Robuste DNA-Isolierung und Hochdurchsatz-Sequenzierung Bibliotheksbau für Herbar

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Dieser Artikel beschreibt ein detailliertes Protokoll für DNA-Isolierung und Hochdurchsatz-Sequenzierung Bibliotheksbau aus Herbarium Material einschließlich Rettung von sehr schlechter Qualität DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbarien sind eine unschätzbare Quelle von pflanzlichem Material, das in einer Vielzahl von biologischen Studien verwendet werden kann. Die Verwendung von Herbar ist verbunden mit einer Reihe von Herausforderungen einschließlich Probenqualität Erhaltung geschädigter DNA und destruktive Probenahme seltene Exemplare. Um effektiver Herbarium Material in großen Sequenzierung Projekten verwenden, ist eine zuverlässige und skalierbare Methode der DNA-Isolierung und Bibliothek Vorbereitung erforderlich. Dieses Papier zeigt eine robuste, Anfang-Ende Protokoll für DNA-Isolierung und hohem Durchsatz Bibliotheksbau von Herbar, die keine Änderung für Einzelproben erfordert. Dieses Protokoll ist für niedrige Qualität getrocknet Pflanze Material und nutzt vorhandene Methoden durch die Optimierung der Gewebe Schleifen, ändern Bibliothek Größenauswahl und die Einführung eines optionalen Reamplification Schritt für geringe Ausbeute Bibliotheken zugeschnitten. Reamplification von geringer Ausbeute DNA-Bibliotheken kann Proben abgeleitet von unersetzlichen und potenziell wertvollen Herbar, negiert die Notwendigkeit für zusätzliche destruktive Probenahme und ohne erkennbare Sequenzierung Voreingenommenheit für gemeinsame retten. phylogenetische Anwendungen. Das Protokoll ist auf Hunderten von Grasart geprüft worden, aber wird voraussichtlich nach Prüfung für den Einsatz in anderen pflanzlichen Linien angepasst werden. Dieses Protokoll kann durch extrem geschädigter DNA, wo Fragmente nicht in der gewünschten Größenordnung vorhanden sind, und sekundäre Pflanzenstoffe in einigen Pflanzenmaterial vorhanden, die saubere DNA-Isolierung hemmen begrenzt. Dieses Protokoll stellt insgesamt eine schnelle und umfassende Methode, die DNA-Isolierung und Bibliothek Vorbereitung von 24 Proben in weniger als 13 Stunden mit nur 8 h aktive Handhabungszeit mit minimalen Anpassungen ermöglicht.

Introduction

Herbarium Sammlungen sind potentiell wertvolle Arten und genomische Diversität für Studien einschließlich Phylogenetik1,2,3, Populationsgenetik4,5, Erhaltung Biologie6, invasive Arten Biologie7und Merkmal Evolution8. Die Fähigkeit, eine große Vielfalt von Arten, Populationen, geografische Orte und Zeitpunkte zu erhalten unterstreicht die "Schatztruhe"9 , die das Herbarium. Historisch, hat degradierten Artder Herbarium abgeleitet DNA PCR-basierten Projekten, oft verwies Forscher mittels nur Marker gefunden in hohe Kopie, wie Regionen von Chloroplast Genom oder die interne transkribierten Distanzstück (ITS) aus der ribosomalen behindert. RNA. Qualität der Proben und DNA variieren ausgiebig basierend auf Methoden der Konservierung9,10, mit Doppelstrang-Brüche und Fragmentierung von Wärme in der Trocknung werden die häufigsten Formen von Schäden, die Schaffung der so genannte 90 % DNA Überbrückungskupplung, die PCR-basierten Studien11belastet hat. Abgesehen von Fragmentierung ist das zweithäufigste Problem im Herbarium Genomics Verunreinigungen, wie z. B. die endophytische Pilze13 abgeleitet oder Pilze Obduktion erworben nach Sammlung aber vor dem Einbau in das Herbarium12, obwohl dieses Problem kann gelöst Bioinformatically rechts Pilze Datenbank (s.u.) gegeben werden. Eine dritte, und weniger üblich, Problem ist Sequenz Modifikation durch Cytosin Deamination (C/G→T/A)14, obwohl es wird geschätzt (~ 0,03 %) niedrig sein Herbarium Exemplare11. Mit dem Aufkommen von Hochdurchsatz-Sequenzierung (HTS) kann das Problem der Fragmentierung mit kurzen Lese- und Sequenzierung Tiefe12,15, so dass Genomebene Datenerfassung aus zahlreichen Proben mit niedriger Qualität überwunden werden DNA, und manchmal sogar ganze Genom-Sequenzierung15erlaubt.

Herbarium Proben werden immer häufiger verwendet und sind ein größerer Bestandteil der phylogenetische Projekte16. Eine aktuelle Herausforderung für HTS Herbar zu verwenden ist konsequent ausreichend Doppel stranded DNA, eine notwendige Voraussetzung für die Sequenzierung Protokolle, von zahlreichen Tierarten in einer fristgerechten Weise erhalten ohne Methoden zur individuellen Optimierung Proben. In diesem Papier wird ein Protokoll für die DNA-Extraktion und Bibliothek Vorbereitung der Herbarbelege demonstriert, nutzt die vorhandenen Methoden und ändert sie, um schnelle und reproduzierbare Ergebnisse zu ermöglichen. Diese Methode ermöglicht für die Komplettbearbeitung von Probe zu einer Bibliothek von 24 Proben in 13 h, mit Hands-on-Zeit 8 h oder 16 h, mit 9 h Arbeitsaufwand beträgt, wenn der optionale Reamplification-Schritt benötigt wird. Gleichzeitige Verarbeitung von mehr Proben ist erreichbar, wenn der limitierende Faktor Zentrifuge Kapazität und technisches Geschick. Das Protokoll soll nur typische Laborgeräte (Thermocycler, Zentrifuge und magnetische steht) anstelle von Spezialausrüstung, wie z. B. einen Vernebler oder Sonikator, für Scheren DNA benötigen.

DNA-Qualität, Fragmentgröße und Menge sind Faktoren für den Einsatz von Herbar im Hochdurchsatz-Sequenzierung Experimente begrenzt. Weitere Methoden zum Herbarium DNA zu isolieren und Erstellen von Hochdurchsatz-Sequenzierung Bibliotheken haben gezeigt, das Dienstprogramm zu verwenden so wenig wie 10 ng DNA-16; jedoch bedürfen experimentell ermitteln die optimale Anzahl von PCR-Zyklen für Bibliothek Vorbereitung erforderlich. Dies wird unpraktisch, beim Umgang mit äußerst geringen Mengen an lebensfähigen Doppel DNA (DsDNA), gestrandet, da einige Herbar nur genügend DNA für eine einzelne Bibliothek Zubereitung produzieren. Die hier vorgestellte Methode verwendet eine einzelne Zahl der Zyklen unabhängig von Sample-Qualität, so dass keine DNA Bibliothek Optimierungsschritte verloren geht. Stattdessen wird ein Reamplification Schritt aufgerufen, wenn Bibliotheken nicht die Mindestbeträge für die Sequenzierung erforderlich erfüllen. Viele Herbarium Proben sind selten und besitzen wenig Material macht es schwierig, destruktive Probenahme in vielen Fällen zu rechtfertigen. Um dem entgegenzuwirken, die vorgestellte Protokoll ermöglicht DsDNA Eingang Größen von weniger als 1,25 ng in der Bibliothek Vorbereitungsprozess, Erweiterung des lebensfähigen Proben für Hochdurchsatz-Sequenzierung und die Notwendigkeit einer destruktiven Entnahme von Proben zu minimieren.

Das folgende Protokoll wurde optimiert für Gräser und getestet auf Hunderte verschiedener Arten von Herbarium Proben, obwohl wir erwarten, dass das Protokoll auf viele andere Pflanzengruppen angewendet werden kann. Freuen Sie sich auf eine optionale Wiederherstellungsschritt, die verwendet werden, um niedrige Qualität und/oder seltene Exemplare zu speichern. Basierend auf mehr als zweihundert Herbar getestet, funktioniert dieses Protokoll auf Proben mit niedrigen Gewebe ein- und Qualität, so dass für die Erhaltung der seltene Exemplare durch minimale destruktive Probenahme. Hier wird gezeigt, dass dieses Protokoll hochwertige Bibliotheken bieten kann, die für Datenqualität-basierte Projekte sequenziert werden können.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. vor dem Start

  1. Machen frische Cetyl Trimethylammonium-Bromid (CTAB) Puffer17 durch Zugabe von 20 g CTAB, 10 g von Polyvinylpyrrolidon (PVP) 40, 100,0 mL 1 M Tris pH 8.0, 40 mL 0,5 M Ethylenediaminetetraacetic Säure (EDTA) pH 8.0, 280,0 mL 5 M NaCl und 400,0 mL Reagenz Wasser zusammen, und das Gesamtvolumen zu 1 L per Reagenz-Grade Wasser bringen. Stellen Sie den pH-Wert auf 8.0.
    Hinweis: Zusätzliche Reagenzien können CTAB je nach sekundären Verbindungen in einzelnen Taxa hinzugefügt werden. Finden Sie unter Allen Et al. 18 für eine vollständige Liste der additive Reagenzien.
  2. Fügen Sie 10 µL des β-Mercaptoethanol pro 5 mL CTAB Puffer.
    Hinweis: Dies kann in Chargen von 50 mL vorbereitet und für 3 – 4 Wochen bei Raumtemperatur gelagert.
    1. Erhitzen Sie die CTAB Lösung im Wasserbad 65 ° C.
  3. Kühlen Sie Mörser und Stößel in-20 ° C für mindestens 20 Minuten.
  4. 4 Sätze von 2 x n 2-mL-Röhrchen beschriften (wobei n = Anzahl der Proben). 1 Satz der beschrifteten Rohre auf Eis gelegt.
  5. Kühlen Sie Isopropanol auf Eis oder im Gefrierschrank-20 ° C.
  6. Festphase reversible Immobilisierung (SPRI) Perlen (siehe Tabelle der Materialien) aus dem Kühlschrank nehmen und auf Raumtemperatur (mindestens 30 min) equilibrate lassen.
  7. Bereiten Sie 80 % Ethanol.
  8. Wählen Sie Herbar für Extraktion und rufen Sie ab ~ 1 cm2oder 10 mg des Gewebes pro Probe, vorzugsweise Blattmaterial.

(2) DNA-Extraktion

  1. Zermahlen Sie ~ 1 cm2 vorgewählte Herbarium Gewebe mit prechilled Mörser und Stößel. Flüssigem Stickstoff und 30 – 50 mg sterilisiert Sand hinzufügen. Schleifen Sie bis Gewebe in feines Pulver verwandelt.
    Hinweis: 10 mg oder mehr Gewebe ist wünschenswert, aber weniger arbeitete auch in einigen Fällen. Nachdem der flüssige Stickstoff verdampft, fügen Sie mehr Bedarf, bis das Gewebe vollständig gemahlen ist hinzu. Eine weitere gängige Methode zur Störung der Zellen und Gewebe ist die Verwendung von einem Wulst-Schläger. Diese Methode wurde jedoch nicht gut für die Proben, die in diesen Experimenten verwendeten arbeiten gefunden.
  2. Übertragen Sie das gefrorene Pulver in zwei 2 mL-Röhrchen (nicht mehr als die Hälfte der Röhre Volumen hinzufügen). Jedes Rohr 600 µL des warmen CTAB Lösung hinzu und mischen Sie die Rohre gründlich durch Inversion und aufschütteln.
    Hinweis: Da die Quantität und Qualität des Herbarium Material ist oft niedrig, hilft DNA-Isolierung in zwei Wiederholungen durchführen, um höhere Erträge zu erzielen.
  3. Inkubieren Sie die Proben im Wasserbad 65 ° C für 1-1,5 h, vortexen alle 15 min.
  4. Zentrifuge Proben bei 10.000 x g für 5 min. übertragen Überstands auf eine neue Reihe von beschrifteten Röhrchen (~ 500 µL). Entsorgen Sie die Tablette mit einem standard-chlorierten Entsorgung Verfahren.
  5. Jedes Rohr 4 µL RNase-A (10 mg/mL) hinzu und mischen Sie durch invertieren oder pipettieren. Inkubieren Sie die Proben bei 37 ° C in einem Hitze-Block oder Wasserbad für 15 min.
  6. Fügen Sie ein gleiches Volumen (~ 500 µL) von einem 25:24:1-Phenol: Chloroform: Isoamyl-Alkohol-Gemisch, wenn die Rohre Raumtemperatur erreicht haben. Mischen Sie gründlich, von oben und unten pipettieren und/oder mit Inversion. Zentrifugieren Sie die Rohre bei 12.000 x g für 15 min. Transfer die wässrige Schicht (obere Schicht), eine neue Reihe von beschrifteten Röhrchen (~ 400 µL). Entsorgen Sie die organische Schicht in einem chlorierten Abfallbehälter.
    Hinweis: Schritt 2.6 kann wiederholt werden wenn große Mengen an sekundären Verbindungen dürften in Pflanzenmaterial.
  7. Fügen Sie ein gleiches Volumen (~ 400 µL) von 24:1 Chloroform: Isoamyl-Alkohol-Gemisch. Mischen Sie gründlich, von oben und unten pipettieren und/oder mit Inversion. Zentrifugieren Sie die Rohre bei 12.000 x g für 15 min. Transfer die wässrige Schicht (obere Schicht), eine neue Reihe von prechilled, beschriftete Röhrchen (~ 300 µL). Entsorgen Sie die organische Schicht in einem chlorierten Abfallbehälter.
  8. Jede Röhre ein gleiches Volumen (~ 300 µL) prechilled Isopropanol und 12 µL 2,5 M Natriumacetat hinzufügen. Inkubieren Sie Proben bei-20 ° C für 30 – 60 min.
    Hinweis: Die Inkubationszeiten erweiterbar (bis zu Inkubation über Nacht), aber DNA Qualität sinkt je länger brüten die Proben.
  9. Nehmen Sie die Proben aus dem Gefrierschrank und Zentrifuge die Rohre bei 12.000 x g für 15 min. entfernen und entsorgen den Überstand vorsichtig ohne zu stören das Pellet. Waschen Sie das Pellet durch Aufhängung mit frischen 70 % Ethanol (ca. 300 – 500 µL). Konsolidieren Sie für jede doppelte Probe die zwei einzelnen Pellets in einem mit begleitenden Ethanol.
    Hinweis: Proben in einem Rohr mit Ethanol zunächst gefestigt werden sollte und dann fortfahren. Es ist nicht notwendig, jede Probe mit Ethanol separat waschen.
  10. Zentrifugieren Sie die Rohre bei 12.000 x g für 10 min. entfernen und entsorgen Sie des Überstands sanft ohne zu stören das Pellet. Die Pellets der Luft trocknen lassen.
    Hinweis: Proben können getrocknet werden schneller mit trockener Hitze Block (65 ° C nicht überschreiten). Stellen Sie sicher, dass die Proben nicht übermäßig trocken, da dies die letzte Ausbeute an DNA zu verringern.
  11. Die isolierte DNA in 50 µL 1 X TE auszusetzen. Speichern Sie in den-20 ° C-Gefrierschrank für langfristige Lagerung oder 4 ° C für den Einsatz in der Folgewoche.

3. Qualitätskontrolle (QC)

  1. Führen Sie eine Agarosegel für die Qualitätsprüfung.
    1. Bereiten Sie 1 X Tris/Borat/EDTA (TBE) Puffer indem 54 g Tris-Base, 27,5 g Borsäure und 3,75 g EDTA Binatrium Salz, das Gesamtvolumen bis 5 L mit Reagenz Grade Wasser zu bringen.
    2. Bereiten Sie eine 1 % Agarose-Gel durch Zugabe von 1 g Agarose in 100 mL 1 X TBE. Mikrowellen Sie-die Lösung bis keine Agarose sichtbar ist. Hinzufügen von 0,01 % Nukleinsäure-Gel Fleck (siehe Tabelle der Materialien). Lassen Sie die Küvette abkühlen, bis es handwarm ist. Mischen Sie gut durch Rühren. Ein Gel-Tiefziehschiene Gießen Sie Agarose hinzu und lassen Sie es sich bis es erstarrt.
    3. Mix 3 µL der Probe, 2 µL Reagenz Grad Wasser und 1 µL 6 x laden Farbstoff. Laden Sie die Proben in der Gelmatrix in Anbetracht ihrer Bestellung.
    4. Laufen Sie die Proben für 60-70 min bei 60 – 70 V. Bild das Gel unter UV-Licht mit korrekte Belichtung und Fokus.
      Hinweis: Präsenz einer klaren hochmolekularen Band ist ein Zeichen von hoher Qualität DNA, während Schlieren normalerweise DNA-Abbau zeigen. Die meisten Herbar werden abgebaut.
  2. Führen Sie eine DsDNA Quantifizierung Analyse (siehe Tabelle der Materialien) zu bestimmen, die Menge der doppelten stranded DNA.
    1. Verwenden Sie 2 µL der Probe für die Analyse.
      Hinweis: Verdünnungen sind nicht für die Quantifizierung Analyse des Herbarium Material benötigt, da sie neigen dazu, in minimalen Mengen. Erfolgreiche Bibliotheken wurden aus so wenig wie 1.26 ng total DsDNA von diesem Schritt gemacht.

4. DNA Scheren

Hinweis: Dies ist eine optimierte Version von einem kommerziellen Doppelstrang-Fragmentase Protokoll (siehe Tabelle der Materialien).

  1. Ort DsDNA Fragmentierung Enzym auf dem Eis nach dem aufschütteln für 3 s.
  2. In einem sterilen 0,2 mL Polymerase-Kettenreaktion (PCR) Rohr isoliert Mischung 1 – 16 µL DNA mit 2 µL Fragmentierung Reaktion Puffer zu begleiten. Bringen Sie das Gesamtvolumen in 18 µL indem Nuklease kostenlos Wasser. Fügen Sie 2 µL DsDNA Fragmentierung Enzyms und Wirbel der Mischung für 3 s.
    Hinweis: Der benötigte DNA variiert je nach DNA-Konzentration (Ziel für 200 ng insgesamt in der Röhre).
  3. Inkubieren Sie die Proben bei 37 ° C für 8,5 min. Dann fügen Sie 5 µL 0,5 M EDTA an den Rohren.
    Hinweis: Dieser Schritt muss ausgeführt werden, sobald die Inkubationszeit vorbei ist, die Reaktion zu beenden und verhindern, dass DNA-Proben zu scheren.

(5) Bead Clean-up

  1. Homogenisieren der SPRI-Perlen durch aufschütteln.
  2. Bringen Sie das Gesamtvolumen der geschert DNA durch Zugabe von 25 µL des freien Wassers Nuklease 50 µL. Fügen Sie 45 µL Raumtemperatur SPRI Perlen (90 % Volumen hinzu) 50 µL geschert DNA und Mischung gründlich von oben und unten pipettieren.
    Hinweis: Hinzufügen von Perlen mit 90 % der Gesamtstichprobe Volumen geschieht, um die kleinste von DNA-Fragmenten, oft unter 200 Basenpaaren zu entfernen.
  3. Lassen Sie die Proben zu inkubieren, für 5 min. die Rohre auf einer magnetischen Platte und lassen für 5 min. sorgfältig sitzen entfernen und entsorgen den überstand.
    Hinweis: Achten Sie nicht zu stören die Perlen, wie sie die gewünschten DNA-Ziele enthalten.
  4. Die Rohre auf die Magnetstativ fügen Sie 200 µL frisch 80 % Ethanol hinzu. Inkubation bei Raumtemperatur für 30 s und dann sorgfältig entfernen und entsorgen den überstand. Wiederholen Sie diesen Schritt einmal. Luft trocknen die Perlen für 5 min, während das Rohr auf die Magnetstativ mit seinem Deckel geöffnet ist.
    Hinweis: Vermeiden Sie übermäßig trocknen die Perlen. Dies führt zu niedrigeren Wiederherstellung der DNA.
  5. Entfernen Sie die Rohre vom Magneten. Die DNA aus den Perlen in 55 µL 0.1 X TE eluieren und von oben und unten Pipettieren gründlich mischen. Inkubation bei Raumtemperatur für 5 min. Ort Rohre auf die Magnetstativ und warten auf die Lösung zu löschen (~ 2 min).
  6. 52 µL des Überstands abziehen. Führen Sie eine DNA-Quantifizierung Analyse auf die Proben zu überprüfen, die Erholung und die anfängliche Konzentration, die in der Bibliothek Prep geht.
    Hinweis: Bibliotheken wurden mit insgesamt DsDNA voraussichtlich weniger als 1,25 ng, aber in jedem Fall Reamplification erforderlich war.

6. Bibliothek Vorbereitung

Hinweis: Dies ist eine modifizierte Version eines handelsüblichen Bibliothek-Kit (siehe Tabelle der Materialien -Protokoll).

  1. Ende Prep
    1. Fügen Sie 3 µL Endonuklease und Phosphat tailing Enzyme und 7 µL der begleitenden Reaktion Puffer zu 50 µL der gereinigten, abscherend DNA. Mischen Sie von oben und unten Pipettieren gründlich. Drehen Sie die Rohre, um Luftblasen zu entfernen.
      Hinweis: Das Gesamtvolumen sollte 60 µL.
    2. Legen Sie die Proben in einem Thermocycler mit dem folgenden Programm: 30 min bei 20 ° C, 30 min bei 65 ° C, dann halten Sie bei 4 ° C.
      Hinweis: Beheizte Deckel wurde eingerichtet, um ≥75 ° C
  2. Adapter-Ligation
    1. Verdünnen Sie dem Adapter 25 – 50 Falte (arbeiten Adapter Konzentration von 0,6 – 0,3 µM). Die Rohre 30 µL Ligatur-master-Mix, 1 µL der Ligatur Enhancer und 2,5 µL des Adapters für Hochdurchsatz-kurze lesen Sie Sequenzierung hinzufügen.
      Hinweis: Das Gesamtvolumen sollte 93.5 µL.
    2. Mischen Sie von oben und unten Pipettieren gründlich. Drehen Sie die Rohre, um Luftblasen zu entfernen. Inkubieren Sie die Röhrchen bei 20 ° C für 15 min.
    3. Fügen Sie 3 µL kommerzielle Mischung von Uracil DNA Glycosylase (UDG) und der DNA-Glycosylase-Lyase Endonuklease VIII (siehe Tabelle der Materialien) an den Rohren. Sicherzustellen, dass das Gesamtvolumen 96,5 µL. gründlich mischen und Inkubation bei 37 ° C für 15 min mit einem Thermocycler.
      Hinweis: Der Deckel sollte festgelegt werden, auf ≥47 ° C. Die ursprüngliche Version des kommerziellen Protokolls hat Größenauswahl nach dem Adapter Ligatur Schritt, gefolgt von eine Perle Bereinigung als letzten Schritt. Dieses Protokoll, das höhere Erträge erreicht, schaltet die Reihenfolge dieser Schritte und Größenauswahl als letzten Schritt implementiert.
  3. Reinigung, Enzyme und kleine Fragmente zu entfernen
    1. Magnetische Beads durch Vortexen zu homogenisieren.
    2. 78 µL SPRI magnetische Beads (80 % Volumen) und gründlich mischen durch Pipettieren rauf und runter.
      Hinweis: Hinzufügen von Perlen bei 80 % der Gesamtstichprobe Volumen geschieht, um die kleinsten DNA-Fragmente, die oft kürzer als 250 Basenpaare sind zu entfernen. Die strengere Entfernung von kleinen DNA-Fragmente ist, (i) entfernen überschüssige Adapter und (Ii) Verstärkung der größeren Fragmente in den folgenden Schritten zu betonen.
    3. Lassen Sie die Proben für 5 min. Put inkubieren Sie die Rohre auf einer magnetischen Platte für 5 min. vorsichtig entfernen und entsorgen den Überstand, der die DNA außerhalb des Größenbereichs der gewünschten enthält.
      Hinweis: Achten Sie darauf, die Perlen zu stören, die die gewünschten DNA-Ziele enthalten.
    4. Die Rohre auf die Magnetstativ fügen Sie 200 µL frisch 80 % Ethanol hinzu. Inkubation bei Raumtemperatur für 30 s und dann sorgfältig entfernen und entsorgen den überstand. Wiederholen Sie diesen Schritt einmal. Luft trocknen die Perlen für 5 min, während das Rohr auf die Magnetstativ mit geöffnetem Deckel.
      Hinweis: Vermeiden Sie über die Perlen trocknen. Dies führt zu niedrigeren Wiederherstellung der DNA.
    5. Entfernen Sie die Rohre vom Magneten. Eluieren DNA Ziel von die Perlen durch Zugabe von 17 µL 0.1 X TE und Mischen von Pipettieren rauf und runter.
    6. Inkubation bei Raumtemperatur für 5 min. Ort Rohre auf die Magnetstativ und warten auf die Lösung zu löschen (~ 2 min).
    7. 15 µL des Überstands abziehen.
  4. PCR-Amplifikation
    1. 15 µL der gereinigten Adapter ligiert DNA fügen Sie 25 µL der High-Fidelity-PCR-master-Mix, 5 µL Hochdurchsatz-kurze lesen Sequenzierung Bibliothek Prep 5' Grundierung und 5 µL Hochdurchsatz-kurze lesen Sie Sequenzierung Bibliothek Prep 3' Grundierung hinzu.
      Hinweis: Gesamtvolumen sollte 50 µL.
    2. Mischen Sie gut durch aufschütteln. Legen Sie die Proben in einem Thermocycler mit den Einstellungen finden in Tabelle 1: Thermocycler Verstärkung Einstellung.
      Hinweis: Eine große Anzahl von Zyklen ist aufgrund der geringen Anzahl der Eingabe DNA erforderlich.
Zyklus-Schritt Temp. Zeit Zyklen
Anfängliche Denaturierung 98 ° C 30 s 1
Denaturierung 98 ° C 10 s 12
Glühen/Verlängerung 65 ° C 75 s 12
Letzte Erweiterung 65 ° C 5 min 1
Halten 4 ° C

Tabelle 1: PCR-Protokoll Denaturierung, Glühen und Erweiterung Zeiten und Temperaturen. Temperatur und Zeit wurden für die Reagenzien präsentiert in diesem Protokoll optimiert. Wenn Reagenzien geändert werden, sollten Temperaturen und Zeiten nochmals optimiert werden.

  1. Größenauswahl für die gewünschte Bibliotheksgröße
    Hinweis: Diese Perle Schritt werden Fragmente oberhalb und unterhalb des Zielbereichs entfernt.
    1. Homogenisieren Sie SPRI Perlen durch aufschütteln.
    2. 25 µL (50 % Volumen) Raumtemperatur magnetische Beads und gründlich mischen durch Pipettieren rauf und runter. Lassen Sie die Proben zu inkubieren, für 5 min. die Rohre auf einer magnetischen Platte und lassen für 5 min. sorgfältig sitzen entfernen und den Überstand auf eine neue Reihe von beschrifteten Rohre übertragen.
      Hinweis: Dieser Band ist je nach gewünschten Bibliotheksgröße einstellbar. Der Überstand enthält DNA-Fragmente der gewünschten Größe. In die erste Perle Inkubation sind die Perlen größeren Bibliothek Fragmente verbindlich. Diese sind zu konzentrieren auf die im Bereich von 400 – 600 Basenpaaren entfernt. Der Überstand enthält kleinere Fragmente.
    3. Hinzu kommen 6 µL Raumtemperatur SPRI Perlen der Überstand und Mischung gründlich durch Pipettieren rauf und runter. Lassen Sie die Proben zu inkubieren, für 5 min. die Rohre auf einer magnetischen Platte und lassen für 5 Minuten sitzen.
      Hinweis: Dieser Band kann je nach Größe der gewünschten Bibliothek gemäß Schritt 6.5.2 angepasst werden.
    4. Sorgfältig entfernen und entsorgen des Überstands.
      Hinweis: Achten Sie darauf, die Perlen zu stören, die die gewünschte DNA enthalten. In der zweiten Wulst Inkubation verbindlich sind die Perlen den Fragmenten verließ, nachdem die anfängliche Beseitigung der größten DNA-Fragmenten. Dieser Satz von Fragmenten ist in der Regel in der gewünschten Größenordnung.
    5. Die Rohre auf die Magnetstativ fügen Sie 200 µL frisch 80 % Ethanol hinzu. Inkubation bei Raumtemperatur für 30 s, dann vorsichtig entfernen und entsorgen den überstand. Den Vorgang wiederholen. Luft trocknen die Perlen für 5 min, während das Rohr auf die Magnetstativ mit geöffnetem Deckel.
      Hinweis: Vermeiden Sie übermäßig trocknen die Perlen. Dies führt zu niedrigeren Wiederherstellung der DNA.
    6. Entfernen Sie die Rohre vom Magneten. Das Ziel der DNA aus der Perlen in 33 µL 0.1 X TE eluieren und gründlich mischen durch Pipettieren rauf und runter.
    7. Inkubation bei Raumtemperatur für 5 min. Ort Rohre auf die Magnetstativ und warten auf die Lösung zu löschen (~ 2 min). Ziehen Sie 30 µL des Überstandes und Transfer zu 2 mL Röhrchen (siehe Tabelle der Materialien) für die Lagerung.
      Hinweis: Die Bibliotheken können bei-20 ˚C für die Langzeitspeicherung aufbewahrt werden.
  2. Qualitätskontrolle
    1. Führen Sie einen Qualitätskontrolle-Test auf DNA-Bibliotheken. Beziehen sich auf Schritte 3.1 und 3.2.
      Hinweis: Für DNA-Bibliotheken, 96 V Gel für ~ 45 min Laufzeit.
  3. Bibliothek Reamplification: Optional wenn Bibliothek Menge nicht ausreicht.
    Hinweis: Proben mit Bibliothek-Konzentrationen unter 10 nM kann mit den folgenden Schritten Professor werden. Reamplification der niedrigen Konzentration Bibliotheken kann praktikable Ergebnisse für die Sequenzierung erreichen, aber Reamplification kann eine geringe Verschiebung in der Basenzusammensetzung Vielfalt führen, obwohl gesammelten Daten (Tabelle 3) deuten darauf hin, dass dies für bestimmte Metriken vernachlässigbar ist .
    1. Verdünnen Sie die universelle Reamplification Primer 10-fach mit 0,1 X TE.
    2. Niedrige Konzentration Bibliotheken 15 µL 25 µL der High-Fidelity-PCR-master-Mix, 5 µL verdünnter universal Reamplification Primer 1 (AATGATACGGCGACCACCGA) und 5 µL verdünnter universal Reamplification Primer 2 (CAAGCAGAAGACGGCATACGA) hinzufügen. Hinweis: Gesamtvolumen sollte 50 µL.
    3. Mischen Sie gut durch aufschütteln. Legen Sie die Proben in einem Thermocycler mit den Einstellungen finden in Tabelle 1: Thermocycler Verstärkung Einstellung
      Hinweis: Die große Anzahl von Zyklen ist aufgrund der geringen Menge der Eingabe DNA erforderlich.
    4. Perle-Bereinigung
    5. Homogenisieren Sie SPRI Perlen durch aufschütteln. 45 µL Raumtemperatur SPRI Perlen (90 % Volumen) und gründlich mischen durch Pipettieren rauf und runter.
    6. Lassen Sie die Proben für 5 min. legen die Rohre auf einer magnetischen Platte für 5 min inkubieren.
    7. Sorgfältig entfernen und entsorgen des Überstands, der die unerwünschte DNA enthält.
      Hinweis: Achten Sie darauf, die Perlen zu stören, die die gewünschten DNA-Ziele enthalten.
    8. Die Rohre auf die Magnetstativ fügen Sie 200 µL frisch 80 % Ethanol hinzu. Inkubation bei Raumtemperatur für 30 s, und dann sorgfältig entfernen und entsorgen den überstand. Wiederholen Sie diesen Schritt einmal.
    9. Luft trocknen die Perlen für 5 min, während das Rohr auf die Magnetstativ mit seinem Deckel geöffnet ist.
      Hinweis: Vermeiden Sie übermäßig trocknen die Perlen. Dadurch können geringere Wiederherstellung des DNA-Ziels.
    10. Entfernen Sie die Rohre vom Magneten. Das Ziel der DNA aus der Perlen in 33 µL 0.1 X TE eluieren und gründlich mischen durch Pipettieren rauf und runter.
    11. Inkubation bei Raumtemperatur für 5 min. Ort Rohre auf die Magnetstativ und warten auf die Lösung zu löschen (~ 2 min).
    12. 30 µL des Überstands abziehen. Die Bibliotheken können bei-20 ° C für die Langzeitspeicherung gespeichert werden.
  4. Qualitätskontrolle
    1. Führen Sie einen Qualitätskontrolle-Test auf DNA-Bibliotheken. Beziehen sich auf Schritte 3.1 und 3.2. Das Gel für ~ 45 min Laufzeit für DNA-Bibliotheken 96 V.
      Hinweis: Wenn eine doppelte-Band im Gel gesehen wird, ist dies wahrscheinlich eine Folge der Grundierung Erschöpfung aus dem Reamplification-Schritt. Die Bänder können entfernt werden, von 6,9 zu wiederholen, aber mit nur ein Zyklus in der PCR-Programm in Tabelle 1dargestellt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA-Isolierung und endgültige Bibliothek Ertrag
In dieser Studie wurde die Wirksamkeit des Protokolls für die Isolierung von Herbarium DNA und die Verwertung von hochwertigen Sequenzierung Bibliotheken nachgewiesen mit fünfzig verschiedenen Proben mit das älteste aus dem Jahre 1920 und der jüngste ab 2012 (Tabelle 2). Für jede Probe wurde etwa 10 mg Blattgewebe für DNA-Isolierung verwendet. Grüner Blattgewebe wurde bevorzugt, falls verfügbar, und kein Gewebe mit offensichtlichen Pilzbefall wurde ausgewählt. Erfolgreiche Isolationen können erfolgen mit gelben oder braunen Gewebe, obwohl der Ertrag sollte voraussichtlich niedriger sein. Insgesamt doppelte stranded DNA (DsDNA) aus der anfänglichen Isolation reichten von 3,56 ng zu 2.610 ng. Wie erwartet, wurde DNA gewonnenen Herbar stark abgebaut (Abbildung 1A, Supplemental Abbildung 1). Ein Teil dieser Isolationen dienten für enzymatische Scheren (1,26 – 464 ng). Obwohl Herbarium DNA bereits durch den Prozess der Erhaltung geschert, erfordert Optimierung des Protokolls zusätzliche Scheren um allgemeine Bibliothek Ertrag zu verbessern. Die gesamte Heilung der DsDNA nach dem Scheren reichten von < 1 bis 51 % der Eingabe DsDNA, wodurch ein Minimum von weniger als 1,25 ng DNA Bibliothek Vorbereitung und maximal 328 ab ng. Der extreme Verlust der DNA in einigen Proben kann die ohnehin schon geringe Fragmentgröße für einen Großteil der DNA vor der enzymatischen Schur (Abbildung 1A, ergänzende Abbildung1) zugeschrieben werden. Die Verwendung von einer 90 % des Volumens Wulst Bereinigung auf der DNA geschoren entfernt absichtlich die kleinsten Fragmente von DNA, für größere, wünschenswerter Fragment Größen zu bereichern. Diese kleinen Fragmente wurden vor allem in Proben, TK463, TK657 und TK694, gesehen, wie durch ein intensives Signal bei 100 Basenpaaren (Abbildung 1A) bezeichnet.

Die Gesamtmenge der Bibliothek Post Größenauswahl reichte von 1,425 ng zu 942.5 ng (Tabelle 2, zusätzliche Tabelle1). Für 23 der Proben, die Extraktion und Bibliothek Vorbereitung keine ausreichende Menge an Bibliothek Ausbeute (< 10 nM; Zusätzliche Tabelle1 Tabelle 2), also diese Proben unterzogen wurden die Schritte Reamplification und Wiederherstellung des Protokolls, wodurch in einem 14-680 X Erhöhung der gesamten Bibliothek (Tabelle 2, zusätzliche Tabelle1). Endgültige Bibliotheken führte ein Band zwischen 350 und 500 Basenpaaren (Abbildung 1 b, Supplemental Abbildung 2). Zeitweise wurde eine zweite Band, die größer als die erwarteten Bibliothek wurde gesehen (Abbildung 1 b, Supplemental Abbildung 2). Dies geschah als die Reamplification PCR zur Verfügung Primer erschöpft und begann Glühen Bibliothek Adapter nicht homologe DNA-Fragmente. Dadurch entsteht ein Molekül, wo die Enden (Adapter) waren richtig glühen, aber die DNA einfügen nicht. Dieses "sprudelte" Molekül erschien auf ein Gel, größer als es langsamer durch die Gelmatrix bewegt. Diese Glühen Fehler wurden behoben, durch die Vorbereitung einer anderen Reamplification Reaktion aus der bereits reamplified Bibliothek und läuft es für einen einzigen Zyklus. Diese Einzelzyklus Primer vorgesehenen richtigen Glühen und Verstärkung, entfernen das zweiten Band (ergänzende Abbildung 3).

Reamplification der Bibliotheken erleichtert letzte Bibliothek Konzentrationen von mindestens 10 nM. Diese Konzentrationen Bibliotheken verdünnt werden, um gleiche Molarity und gebündelt in paritätisch, helfen, Probleme negieren, die mit ungleichen Probenqualität ergeben hätten und Sequenzierung Bibliothek Ausbeute erlaubt. Wenn das Ziel eines Projekts Chloroplast Genom Sequenzierung, dann der Gesamtbetrag der Sequenzierung erforderlich als verschiedene Übertragungslinien variiert und Gewebe unterscheiden sich in der Prozent der Gesamtzahl der Lesevorgänge, die ihren Ursprung in Chloroplast DNA-19. In der Regel 50 – 100 x projizierte Berichterstattung über das Chloroplast Genom ist ausreichend für die Montage und Sequenzierung läuft können um bis zu 70 Personen je nach Spezies und Sequenzierung Methode gehören gebündelt werden.

Tests für Verunreinigungen, Bias und Variation, die durch Reamplification verursacht
Eine bemerkenswerte Sorge für HTS-Sequenzierung ist Einführung der Voreingenommenheit in Bibliotheken durch umfangreiche PCR Verstärkung20. Testen Sie die Auswirkungen von Reamplification und Bias gemeinsam phylogenetische Anwendungsmöglichkeiten der Herbarium Material zu identifizieren, haben wir eine erfolgreich sequenzierte Bibliothek (TK686) mit der gleichen Bibliothek verdünnt 1:5 und Professor (benannten TK686-R) verglichen. Beide TK686 und TK686-R wurden jeweils auf eine Illumina HiSeq4000 an der University of Illinois Roy J. Carver biotechnologischen Zentrum und der Michigan State University Forschung Technologie Support Facility, sequenziert, mit 150 Basenpaare gekoppelten Ende liest (siehe Tabelle 3 Einzelheiten Sequenzierung). Rohe liest wurden in der NCBI SRA (SRP128083) hinterlegt. Lesevorgänge wurden gereinigt, mit Trimmomatic v.0.3621 einschließlich Adapter Trimmen mit NEB Adapter Sequenz, Qualität für eine durchschnittliche Phred Score von 20 für eine 10 Basenpaare Schiebefenster, Filterung und ein Minimum abgeschnitten Größe 40 Basenpaare. Als eines der Hauptprobleme mit Herbar Pilzbefall, schätzte Kontamination durch die Zuordnung liest gegen einen Teil des JGI MycoCosm pilzartige Genom Datenbank22 (312 nuklearen Genomen und 79 mitochondrische Genome) mit bowtie2 v . 2.2.923 mit der "sehr empfindlich-lokal" Parametersatz. TK686 und TK686-R Bibliotheken waren ununterscheidbar in nuklearen Pilzbefall (9,24 % und 9,68 %, beziehungsweise) und mitochondriale Pilzbefall (0,94 % und 0,8 %) (Tabelle 3). Obwohl dies nur ein Beispiel, legt es nahe, dass Pilzbefall Herbarium Proben ist nicht zu vernachlässigen und sollte vor der Verwendung Herbarium abgeleitet Sequenzdaten entfernt werden. In M. R. McKain GitHub Repository Herbarium Genomics24finden die Datenbank und Befehle zur Identifizierung und Entfernung von Pilzbefall.

Chloroplast Genom-Sequenzierung wird häufig verwendet für phylogenetische Analysen und Herbar werden zunehmend als Quelle Material12verwendet. Um die Treue des Reamplification in der Chloroplasten-Genom-Baugruppe zu testen, wurden Chloroplasten Genome für TK686 und TK686-R montiert mit schnell-Plast v.1.2.525 bei Standardeinstellungen mit der Fliege-Index auf Poales festgelegt. Eine vollständige Chloroplast Genom wurde für TK686-R, aber TK686 Chloroplast Genom wurde in sieben Contigs aufgrund niedriger lesen Sie Tiefe montiert. Die TK686 Contigs wurden montiert, manuell nach McKain Et al. 26 komplett montierte Chloroplast Genom wurden aufeinander abgestimmt in einem GUI-basierten Alignment-Software (siehe Tabelle der Materialien) und Unterschiede zwischen den Baugruppen wurde bewertet. Insgesamt 12 SNPs und eine Indel wurden zwischen Chloroplasten Baugruppen für TK686 und TK686-R. Für jede Variante wurde Abdeckung lesen Sie Sets von TK686 und TK686-r bewertet In allen Fällen war die häufigste Variante das gleiche zwischen den beiden Bibliotheken. TK686 zeigte eine T→C, ein G→A, ein G→T, ein G→-, eine C→A, eine T→A und vier C→A Varianten. Fünf dieser Varianten ereignete sich in einem Homopolymer String, was darauf hindeutet, dass ihre Eingliederung in die Baugruppe durch Sequenzierung Fehler und niedrige allgemeine Abdeckung gewesen sein mag. Der andere können das Ergebnis der Chloroplasten Haplotyp Variation, Sequenzierung Fehler oder Cytosin Deamination oder eine Kombination dieser Faktoren gewesen sein. TK686-R hatte ein C→T, ein G→T und ein A→G. Die Varianten C→T und G→T fanden in einem Homopolymer wie oben beschrieben. Letztlich wurden identische komplette Chloroplasten Genome von lesen Sie beide identifiziert. Eine einzelnes Chloroplast Genom von TK686 wurde kommentiert, mit grünen21 und im Vergleich zu anderen Mitgliedern des Stammes Andropogoneae. Alle Features der standard Chloroplasten wurden kommentiert: 8 rRNAs und tRNAs 38 84 Protein kodierenden Gene. Das komplette Chloroplast Genom ist GenBank (MF170217) und grünen27ab.

Potenzielle Verzerrung aus den Reamplification der Bibliotheken wurde auch durch Schätzung der Prozent GC und insgesamt geschätzte Transposon Inhalt ermittelt. Mit einem benutzerdefinierten Skript24Prozent GC schätzte. Unterschiede in der GC-Gehalt der beiden Proben waren vernachlässigbar, mit 49,7 % GC in TK686 und 51,2 % GC in TK686-R. Transposon Zusammensetzung wurde anhand der Transposome28geschätzt. Für beide Bibliotheken Transposon Zusammensetzung wurde mit einem Prozent Identität von 90, ein Bruchteil Abdeckung von 0,55, eine Cluster-Größe von 100 geschätzt 100.000 mal gelesen wurden nach dem Zufallsprinzip subsampled und die RepBase 21.10. Rasen wiederholte Verweis festlegen29. Dies wurde 100 Mal wiederholt, bootstrapping auf Transposon Schätzung von dieser Datensätze durchführen. Gesamten Genom Prozentsätze für großen Unterfamilien der Transposons wurden aus Transposome Ausgabe gewonnen, und der Mittelwert und die Standardabweichung dieser für die 100 Wiederholungen wurden geschätzt. Alle Skripte zur Erzeugung von diesen Ausgängen finden Sie im M. R. McKain Github Repository Transposons30, und alle Ergebnisse in Dryad (doi:10.5061/dryad.r8t2m) hinterlegt worden. Mit den zwei am weitesten verbreiteten Transposon Unterfamilien als Indikatoren (Copia und Gypsy long Terminal repeat Retrotransposons), waren die Ergebnisse fast identisch mit Copia 33,52 ± 4,00 % und 31,68 ± 2,94 % Zigeuner an 24.83 ± 2,72 bis 24.00 ± 2,35 % in TK686 und TK686-R, bzw. (Tabelle 3). Diese Testergebnisse deuten darauf hin, dass der Reamplification Schritt dieses Protokolls keine sinnvolle Sequenzierung Voreingenommenheit für hochrangige Genom Metriken erstellt haben. Allerdings ist anzumerken, dass dieses Beispiel möglicherweise nicht vollständig repräsentativ für alle reamplified Bibliotheken. Diese einzelnen Test zeigt, dass der Reamplification Schritt nicht von Natur aus Genom Metriken in TK686/TK686-R. Vorspannen war Eingeführten Bias würde keinen Einfluss auf die Versammlung ein Chloroplast Genom ausreichende Deckung der Sequenzierung gegeben, aber es wird empfohlen, dass, wie in dieser Studie mit TK686/TK686-R, präsentiert auf Ziel Linien Experimente sind