er synlig. Legge til 0,01% nukleinsyre gel flekker (se Tabell for materiale). La kolbe kjøle til den er varm å berøre. Bland godt omrøring. Hell agarose i en gel skuff og la det sitte før det stivner.
    3. Bland 3 µL av prøven, 2 µL reagens klasse vann og 1 µL av 6 x lasting fargestoff. Laste inn eksemplene i gel matrise, bemerker rekkefølgen.
    4. Kjør prøvene i 60-70 min på 60-70 V. bilde gel under UV-lys med korrekt eksponering og fokus.
      Merk: Tilstedeværelsen av en klar molekylvekt band er et tegn på høy kvalitet DNA, mens utstryk vanligvis indikerer DNA degradering. De fleste herbarium prøver er degradert.
  2. Kjør en dsDNA kvantifisering analyse (se tabell of Materials) til å bestemme mengden av dobbel strandet DNA.
    1. Bruk 2 µL av prøve for analyse.
      Merk: Fortynninger kreves ikke for kvantifisering analyse av herbarium materiale som de pleier å være i minimale mengder. Vellykket biblioteker er gjort fra som 1,26 ng totalt dsDNA dette trinnet.

4. DNA skråstilling

Merk: Dette er en optimalisert versjon av en kommersiell double-strandet fragmentase protokollen (se Tabell for materiale).

  1. Sted dsDNA fragmentering enzym på is etter vortexing for 3 s.
  2. I et sterilt 0,2 mL polymerase kjedereaksjon (PCR) rør isolert blanding 1 – 16 µL DNA med 2 µL av medfølgende fragmentering reaksjon buffer. Bringe det totale volumet til 18 µL ved å legge nuclease gratis vann. Legge til 2 µL dsDNA fragmentering enzym og virvle blandingen for 3 s.
    Merk: Mengden av DNA trengs varierer avhengig av DNA konsentrasjon (målet for 200 ng totalt i røret).
  3. Inkuber prøvene på 37 ° C i 8,5 minutter. Deretter legge til 5 µL av 0,5 M EDTA rørene.
    Merk: Dette trinnet må utføres så snart inkubasjonstiden er avslutte reaksjonen og hindre DNA-prøver fra over klipping.

5. perle opprydding

  1. Homogenize SPRI perler av vortexing.
  2. Bringe det totale volumet av skåret DNA til 50 µL ved å legge til 25 µL nuclease gratis vann. Legge til 45 µL av romtemperatur SPRI perler (90% volum) 50 µL av skåret DNA og bland godt av pipettering opp og ned.
    Merk: Legge perler på 90% av totale eksempel volumet er gjort for å fjerne den minste av DNA, ofte under 200 base parene.
  3. La prøvene ruge 5 min. satte rørene på en magnetisk plate og la dem sitte i 5 min. nøye kast nedbryting.
    Merk: Være forsiktig for ikke å forstyrre perler, som de inneholder ønsket DNA målene.
  4. Legge til 200 µL av fersk 80% etanol rør mens på magnetiske stand. Inkuber ved romtemperatur for 30 s nøye fjerne og forkaste nedbryting. Gjenta dette trinnet når. Lufttørke perlene i 5 min mens røret er på magnetiske stand med sine lokk åpent.
    Merk: Unngå over tørking perler. Dette kan resultere i lavere utvinning av DNA.
  5. Fjern rørene fra magneten. Elute DNA fra perler til 55 µL av 0,1 x TE og bland godt av pipettering opp og ned. Ruge ved romtemperatur for 5 min. sted rør på magnetiske stå og vente løsningen å slå klar (~ 2 min).
  6. Trekke av 52 µL nedbryting av. Kjøre en DNA kvantifisering analyse på prøvene å sjekke utvinning og den innledende konsentrasjonen som går inn i biblioteket prep.
    Merk: Biblioteker er gjort med totalt dsDNA anslått til mindre enn 1,25 ng, men i hvert fall reamplification var nødvendig.

6. biblioteket forberedelse

Merk: Dette er en modifisert versjon av en kommersielt tilgjengelig biblioteket kit (se Tabell for materiale -protokollen).

  1. Slutten Prep
    1. Legg 3 µL endonuclease og fosfat tailing enzymer og 7 µL av medfølgende reaksjon buffer til 50 µL av renset, skråstilte DNA. Bland godt av pipettering opp og ned. Spinne rør for å fjerne bobler.
      Merk: Det totale volumet skal 60 µL.
    2. Sett prøvene i en thermocycler med følgende program: 30 min ved 20 ° C, 30 min ved 65 ° C, hold på 4 ° C.
      Merk: Oppvarmet lokket ble satt til ≥75 ° C
  2. Adapter Ligation
    1. Fortynne adapteren 25-50 brett (arbeider adapter konsentrasjon av 0.6-0,3 µM). Legge til 30 µL av hemorroider master mix og 1 µL av hemorroider enhancer 2,5 µL av adapter for høy gjennomstrømming kort Les sekvensering rørene.
      Merk: Det totale volumet skal 93.5 µL.
    2. Bland godt av pipettering opp og ned. Spinne rør for å fjerne bobler. Inkuber rør på 20 ° C i 15 min.
    3. Legge 3 µL av kommersiell blanding av uracil DNA glycosylase (UDG) og DNA glycosylase-lyase Endonuclease VIII (se Tabell of Materials) til rør. Kontroller at det totale volumet er 96,5 µL. Bland godt og ruge på 37 ° C i 15 min med en thermocycler.
      Merk: Lokket bør settes til ≥47 ° C. Den opprinnelige versjonen av kommersielle protokollen har størrelse utvalg etter adapter ligation trinn, etterfulgt av en perle opprydding som det siste trinnet. Denne protokollen, som gir høyere avkastning, bytter rekkefølgen på trinnene og implementerer størrelse utvalg som et siste skritt.
  3. Diskopprydding fjerner enzymer og små fragmenter
    1. Homogenize magnetiske perler av vortexing.
    2. Legg 78 µL av SPRI magnetiske perler (80% volum) og bland godt av pipettering opp og ned.
      Merk: Legge perler på 80% av totale eksempel volumet er gjort for å fjerne de laveste DNA fragmentene, som ofte er kortere enn 250 base parene. Strengere fjerning av små DNA fragmenter er å (i) fjerne overflødige adaptere og (ii) fremheve forsterkning av større i fremgangsmåten.
    3. La prøvene ruge for 5 min. sette rør på en magnetisk plate for 5 min. nøye fjerne og slette nedbryting som inneholder DNA utenfor den ønskede størrelsen.
      Merk: Pass på ikke å forstyrre perler som inneholder ønsket DNA målene.
    4. Legge til 200 µL av fersk 80% etanol rør mens på magnetiske stand. Inkuber ved romtemperatur for 30 s nøye fjerne og forkaste nedbryting. Gjenta dette trinnet når. Lufttørke perlene i 5 min mens røret er på magnetiske stand med lokk åpent.
      Merk: Unngå over tørking perler. Dette kan resultere i lavere utvinning av DNA.
    5. Fjern rørene fra magneten. Elute DNA målet fra perler ved å legge til 17 µL av 0,1 x TE og bland godt av pipettering opp og ned.
    6. Ruge ved romtemperatur for 5 min. sted rør på magnetiske stå og vente løsningen å slå klar (~ 2 min).
    7. Trekke av 15 µL nedbryting av.
  4. PCR forsterkning
    1. Legge til 25 µL Hi-Fi PCR master mix, 5 µL av høy gjennomstrømming kort lese sekvensering biblioteket prep 5' primer og 5 µL av høy gjennomstrømming kort Les sekvensering biblioteket prep 3' primer, 15 µL av renset adapter-samskrevet DNA.
      Merk: Totalt volum skal 50 µL.
    2. Bland godt vortexing. Sett prøvene i en thermocycler ved hjelp av innstillingene i tabell 1: Thermocycler forsterkning innstillingen.
      Merk: Et stort antall sykluser er nødvendig på grunn av lavt antall inn DNA.
Syklus trinn Temp. Tid Sykluser
Første rødsprit 98 ° C 30 s 1
Rødsprit 98 ° C 10 s 12
Avspenning/Extension 65 ° C 75 s 12
Endelig utvidelse 65 ° C 5 min 1
Hold 4 ° C

Tabell 1: PCR protokollen rødsprit, avspenning, og filtypen ganger og temperaturer. Temperatur og ganger var optimalisert for reagenser presentert i denne protokollen. Hvis reagenser er endret, skal temperaturer og ganger optimaliseres igjen.

  1. Størrelse utvalg for ønsket biblioteket størrelse
    Merk: Denne perlen trinn fjernes fragmenter både over og under målområdet.
    1. Homogenize SPRI perler av vortexing.
    2. Legg 25 µL (50% volum) i romtemperatur magnetiske perler og bland godt av pipettering opp og ned. La prøvene ruge 5 min. satte rørene på en magnetisk plate og la dem sitte i 5 min. nøye fjerne og overføre nedbryting til et nytt sett med etiketter rør.
      Merk: Dette volumet kan bli justert basert på ønsket biblioteket størrelse. Nedbryting inneholder DNA fragmenter av ønsket størrelse. I den første perle inkubering, er perler bindende større bibliotek fragmenter. Disse er fjernet å fokusere på de 400-600 base par området. Nedbryting inneholder mindre fragmenter.
    3. Legge til 6 µL av romtemperatur SPRI perler til nedbryting og blanding grundig ved pipettering opp og ned. La prøvene ruge 5 min. satte rørene på en magnetisk plate og la dem sitte i 5 minutter.
      Merk: Dette volumet kan bli justert basert på ønsket biblioteket størrelse i henhold til trinn 6.5.2.
    4. Nøye fjerne og slette nedbryting.
      Merk: Pass på ikke å forstyrre perler som inneholder ønsket DNA. I den andre perle inkubering binder perler til fragmenter etter første fjerning av største DNA fragmenter. Fragmenter ligger vanligvis i området ønsket størrelse.
    5. Legge til 200 µL av fersk 80% etanol rør mens på magnetiske stand. Inkuber ved romtemperatur for 30 s, deretter forsiktig fjerne og slette nedbryting. Gjenta. Lufttørke perlene i 5 min mens røret er på magnetiske stand med lokk åpent.
      Merk: Unngå over tørking perler. Dette kan resultere i lavere utvinning av DNA.
    6. Fjern rørene fra magneten. Elute DNA målet fra perler til 33 µL av 0,1 x TE og bland godt av pipettering opp og ned.
    7. Ruge ved romtemperatur for 5 min. sted rør på magnetiske stå og vente løsningen å slå klar (~ 2 min). Trekke av 30 µL av nedbryting og overføring til 2 mL rør (se Tabell for materiale) for lagring.
      Merk: Bibliotekene kan holdes på-20 grader for langtidslagring.
  2. Kvalitetskontroll
    1. Kjøre en kvalitetskontroll test på DNA bibliotekene. Se trinn 3.1 og 3.2.
      Merk: For DNA biblioteker, kjøre gel i ~ 45 min 96 V.
  3. Bibliotek reamplification: valgfritt Hvis biblioteket antallet ikke er tilstrekkelig.
    Merk: Eksempler med biblioteket konsentrasjoner under 10 nM kan være reamplified på følgende måte. Reamplification lav konsentrasjon biblioteker kan oppnå gode resultater for sekvenser, men reamplification kan forårsake en beskjeden endring i base sammensetning mangfold, men samlet data (tabell 3) tyder på at dette er ubetydelig for visse beregninger .
    1. Fortynne universell reamplification primerne 10-fold med 0,1 x TE.
    2. Legge til 25 µL Hi-Fi PCR master mix, 5 µL av utvannet universell reamplification primer 1 (AATGATACGGCGACCACCGA) og 5 µL av utvannet universell reamplification primer 2 (CAAGCAGAAGACGGCATACGA) 15 µL av lav konsentrasjon biblioteker. Merk: Totale volumet bør være 50 µL.
    3. Bland godt vortexing. Sett prøvene i en thermocycler ved hjelp av innstillingene i tabell 1: Thermocycler forsterkning innstillingen
      Merk: Det store antallet sykluser er nødvendig på grunn av lavt antall inn DNA.
    4. Perle opprydding
    5. Homogenize SPRI perler av vortexing. Legg 45 µL av romtemperatur SPRI perler (90% volum) og bland godt av pipettering opp og ned.
    6. La prøvene ruge for 5 min. satte rørene på en magnetisk plate i 5 min.
    7. Nøye fjerne og slette nedbryting som inneholder uønskede DNA.
      Merk: Pass på ikke å forstyrre perler som inneholder ønsket DNA målene.
    8. Legge til 200 µL av fersk 80% etanol rør mens på magnetiske stand. Inkuber ved romtemperatur for 30 s, og deretter forsiktig fjerne og slette nedbryting. Gjenta dette trinnet når.
    9. Lufttørke perlene i 5 min mens røret er på magnetiske stand med sine lokk åpent.
      Merk: Unngå over tørking perler. Dette kan resultere i lavere utvinning av DNA målet.
    10. Fjern rørene fra magneten. Elute DNA målet fra perler til 33 µL av 0,1 x TE og bland godt av pipettering opp og ned.
    11. Ruge ved romtemperatur for 5 min. sted rør på magnetiske stå og vente løsningen å slå klar (~ 2 min).
    12. Trekke av 30 µL nedbryting av. Biblioteker kan lagres på 20 ° C for langtidslagring.
  4. Kvalitetskontroll
    1. Kjøre en kvalitetskontroll test på DNA bibliotekene. Se trinn 3.1 og 3.2. For DNA biblioteker og kjøre gel i ~ 45 min på 96 V.
      Merk: Hvis en dobbel bandet er sett i gel, er dette sannsynligvis en konsekvens av primer utmattelse fra reamplification trinn. Feltene kan fjernes ved gjentatt 6,9, men bruker bare en syklus i programmet PCR avbildet i tabell 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA isolasjon og endelige biblioteket avkastning
I denne studien ble effekten av protokollen for isolering av herbarium DNA og utvinning av høy kvalitet sekvensering biblioteker demonstrert med 50 forskjellige prøver med den eldste 1920 og den yngste fra 2012 (tabell 2). For hver prøve, var ca 10 mg av blad vev brukes for DNA isolasjon. Grønnere blad vev ble foretrukket hvis tilgjengelig, og ingen vev med åpenbare fungal smitte ble valgt. Vellykket isolasjoner kan gjøres ved hjelp av gule eller brune vev, men yield bør forventes å bli lavere. Totalt dobbel strandet DNA (dsDNA) av den første varierte fra 3.56 ng til 2610 ng. Som forventet, DNA fra herbarium prøvene var svært degradert (figur 1A, Supplemental figur 1). En del av disse isolasjoner ble brukt for enzymatisk skråstilling (1.26-464 ng). Om herbarium DNA er allerede skåret gjennom bevaring prosessen, krever optimalisering av protokollen ytterligere skråstilling for å forbedre generelle biblioteket avkastning. Total utvinning av dsDNA etter klipping varierte fra < 1% til 51% av input dsDNA, noe som resulterer i minst mindre enn 1,25 ng Start DNA for biblioteket forberedelse og maksimalt 328 ng. Ekstreme tapet av DNA i eksempler kan tilskrives allerede lite fragment størrelsen på mye av DNA før enzymatisk klipping (figur 1A, supplerende figur 1). Bruk av en 90% volum perle opprydding på skråstilte DNA fjernet hensikt de minste fragmentene av DNA å berike for større, mer attraktive fragment størrelser. Disse små fragmenter ble spesielt sett i prøver TK463, TK657 og TK694, som angitt av en intens signalet på 100 base par merket (figur 1A).

Det totale antallet biblioteket innlegget størrelse utvalg varierte fra 1.425 ng til 942.5 ng (tabell 2, supplerende tabell 1). For 23 av prøvene, første ekstraksjon og bibliotek utarbeidelse ikke gi en tilstrekkelig mengde bibliotek (< 10 nM; Tabell 2, supplerende tabell 1), så disse prøvene ble utsatt for reamplification og gjenoppretting trinnene av protokollen, som resulterer i en 14-680 x økning i total bibliotek (tabell 2, supplerende tabell 1). Siste biblioteker resulterte i et band mellom 350 og 500 base parene (figur 1B, Supplemental figur 2). Til tider, et andre band som var større enn forventet biblioteket størrelse ble sett (figur 1B, Supplemental figur 2). Dette skjedde da reamplification PCR oppbrukt tilgjengelig primere og begynte annealing biblioteket adaptere av ikke-homologe DNA. Dette skaper et molekyl der endene (adaptere) var riktig annealing, men DNA innsatsen ikke. Dette "boblet" molekylet dukket opp mer på en gel, ettersom den beveget seg sakte gjennom gel matrix. Feilene annealing ble løst ved å forberede en reamplification reaksjonen fra allerede reamplified biblioteket og kjører det for en enkelt syklus. Dette enkelt syklus angitt primere for riktig avspenning og forsterkning, fjerne andre bandet (supplerende figur 3).

Reamplification av bibliotekene tilrettelagt siste biblioteket konsentrasjoner av minst 10 nM. Disse konsentrasjonene tillatt biblioteker fortynnes likestilling molarity og gruppert i samme representasjon, bidrar til å oppheve problemer som ville ha oppstått med ulik eksempel kvalitet og sekvensering biblioteket avkastning. Hvis målet for et prosjekt er chloroplast genomet sekvensering, deretter den totale mengden sekvensering trengs varierer som forskjellige overleveringslinjer og vev varierer i total prosent av lyder som kommer fra chloroplast DNA19. Vanligvis 50-100 x projiserte dekning av chloroplast genomet er tilstrekkelig for samlingen, og rekkefølgen går kan samordnes for å inkludere opptil 70 personer avhengig av arter og sekvensering metoden.

Testing for forurensning, Bias og variasjonen skyldes Reamplification
En bemerkelsesverdig bekymring for HTS sekvensering er innføring av skjevhet i biblioteker omfattende PCR forsterkning20. For å teste effekten av reamplification og identifisere potensielle skjevhet felles Fylogenetiske programmer herbarium materiale, sammenlignet vi en vellykket sekvensert bibliotek (TK686) med samme bibliotek utvannet 1:5 og reamplified (utpekte TK686-R). Både TK686 og TK686-R var rekkefølge på en Illumina HiSeq4000 på University of Illinois Roy J. Carver bioteknologi midten og Michigan State University Research teknologi støtte anlegget, henholdsvis, ved hjelp av sammenkoblede slutten 150 base par leser (se Tabell 3 for sekvensering detaljer). Lese rådata har blitt satt i NCBI SRA (SRP128083). Leser ble renset ved hjelp av Trimmomatic v.0.3621 inkludert adapter trimming bruker NEB adapter sekvens, kvalitet filtrering for en gjennomsnittlig phred score på 20 for et 10 base par skyve vinduet og minimum kuttet av størrelsen på 40 base parene. Som en av de viktigste problemene med herbarium prøver fungal forurensning, forurensning ble beregnet ved å tilordne leser mot en del av de JGI MycoCosm sopp genomet databasen22 (312 kjernefysiske genomer og 79 mitokondrie genomer) ved hjelp av bowtie2 v . 2.2.923 med "svært-følsom-lokale" parameter sett. TK686 og TK686-R ble utvisket i kjernefysiske fungal smitte (9.24% og 9.68%, henholdsvis) og mitokondrie fungal smitte (0,94% og 0,8%) (Tabell 3). Om dette er bare ett eksempel, antyder det at fungal smitte av herbarium prøver er ikke ubetydelig og må fjernes før du bruker herbarium-avledet sekvens databehandling. Databasen og kommandoene brukes til å identifisere og fjerne fungal smitte kan finnes i M. R. Mckain's GitHub oppbevaringssted Herbarium Genomics24.

Chloroplast genomet sekvensering brukes vanligvis for Fylogenetiske analyser og herbarium prøvene blir stadig mer brukt som kilde materiale12. For å teste gjengivelsen av reamplification i samlingen chloroplast genom, ble chloroplast genomer for både TK686 og TK686-R samlet med bowtie indeksen satt til Poales Fast-Plast v.1.2.525 under standardinnstillinger. En full chloroplast genomet ble oppnådd for TK686-R, men TK686 chloroplast genomet ble samlet inn syv contigs på grunn av lavere Les dybde. TK686 contigs ble samlet manuelt etter McKain et al. 26 fullt monterte chloroplast genomer ble justert til hverandre i en GUI-basert justering programvare (se Tabell for materiale) og variasjon mellom samlinger ble vurdert. Totalt 12 SNPs og en indel ble identifisert mellom chloroplast samlinger for TK686 og TK686-R. For hver variant, ble dekning vurdert i Les sett fra både TK686 og TK686-R. I alle tilfeller var den vanligste varianten det samme mellom to bibliotekene. TK686 vist en T→C, en G→A, en G→T, en G→, en C→A, en T→A og fire C→A varianter. Fem av disse variantene inntraff innen en homopolymer streng, tyder inn i samlingen kan ha vært sekvensering feil og lav total dekning. Andre kan ha vært et resultat av enten chloroplast haplotype variant, sekvensering feil, eller cytosine deamination, eller en kombinasjon av disse faktorene. TK686-R hadde en C→T, en G→T og en A→G. Varianter av C→T og G→T ble funnet i en homopolymer som ovenfor. Til slutt ble identiske komplett chloroplast genomer identifisert fra settene Les. En enkelt chloroplast genomet fra TK686 ble merket med frodige21 og sammenlignet med andre medlemmer av stammen Andropogoneae. Alle standard chloroplast funksjoner ble kommentert: 8 rRNAs, 38 tRNAs og 84 protein koding gener. Komplett chloroplast genomet er tilgjengelig fra GenBank (MF170217) og frodige27.

Mulige bias fra reamplification bibliotekene ble også bestemt gjennom estimering av prosent GC og totale estimerte transposon innhold. Prosent GC ble beregnet ved hjelp av en egendefinert skript24. Forskjellene i GC innholdet i de to utvalgene var ubetydelig, med 49.7% GC i TK686 og 51,2% GC i TK686-R. Transposon sammensetning ble anslått bruker Transposome28. For begge bibliotekene, 100.000 leser var tilfeldig subsampled transposon komposisjon ble beregnet ved hjelp av en prosent identiteten til 90, en brøkdel dekning av 0,55, en størrelse 100 og RepBase 21.10 gress gjenta referansen angitt29. Dette ble gjentatt 100 ganger utføre bootstrapping på transposon anslag fra disse datasett. Totale genom prosenter for store underfamilier av transposons var utdraget fra Transposome produksjon og middelverdi og standardavvik av disse for 100 gjentak var anslått. Alle skript brukes til å generere disse utgangene kan finnes i M. R. Mckain's Github oppbevaringssted Transposons30, og alle resultatene har blitt satt i dryade (doi:10.5061/dryad.r8t2m). Bruker to vanligste transposon underfamilier som indikatorer (Copia og sigøyner lang terminal gjenta retrotransposons), var resultatene nesten identisk med Copia til 33.52 ± 4.00% og 31.68 ± 2.94% og sigøyner på 24.83 ± 2.72% og 24.00 ± 2,35% i TK686 og TK686-R, henholdsvis (tabell 3). Disse testresultater foreslår at det reamplification trinnet av denne protokollen ikke opprette meningsfull sekvensering bias for høyt nivå genomet beregninger. Det bør imidlertid bemerkes at dette enkle eksemplet ikke er fullt ut representative for alle reamplified biblioteker. Dette enkelt test viser at reamplification trinnet ikke ble iboende biasing genomet beregninger i TK686/TK686-R. Innført skjevheter vil ikke påvirke montering av en chloroplast genomet gitt tilstrekkelig dekning av sekvenser, men det anbefales at eksperimenter, som presenteres i denne studien med TK686/TK686-R, er gjennomført på målet linjene slik kontrollerer at skjevhet ikke er oppstått under studier undersøker transposable element mangfold.

Figure 1
Figur 1: Agarose gel bilder av A) DNA isolasjon og B) siste sekvensering biblioteker fra ti herbarium prøver. For hver bane, ble 3 µL av DNA eller biblioteket brukt. (A) DNA ble degradert i alle herbarium isolasjoner sett av generelle smear. (B) Final sekvensering biblioteker viser en primær gjeng 300-500 base parene med en bredere distribusjon av 200-1000 base parene; sistnevnte er mer utbredt i reamplified bibliotek. Baner for både (A) og (B) ble identifisert av utvalget og kan bli sammenliknet med resultatene i tabell 2. Stigen størrelse ble avbildet i base parene (bp). Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Sirkulær tomt Schizachyrium scoparium (TK686) chloroplast genomet med merknaden. Ferdigmonterte genomet fra hagle sekvensering av herbarium-avledet DNA utstilt en lengde på 139,296 base parene (bp), en stor kopi regionen (Lexmarks Løsningssenter) 81,401 bp, en invertert gjenta region (IR) i 22,669 bp, og en liten kopi regionen (SSC) 12,557 BP. Alle standard protein-koding gener, tRNAs og rRNAs for medlemmer av Andropogoneae stammen ble identifisert i merknaden. Klikk her for å se en større versjon av dette tallet.

Tabell 2: DNA utvinning og biblioteket forberedelse resultater for ti herbarium prøver og fire reamplified biblioteker. Den totale double-strandet DNA på ulike trinn i protokollen demonstrert hvordan variabel kvalitet kan være, spesielt når filtrert for størrelse. Klikk her for å laste ned denne tabell.

Tabell 3: sekvensering statistikk for TK686 og reamplified TK686R. Reamplification påvirker ikke generelle forekomsten av sopp genomet forurensning, GC innhold estimering, transposon sammensetning estimering eller muligheten til å sette sammen hele chloroplast genomer. Klikk her for å laste ned denne tabell.

Ekstra tabell 1: DNA utvinning og biblioteket forberedelse resultater for 40 flere herbarium blodprøver, inkludert tjue reamplified biblioteker. Totale double-strandet DNA på ulike trinn i protokollen demonstrert hvordan variabel kvalitet kan være, spesielt når filtrert for størrelse. Klikk her for å laste ned denne tabell.

Ekstra figur 1: Agarose gel bilder av førti ekstra DNA isolasjoner fra herbarium prøver. Både (A) og (B) skildrer tyve separat DNA isolasjoner og demonstrere karakteristiske nedbrytning av herbarium-avledet DNA. For hver bane, ble 3 µL av DNA brukt. Baner for både (A) og (B) ble identifisert av utvalget og kan bli sammenliknet med resultatene i supplerende tabell 1. Stigen størrelse er avbildet i base parene (bp). Hvite prikker på bildet er på grunn av gjenstander i gel imager som ikke kan fjernes med rengjøring. Klikk her for å laste ned dette tallet.

Ekstra figur 2: Agarose gel bilder av førti ekstra sekvensering biblioteker fra herbarium-avledet DNA. For hver bane, ble 3 µL av biblioteket brukt. Siste sekvensering biblioteker finnes i både (A) og (B) med en gjennomsnittlig størrelse på 300-500 base parene. Sekundær band sett i eksempler forsterket foreslå "bobler" biblioteker. Baner for både (A) og (B) er identifisert av utvalget og kan bli sammenliknet med resultatene i supplerende tabell 1. Stigen størrelse er avbildet i base parene (bp). Klikk her for å laste ned dette tallet.

Ekstra figur 3: Agarose gel bilde av sekundær bandet fjerning med en ekstra enkelt syklus PCR trinn. Klikk her for å laste ned dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollen presenteres her er en omfattende og robust metode for DNA isolasjon og sekvensering biblioteket forberedelse fra tørkede planter prøver. Konsistensen av metoden og minimalt behov for å endre det basert på prøven kvaliteten gjør det skaleres for store herbarium-baserte sekvensering prosjekter. Inkludering av et valgfritt reamplification trinn for lav yield biblioteker tillater inkludering av lav kvalitet, lav mengde, sjeldne, eller historisk viktige eksempler som ellers ikke ville være egnet for sekvenser.

Betydningen av første DNA avkastning
Herbarium-avledet DNA er ofte degradert av første prøven bevaring11, med DNA av mindre enn 300 år gamle som degradert som DNA isolert fra dyrerester som er flere hundre tusenvis av år31 , 32. optimalisering av første DNA avkastning er derfor viktig å skaffe nok høykvalitets dsDNA for vellykkede sekvensering biblioteket forberedelse. For grasarter, en optimal ytelse oppnås gjennom kombinert bruk av sterilisert sand og flytende nitrogen i den første sliping steg, gir en mer grundig ødeleggelse av cellevegger og utgivelsen av nukleinsyrer. Dette øker både ønskelig større dsDNA og uønsket mindre fragmenter (figur 1, supplerende figur 1, tabell 2, supplerende tabell 1). Etterfølgende perle rengjøring trinn isolere og berike for fragmenter av en størrelse passer for sekvenser (300-500 base parene), noe som reduserer utvinning, men også berikende for lengre fragmenter (tabell 2, supplerende tabell 1). Endringer i første DNA isolasjon trinnene kan være nødvendig basert på linjen blir samplet for å redusere virkningene av sekundær metabolitter på nedstrøms behandling18.

Optimalisering av biblioteket adaptere
Konsentrasjonen av adaptere brukes for hemorroider har direkte innvirkning på mengden adapter dimer i ferdige biblioteker. Adapter dimers skyldes adapter selv ligation når utilstrekkelig prøven, og forurense sekvensering kjører33. Den relativt lave totale dsDNA tilgjengelig fra herbarium prøver nødvendiggjør fortynning av adaptere før hemorroider. Adaptere kan bli utvannet 50-fold fra lager konsentrasjonen av 15 µM (se Protokollen avsnitt) går lettere høy gjennomstrømming biblioteket forberedelse uten å måtte individuelt måle og fortynne adapter for hvert utvalg (tabell 2, tilleggstabellen 1). om metning av adaptere kan i prinsippet redusere totale biblioteket avkastning, er det usannsynlig at herbarium prøver vil gi dsDNA i slike overkant av adapter.

Variasjon i perle rengjøring trinnene for høyere avkastning
Størrelse utvalg i utarbeidelsen av sekvensering biblioteker er vanligvis gjort etter adapter hemorroider, slik at forsterkningen av hovedsakelig innen ønsket størrelse; Dette gjøres ved å fjerne fragmenter som både større og mindre enn størrelsen som mål. Den lave mengden herbarium-avledet dsDNA for biblioteket forberedelse er forverret etter størrelse utvalg på dette trinnet, som resulterer i unworkably lav total dsDNA og til slutt lav avkastning i siste biblioteket. Utfører en standard perle-rengjøring trinn med 90% volum perler etter hemorroider, beholdes mer totale dsDNA for anriking i forsterkning trinn. Ekstremt liten DNA fragmenter fjernes fortrinnsvis med 90% volum perler. Størrelse er gjennomført i det siste trinnet på forsterket bibliotek, som sikrer anriking av ønsket fragment størrelser. Totalt mengder perler kan justeres for å velge ønsket område, men i two-step volumer av 25 µL og 6 µL av perler er optimalisert for å hente biblioteker av 400-500 base par innstikk i denne protokollen (figur 1B, utfyllende figur 2).

Eksempel redning gjennom Reamplification av biblioteker
Til tross for beste praksis i DNA isolasjon og biblioteket forberedelse, kan endelig konsentrasjoner av sekvensering biblioteker være utilstrekkelig for ytterligere sekvensering. Destruktive av prøvetaking og ofte begrenset unnværes materiale fra herbarium prøver tillater ikke alltid gjentatte DNA isolasjon. Av reamplifying biblioteket opptil kan 12 ytterligere PCR sykluser, selv eksepsjonelt dårlig biblioteker lagres. Noen standard primer brukes til forsterkning, som er kompatibel med enten dobbel eller enkel indekserte biblioteket protokoller. Et hovedanliggende for reamplification er innføringen av bias, ofte gjennom reduksjon i GC-rik deler av genomet20. Ved å bruke en høy kvalitet utvalg (se Tabell for materiale), disse potensielle biases potensielt unngås. Dette er demonstrert gjennom minimal variasjonen av GC innhold sekvensert biblioteker TK686 og TK686-R (tabell 3). Som andre bevis, var transposon innholdet av både TK686 og TK686-R beregnet og viste ingen merkbar forskjeller (tabell 3). Til slutt, hele chloroplast genomet av denne tiltredelse ble samlet fra TK686 og TK686-R, som resulterte i identiske sekvenser etter nært inspeksjon av SNP variasjon mellom de to samlingene (figur 2, tabell 3). Disse testene foreslår at standard genomisk beregninger, som GC innhold og transposon sammensetning, og muligheten til å sette sammen komplette chloroplast genomer, ikke kan bli påvirket av reamplification. Dette åpner muligheten for omfatter herbarium prøver tenkte reduseres også eller mangler i materiale i phylogenomic studier uten bekymring introdusert bias gjennom PCR. Disse reamplified biblioteker kan også brukes for sekvensen fange34, selv om det ville være nødvendig å teste om SNP ringer er partisk. Det anbefales at småskala tester skjevhet gjennomføres med hvert prosjekt for å kontrollerer at skjevhet ikke er innført i sekvensering biblioteker.

Begrensninger og endres
Selv om denne protokollen har jobbet med kan hundrevis av herbarium prøver, dårlig bevart vev fortsatt mislykkes på noen trinn. Det er imidlertid svært sjelden for biblioteker mislykkes fra vev med vellykket DNA utdrag, spesielt etter biblioteket redning gjennom reamplification. Størrelse utvalg trinnene kan endres målrette ulike størrelse fragmenter eller redusere rekke fragmenter sett i noen endelige biblioteker. Som med alle plante-baserte utvinning protokoller, trinn kan være nødvendig å fjerne slektslinje kundespesifikk sekundære forbindelser som kan hindre den generelle protokollen. Som presenteres, denne protokollen gir en standardmetode for DNA isolasjon og høy gjennomstrømming biblioteket forberedelse for gress herbarium prøver, og gjennom bekreftelse og eksperimentering er sikkert å bli amendable til andre plante overleveringslinjer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer de har ingen konkurrerende interesser.

Acknowledgments

Vi takker Taylor AuBuchon-eldre, Jordan Teisher, og Kristina Zudock for hjelp i prøvetaking herbarium prøver og Missouri botaniske hagen for tilgang til herbarium prøver for destruktive prøvetaking. Dette arbeidet var støtte av et stipend fra National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics