Robust DNA isoleret og høj overførselshastighed sekventering bibliotek konstruktion til Herbarium prøver

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Denne artikel viser en detaljeret protokol for DNA isoleret og høj overførselshastighed sekventering bibliotek byggeri fra herbarium materiale herunder redning af usædvanligt dårlige DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbarier er en uvurderlig kilde af plantemateriale, der kan bruges i en bred vifte af biologiske undersøgelser. Brugen af herbarium enheder er forbundet med en række udfordringer, herunder prøve bevarelse kvalitet, forringet DNA og destruktiv prøvetagning af sjældne eksemplarer. Mere effektivt bruge herbarium materiale i store sekventering projekter, der er behov for en pålidelig og skalerbar fremstillingsmetoden DNA isolation og bibliotek. Dette papir viser en robust, start-til-slut protokol for DNA isoleret og høj overførselshastighed bibliotek byggeri fra herbarium enheder der ikke kræver ændring for individuelle prøver. Denne protokol er skræddersyet til lav kvalitet tørret plante materiale og tager fordel af eksisterende metoder ved at optimere væv slibning, ændre bibliotek størrelse udvælgelse og indføre en valgfri reamplification skridt for lavt udbytte biblioteker. Reamplification af lavt udbytte DNA biblioteker kan redde prøver afledt af uerstattelige og potentielt værdifulde herbarium prøver, bevirke, at behovet for yderligere destruktiv prøvetagning og uden at indføre mærkbar sekventering bias for fælles Fylogenetisk applikationer. Protokollen er blevet testet på hundredvis af græs arter, men forventes at kunne tilpasses til brug i andre plante lineages efter verifikation. Denne protokol kan begrænses ved meget forringet DNA, hvor fragmenter ikke findes i den ønskede størrelsesområde, og sekundære metabolitter til stede i nogle plantemateriale, der hæmmer ren DNA isolation. Samlet set indfører denne protokol en hurtig og omfattende metode, der giver mulighed for DNA isolation og bibliotek forberedelse af 24 prøver i mindre end 13 h, med kun 8 h aktive hands-on tid med minimale ændringer.

Introduction

Herbarium samlinger er en potentielt værdifulde kilde til både arter og genomisk mangfoldighed for undersøgelser, herunder phylogenetics1,2,3, populationsgenetik4,5, bevarelse biologi6, invasive arters biologi7og træk evolution8. Evnen til at opnå en rig mangfoldighed af arter, populationer, geografiske steder og tidspunkter fremhæver "skattekiste"9 , som er herbarium. Historisk set har har den forringede karakter af herbarium-afledte DNA hindret PCR-baserede projekter, ofte relegating forskere til at bruge kun markører fundet i høj kopi, såsom regioner i grønkornets genom eller den interne transskriberede spacer (ITS) i de ribosomale RNA. Kvaliteten af prøver og DNA variere udstrakt grad baseret på metoder til bevarelse9,10, med dobbelt-strenget pauser og opsplitning fra varmen bruges i tørringsprocessen er de mest almindelige former for skader, skaber den såkaldte 90% DNA lock-up, der har belastet PCR-baserede studier11. Bortset fra fragmentering er den anden mest udbredte problem i herbarium genomforskning forurening, der stammer fra endophytic svampe13 eller svampe erhvervet postmortem efter samling men før montering i herbarium12, selv Dette problem kan blive løst bioinformatically givet den lige svampe database (se nedenfor). En tredje og mindre almindelige, problemet er sekvens ændring gennem cytosin deamination (C/G→T/A)14, selvom det skønnes for at være lavt (~ 0,03%) i herbarium prøver11. Med fremkomsten af høj overførselshastighed sekventering (HTS), kan spørgsmålet om opsplitning overvindes med kort læser og sekventering dybde12,15, tillader genomisk-niveau dataopsamling fra talrige prøver med lav kvalitet DNA, og nogle gange endda tillade hele genome sequencing15.

Herbarium prøver at blive hyppigere anvendes og er en større komponent om fylogenetiske projekter16. En nuværende udfordring ved at bruge herbarium prøver for HTS konsekvent opnå tilstrækkelig dobbelt strandede DNA, en nødvendig forudsætning for sekventering protokoller, fra talrige arter i tide, uden at behøve at optimere metoder for enkelte prøver. I dette papir, er en protokol til DNA-ekstraktion og bibliotek præparation af herbarium prøver viste der udnytter eksisterende metoder og ændrer dem til at give mulighed for hurtig og reproducerbare resultater. Denne metode giver mulighed for komplet behandling fra prøvemateriale til et bibliotek med 24 prøver i 13 h, med 8 h hands-on tid, eller 16 h, med 9 h hands-on tid, når den valgfrie reamplification trin er påkrævet. Samtidig behandling af flere prøver er opnåeligt, men den begrænsende faktor er centrifuge kapacitet og tekniske færdigheder. Protokollen er udviklet til kræver kun typiske laboratorieudstyr (thermocycler, centrifuge og magnetiske stande) i stedet for specialiseret udstyr, såsom en forstøver eller sonikator, for klipning DNA.

DNA kvalitet, fragment størrelse og mængde er begrænsende faktorer for brug af herbarium modellerne i høj overførselshastighed sekventering eksperimenter. Andre metoder til isolering herbarium DNA og skabe høj overførselshastighed sekventering biblioteker har vist nytten af bruger så lidt som 10 ng af DNA16; men de kræver eksperimentelt bestemme det optimale antal PCR-cykler kræves for biblioteket forberedelse. Dette bliver upraktisk, når der beskæftiger sig med overordentlig meget små mængder af levedygtige dobbelt strandede DNA (dsDNA), da nogle herbarium eksemplarer producerer kun nok DNA til en enkelt bibliotek forberedelse. Metoden præsenteres her bruger en enkelt antal cyklusser uanset prøve kvalitet, så ingen DNA er tabt i biblioteket optimering trin. I stedet, et reamplification skridt er gældende når biblioteker ikke opfylder de minimumsbeløb, der er nødvendige til sekvensering. Mange herbarium prøver er sjældne, og besidde lille materiale gør det vanskeligt at retfærdiggøre destruktiv prøvetagning i mange tilfælde. For at imødegå dette, præsenteres protokollen tillader dsDNA input størrelser mindre end 1,25 ng i forberedelsesprocessen bibliotek, udvidelse af levedygtige prøver for høj overførselshastighed sekvensering og minimere behovet for destruktive udtagning af prøver.

Følgende protokol er blevet optimeret til græsser og testet på hundredvis af forskellige arter fra herbarium prøver, selv om vi forventer, at protokollen kan anvendes til mange andre plantegrupper. Det omfatter en valgfri recovery trin, der kan bruges til at gemme lav kvalitet og/eller sjældne eksemplarer. Baseret på over to hundrede herbarium enheder testet, fungerer denne protokol på enheder med lav væv input og kvalitet, giver mulighed for bevarelse af sjældne eksemplarer gennem minimal destruktiv prøvetagning. Her er det vist, at denne protokol kan levere høj kvalitet biblioteker, der kan blive sekventeret for phylogenomics-baserede projekter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. forud for Start

  1. Gøre friske cetyl trimethylammoniumformiat bromid (CTAB) buffer17 ved at tilføje 20 g af CTAB, 10 g af polyvinylpyrrolidon (PVP) 40, 100,0 mL 1 M Tris pH 8,0, 40 mL 0,5 M ethylendiamintetra syre (EDTA) pH 8,0, 280,0 mL 5 M NaCl og 400.0 mL reagens vand sammen, og bringe det samlede volumen på 1 L ved hjælp af reagens-grade vand. Justeres til pH 8,0.
    Bemærk: Yderligere reagenser kan føjes til CTAB afhængigt af sekundære forbindelser i enkelte taxa. Se Allen et al. 18 en grundig liste over tilsætningsstof reagenser.
  2. Tilsæt 10 µL af β-mercaptoethanol pr. 5 mL af CTAB buffer.
    Bemærk: Dette kan være forberedt i partier af 50 mL og opbevares ved stuetemperatur i 3-4 uger.
    1. Varme CTAB løsning i en 65 ° C vandbad.
  3. Chill morterer og pestles i-20 ° C i mindst 20 min.
  4. Mærke 4 sæt af 2 x n 2-mL-rør (hvor n = antallet af prøver). Sætte 1 sæt af mærket rørene på is.
  5. Chill isopropanol på is eller i en-20 ° C fryser.
  6. Fjerne faste fase reversible immobilisering (SPRI) perler (Se Tabel af materialer) fra køleskabet, og tillade dem at reagensglasset stuetemperatur (mindst 30 min).
  7. Forberede 80% ethanol.
  8. Vælg herbarium prøver til udtræk og hente ~ 1 cm2eller 10 mg, væv per eksemplar, helst blad materiale.

2. DNA-ekstraktion

  1. Grind ~ 1 cm2 forudvalgt herbarium væv ved hjælp af prechilled morterer og pestles. Tilføj flydende kvælstof og 30 – 50 mg steriliseret sand. Slibe indtil væv til fint pulver.
    Bemærk: 10 mg eller mere væv er ønskeligt, men mindre har også arbejdet i nogle tilfælde. Når den flydende nitrogen fordamper, tilføje mere efter behov indtil væv er fuldt jorden. En anden almindelig metode til at forstyrre celler og væv er brugen af en perle tæppebanker. Denne metode fandtes imidlertid ikke arbejde godt for de prøver, der anvendes i disse eksperimenter.
  2. Overføre den frosne pulver til to 2 mL rør (tilsæt ikke mere end halvdelen af tube's volumen). Tilføje 600 µL af varm CTAB løsning til hvert rør og blande rør grundigt ved inversion og vortexing.
    Bemærk: Da mængden og kvaliteten af herbarium materiale er ofte lav, udfører DNA isoleret i to gentagelser bidrager til at opnå højere udbytter.
  3. Inkuber prøver i vandbad 65 ° C i 1-1,5 timer, vortexing hvert 15 min.
  4. Centrifuge prøver på 10.000 x g i 5 min. Overfør supernatanten til et nyt sæt af mærket rør (~ 500 µL). Kassér pellet ved hjælp af en standard ikke-chlorerede bortskaffelse procedure.
  5. Tilføjes hver tube 4 µL af RNase-A (10 mg/mL) og blandes ved at vende eller pipettering. Inkuber prøver ved 37 ° C i varme blok eller vand bad i 15 min.
  6. Tilføje en tilsvarende mængde (~ 500 µL) af en 25:24:1 phenol: chloroform: isoamyl alkohol blanding, når rørene har nået stuetemperatur. Blandes grundigt ved pipettering op og ned og/eller med inversion. Centrifuge rør på 12.000 x g i 15 min. overføre den vandige lag (øverste lag) til et nyt sæt af mærket rør (~ 400 µL). Kassér de organiske lag i en chloreret spildbakken.
    Bemærk: Trin 2.6 kan gentages, hvis store mængder af sekundære forbindelser forventes i plante materiale.
  7. Tilføje en tilsvarende mængde (~ 400 µL) af en 24:1 chloroform: isoamyl alkohol blanding. Blandes grundigt ved pipettering op og ned og/eller med inversion. Der centrifugeres rør på 12.000 x g i 15 min. Transfer den vandige lag (øverste lag) til et nyt sæt af prechilled, mærket rør (~ 300 µL). Kassér de organiske lag i en chloreret spildbakken.
  8. Tilføje en tilsvarende mængde (~ 300 µL) prechilled isopropanol og 12 µL af 2,5 M natriumacetat til hver tube. Inkuber prøver ved-20 ° C i 30-60 min.
    Bemærk: Inkuberingstider kan forlænges (til natten inkubation), men DNA kvalitet bliver mindre jo længere prøverne inkuberes.
  9. Tage prøver ud af fryseren og centrifugeres rør på 12.000 x g i 15 min. Fjern og kassér supernatanten forsigtigt uden at forstyrre pelleten. Afvaske pelleten ved suspension med friske 70% ethanol (ca 300-500 µL). For hver fordoblet prøve, konsolidere de to enkelte pellets i en med tilhørende ethanol.
    Bemærk: Prøver bør konsolideres ind i et rør med ethanol først og derefter gå videre. Det er ikke nødvendigt at vaske hver prøve med ethanol separat.
  10. Centrifugeres rør på 12.000 x g i 10 min. Fjern og supernatanten forsigtigt uden at forstyrre pelleten. Luft tørre pellets.
    Bemærk: Prøver kan være tørret hurtigere ved hjælp af en tør varme blok (ikke overstige 65 ° C). Sørg for, at prøverne over ikke tør, da dette kan mindske det endelige udbytte af DNA.
  11. Suspendere den isolerede DNA i 50 µL 1 x TE. Gemme i-20 ° C fryser til langtidsopbevaring eller 4 ° C til brug i den følgende uge.

3. kvalitetskontrol (QC)

  1. Køre en agarosegel for kvalitetskontrol.
    1. Forbered en 1 x Borat-Tris-EDTA (TBE) buffer ved at tilføje 54 g Tris base, 27,5 g borsyre og 3.75 g EDTA dinatriumsalt, at bringe den samlede mængde til 5 L ved hjælp af vand af reagens.
    2. Forbered en 1%-agarosegel ved at tilføje 1 g Agarosen til 100 mL af 1 x TBE. Mikroovn løsningen, indtil ingen Agarosen er synlige. Tilføje 0,01% nukleinsyre gel pletten (Se Tabel af materialer). Lad kolbe køle, indtil den er varm at røre ved. Bland godt ved omrøring. Hæld Agarosen i gelen bakken og lad det sidde, indtil det størkner.
    3. Mix 3 µL af prøven, 2 µL af reagens klasse vand og 1 µL af 6 x lastning farvestof. Indlæse prøver i matrixen gel at bemærke deres ordre.
    4. Køre prøver til 60-70 min. på 60 – 70 V. billede gel under UV-lys med korrekte eksponering og fokus.
      Bemærk: Tilstedeværelsen af en klar høj molekylvægt band er et tegn på høj kvalitet DNA, mens udstrygningspræparater angiver normalt DNA nedbrydning. De fleste herbarium prøver er nedbrudt.
  2. Køre en dsDNA kvantificering analyse (se tabel af materialer) til at bestemme mængden af dobbelt strandede DNA.
    1. Bruge 2 µL af prøven til analyse.
      Bemærk: Fortyndinger er ikke behov for kvantificering analyse af herbarium materiale, som de har tendens til at være i minimale mængder. Vellykket biblioteker har gjort fra så lidt som 1.26 ng samlede dsDNA fra dette trin.

4. DNA klipning

Bemærk: Dette er en optimeret version af en kommerciel dobbelt-strenget fragmentase protokol (Se Tabel af materialer).

  1. Sted dsDNA fragmentering enzym på is efter vortexing for 3 s.
  2. I en steril 0,2 mL polymerase kædereaktion (PCR) rør isoleret blanding 1 – 16 µL DNA med 2 µL af ledsager fragmentering reaktion buffer. Bringe den samlede mængde til 18 µL ved at tilføje nukleasen gratis vand. Tilføj 2 µL af dsDNA fragmentering enzym og vortex blanding til 3 s.
    Bemærk: Mængden af DNA behov varierer afhængigt af DNA koncentration (mål for 200 ng alt i røret).
  3. Inkuber prøver ved 37 ° C i 8,5 minutter. Derefter tilsættes 5 µL af 0,5 M EDTA til rør.
    Bemærk: Dette trin skal udføres så snart Inkubationstiden er at opsige reaktionen og forhindre DNA-prøver fra over klipning.

5. perle Clean-up

  1. Homogeniseres SPRI perler af vortexing.
  2. Bringe den samlede mængde af den afrevne DNA til 50 µL ved at tilføje 25 µL nukleasen gratis vand. Føje 45 µL af stuetemperatur SPRI perler (90% vol.) til 50 µL afrevne DNA og bland grundigt ved pipettering op og ned.
    Bemærk: Tilføje perler på 90% af samlede stikprøve er gjort for at fjerne den mindste af DNA fragmenter, ofte under 200 basepar.
  3. Lad prøverne inkuberes for 5 min. sætte rørene på en magnetisk plade og lad dem sidde i 5 min. forsigtigt fjerne og supernatanten.
    Bemærk: Vær forsigtig ikke at forstyrre perlerne, som de indeholder de ønskede DNA mål.
  4. Tilføje 200 µL af friske 80% ethanol til rør på den magnetiske stand. Inkuber ved stuetemperatur i 30 s og derefter omhyggeligt ophæve og supernatanten. Gentag dette trin en gang. Luft tørre perler i 5 min, mens røret er på den magnetiske stå med låget åbent.
    Bemærk: Undgå over tørring perlerne. Dette kan resultere i lavere inddrivelse af DNA.
  5. Fjerne rør fra magneten. Elueres DNA fra perler til 55 µL af 0,1 x TE og blandes grundigt af pipettering op og ned. Inkuber ved stuetemperatur for 5 min. sted rør på den magnetiske stå og vente på opklaring at vende klare (~ 2 min).
  6. Trække ud 52 µL af supernatanten. Køre en DNA kvantificering analyse af prøver hen til indskrive opsvinget og den oprindelige koncentration, der går ind i biblioteket prep.
    Bemærk: Biblioteker har gjort med samlede dsDNA skønnes for at være mindre end 1,25 ng, men i hvert tilfælde reamplification var påkrævet.

6. bibliotek forberedelse

Bemærk: Dette er en modificeret version af en kommercielt tilgængelig bibliotek kit (Se Tabel af materialer protokol).

  1. Ende Prep
    1. Tilføje 3 µL af liv1975 og fosfat affaldsgruber enzymer og 7 µL af ledsager reaktion buffer til 50 µL af renset, afrevne DNA. Blandes grundigt ved pipettering op og ned. Spin rør for at fjerne boblerne.
      Bemærk: Det samlede volumen skal være 60 µL.
    2. Prøveemner i et thermocycler med følgende program: 30 min. ved 20 ° C, 30 min. ved 65 ° C, derefter holde ved 4 ° C.
      Bemærk: Opvarmet låg blev sat til ≥75 ° C
  2. Adapter ligatur
    1. Fortynd adapteren 25 – 50 fold (arbejder adapter koncentration af 0,6 – 0,3 µM). Tilføj 30 µL af ligatur master mix, 1 µL af ligatur enhancer og 2,5 µL af adapteren til høj overførselshastighed kort Læs sekvensering til rør.
      Bemærk: Det samlede volumen skal være 93,5 µL.
    2. Blandes grundigt ved pipettering op og ned. Spin rør for at fjerne boblerne. Inkuber rør ved 20 ° C i 15 min.
    3. Tilføje 3 µL af kommercielle blanding af uracil DNA glycosylase (UDG) og DNA glycosylase-lyase Liv1975 VIII (Se Tabel af materialer) til rør. Sikre, at den samlede mængde 96,5 µL. blandes grundigt, og der inkuberes ved 37 ° C i 15 min ved hjælp af en thermocycler.
      Bemærk: Låget skal indstilles til ≥47 ° C. Den oprindelige version af den kommercielle protokollen har størrelse udvalg efter trinnet adapter ligatur, efterfulgt af en perle oprydning som det sidste trin. Denne protokol, der opnår højere udbytter, skifter rækkefølgen af disse trin og implementerer størrelse udvælgelse som et sidste skridt.
  3. Oprydningsværktøjet til at fjerne enzymer og små fragmenter
    1. Homogeniseres magnetiske perler af vortexing.
    2. Tilføje 78 µL af SPRI magnetisk perler (80% vol.) og blandes grundigt af pipettering op og ned.
      Bemærk: Tilføje perler på 80% af samlede stikprøve er gjort for at fjerne de mindste DNA fragmenter, der er ofte kortere end 250 basepar. Strengere fjernelse af små DNA fragmenter er a fjerne overskydende adaptere og (ii) understrege forstærkning af større fragmenter i følgende trin.
    3. Lad prøverne inkuberes i 5 min. Læg rør på en magnetisk plade i 5 min. forsigtigt fjerne og supernatanten, der indeholder DNA uden ønskede størrelse.
      Bemærk: Pas på ikke at forstyrre de perler, der indeholder de ønskede DNA mål.
    4. Tilføje 200 µL af friske 80% ethanol til rør på den magnetiske stand. Inkuber ved stuetemperatur i 30 s og derefter omhyggeligt ophæve og supernatanten. Gentag dette trin en gang. Luft tørre perler i 5 min, mens røret er på den magnetiske stå med låget åbent.
      Bemærk: Undgå over tørring perlerne. Dette kan resultere i lavere inddrivelse af DNA.
    5. Fjerne rør fra magneten. Elueres DNA målet fra perlerne ved at tilføje 17 µL af 0,1 x TE og blandes grundigt af pipettering op og ned.
    6. Inkuber ved stuetemperatur for 5 min. sted rør på den magnetiske stå og vente på opklaring at vende klare (~ 2 min).
    7. Trække ud 15 µL af supernatanten.
  4. PCR-amplifikation
    1. Tilføje 25 µL af high fidelity PCR master mix, 5 µL af høj overførselshastighed kort læse sekventering bibliotek prep 5' primer og 5 µL af høj overførselshastighed kort Læs sekventering bibliotek prep 3' primer, til 15 µL af den rensede adapter-forbundet DNA.
      Bemærk: Samlede volumen skal være 50 µL.
    2. Bland godt ved vortexing. Placere prøverne i en thermocycler ved hjælp af de indstillinger, der findes i tabel 1: Thermocycler forstærkning indstilling.
      Bemærk: Et stort antal cyklusser er nødvendig på grund af det lave antal input DNA.
Cyklus trin Temp. Tid Cykler
Indledende denaturering 98 ° C 30 s 1
Denaturering 98 ° C 10 s 12
Udglødning/udvidelse 65 ° C 75 s 12
Endelige udvidelse 65 ° C 5 min 1
Hold 4 ° C

Tabel 1: PCR protokol denaturering, udglødning og udvidelse gange og temperaturer. Temperatur og gange var optimeret til de reagenser, der er præsenteret i denne protokol. Hvis reagenser er ændret, bør temperaturer og gange optimeres igen.

  1. Størrelse udvalg for ønskede bibliotek størrelse
    Bemærk: Denne perle skridt vil fjerne fragmenter både over og under målintervallet.
    1. Homogeniseres SPRI perler af vortexing.
    2. Tilsæt 25 µL (50% volumen) af stuetemperatur magnetiske perler og bland grundigt af pipettering op og ned. Lad prøverne inkuberes for 5 min. sætte rørene på en magnetisk plade og lad dem sidde i 5 min. forsigtigt fjerne og overføre supernatanten til et nyt sæt af mærket rør.
      Bemærk: Denne diskenhed kan justeres baseret på ønskede bibliotek størrelse. Supernatanten indeholder DNA fragmenter af den ønskede størrelse. I den første perle inkubation, er perlerne bindende større bibliotek fragmenter. Disse er fjernet fokus på dem i området 400-600 basepar. Supernatanten indeholder mindre fragmenter.
    3. Føje 6 µL af stuetemperatur SPRI perler til supernatanten og bland grundigt ved pipettering op og ned. Lad prøverne inkuberes for 5 min. sætte rørene på en magnetisk plade og lad dem sidde i 5 min.
      Bemærk: Denne diskenhed kan justeres baseret på ønskede bibliotek størrelse i overensstemmelse med trin 6.5.2.
    4. Forsigtigt fjerne og supernatanten.
      Bemærk: Pas på ikke at forstyrre de perler, der indeholder den ønskede DNA. I den anden perle inkubation, er perlerne bindende for fragmenterne tilbage efter den første fjernelse af den største DNA fragmenter. Dette sæt af fragmenter er normalt i området ønskede størrelse.
    5. Tilføje 200 µL af friske 80% ethanol til rør på den magnetiske stand. Inkuber ved stuetemperatur i 30 s, derefter forsigtigt fjerne og supernatanten. Gentag. Luft tørre perler i 5 min, mens røret er på den magnetiske stå med låget åbent.
      Bemærk: Undgå over tørring perlerne. Dette kan resultere i lavere inddrivelse af DNA.
    6. Fjerne rør fra magneten. Elueres DNA målet fra glasperler i 33 µL af 0,1 x TE og blandes grundigt af pipettering op og ned.
    7. Inkuber ved stuetemperatur for 5 min. sted rør på den magnetiske stå og vente på opklaring at vende klare (~ 2 min). Trække ud 30 µL af supernatanten og overførsel til 2 mL rør (Se Tabel af materialer) til opbevaring.
      Bemærk: Bibliotekerne kan opbevares ved-20 ˚C til langtidsopbevaring.
  2. Kvalitetskontrol
    1. Køre en kvalitetskontrol test på DNA-biblioteker. Henvise til trin 3.1 og 3.2.
      Bemærk: For DNA biblioteker, køre gel for ~ 45 min på 96 V.
  3. Bibliotek reamplification: valgfrit hvis bibliotek mængde ikke er tilstrækkelig.
    Bemærk: Prøver med biblioteket koncentrationer under 10 nM kan være reamplified ved hjælp af følgende trin. Reamplification af lav koncentration biblioteker kan opnå brugbare resultater til sekvensering, men reamplification kan forårsage en beskeden ændring i base sammensætning mangfoldighed, selvom indsamlet data (tabel 3) tyder på, at dette er ubetydelig for visse målinger .
    1. Fortynd de universelle reamplification primere 10-fold bruger 0,1 x TE.
    2. Tilføje 25 µL af high fidelity PCR master mix, 5 µL fortyndede universal reamplification primer 1 (AATGATACGGCGACCACCGA) og 5 µL fortyndede universal reamplification primer 2 (CAAGCAGAAGACGGCATACGA) til 15 µL af lav koncentration biblioteker. Bemærk: Samlede volumen skal være på 50 µL.
    3. Bland godt ved vortexing. Placere prøverne i en thermocycler ved hjælp af de indstillinger, der findes i tabel 1: Thermocycler forstærkning indstilling
      Bemærk: Det store antal cyklusser er nødvendig på grund af lavt antal input DNA.
    4. Perle oprydning
    5. Homogeniseres SPRI perler af vortexing. Tilføje 45 µL af stuetemperatur SPRI perler (90% vol.) og blandes grundigt af pipettering op og ned.
    6. Lad prøverne inkuberes i 5 min. sætte rørene på en magnetisk plade i 5 min.
    7. Forsigtigt fjerne og supernatanten, der indeholder de uønskede DNA.
      Bemærk: Pas på ikke at forstyrre de perler, der indeholder de ønskede DNA mål.
    8. Tilføje 200 µL af friske 80% ethanol til rør på den magnetiske stand. Inkuber ved stuetemperatur i 30 s, og derefter forsigtigt fjerne og supernatanten. Gentag dette trin en gang.
    9. Luft tørre perler i 5 min, mens røret er på den magnetiske stå med låget åbent.
      Bemærk: Undgå over tørring perlerne. Dette kan resultere i lavere inddrivelse af DNA-målet.
    10. Fjerne rør fra magneten. Elueres DNA målet fra glasperler i 33 µL af 0,1 x TE og blandes grundigt af pipettering op og ned.
    11. Inkuber ved stuetemperatur for 5 min. sted rør på den magnetiske stå og vente på opklaring at vende klare (~ 2 min).
    12. Trække ud 30 µL af supernatanten. Bibliotekerne kan opbevares ved-20 ° C til langtidsopbevaring.
  4. Kvalitetskontrol
    1. Køre en kvalitetskontrol test på DNA-biblioteker. Henvise til trin 3.1 og 3.2. For DNA biblioteker, skal du køre gel for ~ 45 min på 96 V.
      Bemærk: Hvis en dobbelt band ses i gelen, dette er sandsynligvis en konsekvens af primer konsumption fra reamplification trin. Bandene kan fjernes ved gentagne 6,9, men ved hjælp af kun én cyklus i PCR programmet afbildet i tabel 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA Isolation og endelige bibliotek udbytte
I denne undersøgelse viste effekten af protokollen til isolering af herbarium DNA og inddrivelse af høj kvalitet sekventering biblioteker ved hjælp af halvtreds forskellige prøver med de ældste fra 1920 og den yngste fra 2012 (tabel 2). For hver prøve, var ca. 10 mg blad væv bruges til DNA isolation. Grønnere blad væv blev foretrukket, hvis det er tilgængeligt, og ingen væv med indlysende svampe forurening blev valgt. Vellykket isolering kan gøres ved hjælp af gul eller brun væv, selvom udbytte bør forventes at være lavere. Alt dobbelt strandede DNA (dsDNA) fra den oprindelige isolering varierede fra 3,56 ng til 2.610 ng. Som forventet, DNA fra herbarium prøver blev stærkt forringet (figur 1A, supplerende figur 1). En del af disse isolering blev brugt til enzymatisk klipning (1,26-464 ng). Selvom herbarium DNA er allerede klippet med at bevare, kræver optimering af protokollen ekstra klipning for at forbedre samlede bibliotek udbytte. Total genopretning af dsDNA efter klipning varierede fra < 1-51% af input dsDNA, hvilket resulterer i et minimum af mindre end 1,25 ng af start DNA i biblioteket forberedelse og højst 328 ng. Den ekstreme tab af DNA i nogle prøver kan tilskrives den allerede lille fragment størrelse meget af DNA før enzymatisk klipning (figur 1A, supplerende figur 1). Brug af en 90% vol. perle oprydning på vredne DNA fjernet bevidst de mindste fragmenter af DNA til at berige for større, mere ønskeligt fragment størrelser. Disse små fragmenter var især set i prøver, TK463, TK657 og TK694, som angivet af en intens signal på 100 basepar mark (figur 1A).

Den samlede mængde af bibliotek indlæg størrelse valg varierede fra 1.425 ng til 942.5 ng (tabel 2, supplerende tabel 1). For 23 af prøverne, den indledende ekstraktion og bibliotek forberedelse ikke udbyttet af et passende beløb af bibliotek (< 10 nM; Tabel 2, supplerende tabel 1), så disse prøver blev udsat for reamplification og recovery trinene i protokollen, hvilket resulterer i en 14 – 680 x stigning i samlede bibliotek (tabel 2, supplerende tabel 1). Endelige biblioteker resulterede i et bånd mellem 350 og 500 basepar (figur 1B, supplerende figur 2). Til tider, et andet band, der var større end den forventede bibliotek blev set (figur 1B, supplerende figur 2). Dette skete da reamplification PCR opbrugt tilgængelige primere og begyndte udglødning bibliotek adaptere for ikke-homologe DNA fragmenter. Dette skaber et molekyle hvor ender (adaptere) korrekt udglødning, men DNA Indsæt gjorde ikke. Denne "boblede" molekyle syntes større på en gel, som den bevægede sig mere langsomt gennem matrixen gel. Disse optimerende fejl blev fastsat ved at forberede en anden reamplification reaktion fra biblioteket allerede reamplified og køre det for en enkelt cyklus. Denne enkelt cyklus forudsat primere for ordentlig udglødning og forstærkning, at fjerne den anden band (supplerende figur 3).

Reamplification af biblioteker lettet endelige bibliotek koncentrationer af mindst 10 nM. Disse koncentrationer tilladt biblioteker bliver udvandet lige molariteten og samles i en ligelig repræsentation, bidrager til at negere problemer, der ville være opstået med ulige prøve kvalitet og sekventering bibliotek udbytte. Hvis målet om et projekt er grønkorn genom sekventering, derefter sekventering samlede behov vil variere som forskellige slægter og væv er forskellige i den samlede procent af læser, der stammer fra grønkorn DNA19. Typisk 50 – 100 x forventede dækning af grønkorn genom er tilstrækkelig for forsamlingen, og sekventering løber kan samles for at optage så mange som 70 personer afhængigt af arter og sekventering metode.

Testning for forurening, Bias og Variation forårsaget af Reamplification
En bemærkelsesværdig bekymring for HTS sekventering er indførelsen af bias i biblioteker gennem omfattende PCR forstærkning20. For at teste effekten af reamplification og identificere potentielle bias fælles fylogenetiske anvendelser af herbarium materiale, sammenlignede vi en vellykket sekventeret bibliotek (TK686) med den samme bibliotek fortyndet 1:5 og reamplified (udpegede TK686-R). Både TK686 og TK686-R blev sekventeret på en Illumina HiSeq4000 på University of Illinois Roy J. Carver bioteknologisk Center og Michigan State University forskning teknologi støtte anlægget, henholdsvis, ved hjælp af parrede ende 150 basepar læser (Se Tabel 3 til sekvensering detaljer). Rå læsninger har været deponeret i NCBI SRA (SRP128083). Læser blev renset ved hjælp af Trimmomatic v.0.3621 herunder adapter trimning bruger NEB adapter sekvens, kvalitet filtrering til den gennemsnitlige Jytte score på 20 for et 10 base par glidende vindue, og et minimum afskåret størrelse 40 basepar. Som en af de primære problemer med herbarium prøver er svampe forurening, forurening blev anslået ved at knytte læser mod en del af den JGI MycoCosm svampe genom database22 (312 nukleare genomer og 79 mitokondrie genomer) ved hjælp af bowtie2 v . 2.2.923 bruger de "meget følsomme-local" parametersæt. TK686 og TK686-R biblioteker var umulig at skelne i nukleare svampe forurening (9.24% og 9.68%, henholdsvis) og mitokondriel svampe forurening (0,94% og 0,8%) (Tabel 3). Selv om dette er blot ét eksempel, foreslår at svampe kontaminering af herbarium prøver er ikke ubetydelig og skal fjernes før du bruger herbarium-afledte sekvens data. Database og kommandoer, der bruges til at identificere og fjerne svampe kontamination kan findes i M. R. McKain GitHub opbevaringssted Herbarium genomforskning24.

Grønkorn genome sequencing bruges almindeligvis om fylogenetiske analyser, og herbarium prøver er i stigende grad anvendt som kilde materiale12. For at teste troskab af reamplification i grønkornets genom forsamling, var grønkorn genomer for både TK686 og TK686-R samlet ved hjælp af hurtig-Plast v.1.2.525 under standardindstillingerne med Butterfly indeks indstillet til græs. En fuld grønkorn genom blev opnået for TK686-Rasmussen, men TK686 grønkorn genom blev samlet i syv contigs på grund af lavere Læs dybde. TK686 contigs blev samlet manuelt efter McKain et al. 26 færdigsamlet grønkorn genomer blev justeret til hinanden i et GUI-baseret tilpasning software (Se Tabel af materialer) og variation mellem forsamlinger blev vurderet. I alt 12 SNPs og én indel blev identificeret mellem grønkorn forsamlinger for TK686 og TK686-R. For hver variant blev dækning vurderet i Læs sæt fra både TK686 og TK686-R. I alle tilfælde var den mest almindelige variant den samme mellem de to biblioteker. TK686 påvist én T→C, én G→A, én G→T, én G→-, én C→A, én T→A og fire C→A varianter. Fem af disse varianter opstod inden for en homopolymer streng, hvilket tyder på deres inkorporering i forsamlingen kan have været resultatet af sekventering fejl og lave samlede dækning. De andre kan have været resultatet af enten grønkorn haplotype variation, sekventering fejl, eller cytosin deamination, eller en kombination af disse faktorer. TK686-R havde én C→T, én G→T og én A→G. Varianter af C→T og G→T blev fundet i en homopolymer som ovenfor. I sidste ende, identiske komplet grønkorn genomer blev identificeret fra begge Læs sæt. En enkelt grønkorn genom fra TK686 blev kommenteret ved hjælp af Verdant21 og i forhold til andre medlemmer af stammen Andropogoneae. Alle standard grønkorn funktioner blev kommenteret: 8 rRNAs, 38 tRNAer og 84 protein kodende gener. Komplet grønkorn genom er tilgængelig fra GenBank (MF170217) og grønne27.

Potentiel bias fra reamplification biblioteker var også bestemmes gennem vurdering af procent GC og samlede anslåede transposon indhold. Procent GC blev estimeret ved hjælp af et brugerdefineret script24. Forskelle i GC indholdet af de to prøver var ubetydelig, med 49,7% GC i TK686 og 51.2% GC i TK686-R. Transposon sammensætning blev estimeret ved hjælp af Transposome28. 100.000 læser var tilfældigt subsampled for begge biblioteker, transposon sammensætning blev anslået ved hjælp af 90 procent identitet, en brøkdel dækning af 0,55, en klyngestørrelse på 100, og RepBase 21,10 græs gentagne reference indstille29. Dette blev gentaget 100 gange for at udføre bootstrapping på transposon skøn fra disse datasæt. Samlede genom procentsatser for store underfamilierne af transposoner blev udvundet fra Transposome udgang og middelværdi og standardafvigelse af disse for de 100 replikater blev anslået. Alle scripts, som bruges til at generere disse udgange kan findes i M. R. McKain Github opbevaringssted transposoner30, og alle resultater er blevet deponeret i Dryaden (doi:10.5061/dryad.r8t2m). Ved hjælp af de to mest udbredte transposon underfamilierne indikatorer (Copia og Gypsy lange terminal gentage retrotransposons), var resultaterne næsten identisk med Copia på 33.52 ± 4,00% og 31.68 ± 2.94% og Gypsy 24,83 ± 2,72% og 24.00 ± 2,35% i TK686 og TK686-Rasmussen, henholdsvis (tabel 3). Disse test resultater tyder på, at reamplification skridt af denne protokol ikke skabe meningsfuld sekventering bias for højtstående genom målinger. Dog skal det bemærkes, at dette enkelt eksempel ikke er fuldt repræsentativt for alle reamplified biblioteker. Denne enkelt test viser, at reamplification skridt i sagens natur ikke var påvirke genom målinger i TK686/TK686-R. Indførte bias vil ikke påvirke forsamlingen af et grønkorn genom givet tilstrækkelig dækning af sekventering, men det anbefales, at eksperimenter, som præsenteres i denne undersøgelse med TK686/TK686-Rasmussen, er udført på target lineages til at kontrollere, at bias ikke er opstår under studier undersøger varemærkeregistreringer element mangfoldighed.

Figure 1
Figur 1: Agarosen gel billeder a) DNA isolation og B) endelige sekventering biblioteker fra ti herbarium prøver. For hver lane brugt 3 µL DNA eller biblioteket. (A) DNA blev nedbrudt i alle herbarium isolering som set af den generelle smear. (B) endelige sekventering biblioteker skildrer en primær band af 300-500 basepar med en bredere fordeling af 200-1.000 basepar; sidstnævnte er mere udbredt i reamplified biblioteker. Baner til begge (A) og (B) blev identificeret af prøven og kan sammenlignes med resultaterne i tabel 2. Stigen størrelse blev afbildet i basepar (bp). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Cirkulære plot af Schizachyrium scoparium (TK686) grønkorn genom med annotation. Den færdigsamlede genom fra shotgun sekventering af herbarium-afledte DNA udstillet en samlet længde af 139,296 basepar (bp), en stor enkelt kopi region (LSC) i 81,401 bp, et inverted repeat region (IR) 22,669 bp, og et lille enkelt kopi region (SSC) af 12,557 BP. Alle standard protein-kodning gener, tRNAer og rRNAs for medlemmer af Andropogoneae stammen blev identificeret i anmærkningen. Venligst klik her for at se en større version af dette tal.

Tabel 2: DNA udvinding og bibliotek forberedelse resultater for ti herbarium prøver og fire reamplified biblioteker. Den samlede dobbelt strandede DNA på forskellige trin i protokollen demonstreret hvordan varierende kvalitet kan være, især når filtreret for størrelse. Venligst klik her for at downloade denne tabel.

Tabel 3: Sequencing statistikker for TK686 og den reamplified TK686R. Reamplification påvirker ikke den samlede incidens af svampe genom forurening, GC indhold estimering, transposon sammensætning skøn eller evnen til at samle hele grønkorn genomer. Venligst klik her for at downloade denne tabel.

Supplerende tabel 1: DNA udvinding og bibliotek forberedelse resultater for fyrre yderligere herbarium prøver, herunder tyve reamplified biblioteker. Samlede dobbelt strandede DNA på forskellige trin i protokollen demonstreret hvordan varierende kvalitet kan være, især når filtreret for størrelse. Venligst klik her for at downloade denne tabel.

Supplerende figur 1: Agarosen gel billeder af fyrre yderligere DNA isolering fra herbarium prøver. Både (A) og (B) skildrer tyve separat DNA isolering og demonstrere den karakteristiske nedbrydning af herbarium-afledte DNA. For hver lane, blev 3 µL DNA brugt. Baner til begge (A) og (B) blev identificeret af prøven og kan sammenlignes med resultaterne i supplerende tabel 1. Stigen størrelse er afbildet i basepar (bp). Hvide pletter på billedet er på grund af artefakter i gel imager, der ikke kunne fjernes med rengøring. Venligst klik her for at downloade denne figur.

Supplerende figur 2: Agarosen gel billeder af fyrre yderligere sekventering biblioteker fra herbarium-afledte DNA. For hver lane brugt 3 µL af biblioteket. Endelige sekventering biblioteker findes i begge (A) og (B) med en gennemsnitlig størrelse på 300-500 basepar. Sekundære bands set i nogle forstærkede prøver tyder på "bobler" af biblioteker. Baner til begge (A) og (B) identificeres ved hjælp af prøven og kan sammenlignes med resultaterne i supplerende tabel 1. Stigen størrelse er afbildet i basepar (bp). Venligst klik her for at downloade denne figur.

Supplerende figur 3: Agarosen gel billede af sekundære band fjernelse med en ekstra enkelt cyklus PCR trin. Venligst klik her for at downloade denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollen præsenteres her er en omfattende og robust metode til DNA isolation og sekventering bibliotek forberedelse fra tørret plante eksemplarer. Sammenhængen mellem metode og minimal behov for at ændre det baseret på modellen kvalitet gør det skalerbare for store herbarium-baserede sekventering projekter. Medtagelsen af en valgfri reamplification skridt for lavt udbytte biblioteker giver mulighed for optagelse af lav kvalitet, lav mængde, sjælden, eller historisk vigtige prøver, der ellers ikke ville være egnet til sekvensering.

Betydningen af oprindelige DNA udbytte
Herbarium-afledte DNA er ofte nedbrudt som følge af indledende modellen bevarelse11, med DNA af enheder mindre end 300 år gamle være så nedbrudt som DNA isoleret fra dyr rester, der er flere hundrede til tusinder af år gamle31 , 32. optimering af oprindelige DNA udbytte er derfor afgørende for at opnå tilstrækkelig høj kvalitet dsDNA for vellykkede sekventering bibliotek forberedelse. For græs arter, en optimal udbytte er opnået gennem den kombinerede brug af steriliseret sand og flydende kvælstof i den første slibning trin, giver en mere grundig ødelæggelse af cellevægge og frigivelse af nukleinsyrer. Denne metode øger både ønskeligt større dsDNA og uønskede mindre fragmenter (figur 1, supplerende figur 1, tabel 2, supplerende tabel 1). Efterfølgende perle rensningsetaper isolere og berige for fragmenter af en størrelse passende til sekventering (300-500 basepar), hvilket reducerer opsving men også berigende for længere fragmenter (tabel 2, supplerende tabel 1). Ændringer til de oprindelige DNA isoleret trin kan være nødvendigt baseret på slægt at stikprøven for at mindske virkningerne af sekundære metabolitter på downstream behandling18.

Optimering af bibliotek adaptere
Koncentrationen af adaptere til ligatur har en direkte virkning på mængden af adapter dimer i færdige biblioteker. Adapter dimerer skyldes adapter selvstændig ligatur når utilstrækkelig prøven er til stede, og forurene sekventering løber33. Den relativt lave samlede dsDNA fra herbarium prøver nødvendiggør fortynding af adaptere før ligatur. Adaptere kan være fortyndet 50-fold fra stock koncentrationen af 15 µM (Se Protokoltjenesten) lette høj overførselshastighed bibliotek forberedelse uden at skulle individuelt måle og fortyndes adapter til hver prøve (tabel 2, supplerende tabel 1). selvom mætning adaptere kunne i princippet nedsætte samlede bibliotek udbytte, det er usandsynligt, at herbarium prøver vil give dsDNA sådan overskydende af adapteren.

Variation i perle rengøring trin for højere udbytter
Størrelse udvalg under forberedelse af sekventering biblioteker sker normalt efter adapter ligatur, giver mulighed for forstærkning af fragmenter primært inden for den ønskede størrelse; Dette gøres ved at fjerne fragmenter, der er både større og mindre end størrelsen, mål. Det lave antal herbarium-afledte dsDNA for biblioteket forberedelse er forværret efter størrelse udvælgelse på dette trin, hvilket resulterer i unworkably lave samlede dsDNA og i sidste ende lavt udbytte i den endelige bibliotek. Ved at gennemføre en standard perle-rengøring trin ved hjælp af 90% volumen perler efter ligatur, stadig mere total dsDNA for berigelse taktfast forstærkning. Ekstremt små DNA fragmenter er fortrinsvis fjernet ved hjælp af 90% volumen perler. Størrelse udvælgelse er udført i det sidste trin på den forstærkede bibliotek, som sikrer berigelse af ønskede fragment størrelser. Samlede mængder af perler kan justeres for at markere det ønskede område, selvom to-trins bind 25 µL og 6 µL af perler er optimeret for at hente biblioteker af 400-500 basepar skær inden for denne protokol (figur 1B, supplerende figur 2).

Prøven redning gennem Reamplification af biblioteker
På trods af bedste praksis i DNA isolation og bibliotek forberedelse, kan endelige koncentrationer af sekventering biblioteker være utilstrækkelig for yderligere sekvensering. Den destruktive karakter af prøvetagning og ofte begrænset ofres materiale fra herbarium prøver tillader ikke altid gentage DNA isolation. Ved reamplifying biblioteket op til kan 12 ekstra PCR cyklusser, endda usædvanlig dårlig biblioteker gemmes. En standard primer par bruges til forstærkning, som er kompatible med enten dobbelt eller enkelt indekserede bibliotek protokoller. En primære bekymring for reamplification er indførelsen af bias, ofte gennem reduktion i GC-rige dele af genomet20. Ved hjælp af en high-fidelity polymerase (Se Tabel af materialer), disse potentielle bias er potentielt undgås. Dette er påvist gennem den minimale variation af GC indhold af sekventeret bibliotekernes TK686 og TK686-R (tabel 3). Som en anden verifikation, var transposon indholdet af både TK686 og TK686-R anslået og viste ingen mærkbare forskelle (tabel 3). Endelig, det hele grønkorn genom af denne tiltrædelse var samlet fra TK686 og TK686-R, hvilket resulterede i identiske sekvenser efter tæt kontrol af SNP variation mellem de to forsamlinger (figur 2, tabel 3). Disse forsøg tyder på, at standard genomisk målinger, som GC indhold og transposon sammensætning og evnen til at samle komplet grønkorn genomer, ikke kan påvirkes af reamplification. Dette åbner mulighed for at indarbejde herbarium prøver menes at være for forringet eller mangler i materialet til phylogenomic undersøgelser uden bekymring for indførte bias gennem PCR. Disse reamplified biblioteker kan også anvendes til sekvens capture34, selv om det ville være nødvendigt at teste, om SNP kald er forudindtaget. Det anbefales, at små tests af bias udføres med hvert projekt til at kontrollere, at bias ikke er indført i sekventering biblioteker.

Begrænsninger og mulige ændringer
Selv om denne protokol har arbejdet på kan hundredvis af herbarium prøver, dårligt bevaret væv stadig mislykkes på ethvert trin. Det er imidlertid overordentlig sjælden for biblioteker til at mislykkes fra væv med vellykket DNA ekstraktioner, især efter bibliotek redning gennem reamplification. Størrelse udvælgelse trin kan ændres til at målrette forskellige størrelse fragmenter eller reducere den brede vifte af fragmenter set i nogle endelige biblioteker. Som med alle plante-baserede udvinding protokoller, trin kan være nødvendigt at fjerne afstamning-specifikke sekundære forbindelser, som kan hæmme den samlede protokol. Som præsenteret, denne protokol giver en standardmetode for DNA isoleret og høj overførselshastighed bibliotek forberedelse til græs herbarium prøver, og gennem kontrol og eksperimenter er tilbøjelige til at kunne ændres til andre plante lineages.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, de har ingen konkurrerende interesser.

Acknowledgments

Vi takker Taylor AuBuchon-ældre, Jordan Teisher, og Kristina Zudock for assistance i prøvetagning herbarium prøver og Missouri botanisk have for adgang til herbarium prøver til destruktiv prøvetagning. Dette arbejde blev støtte af et tilskud fra National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics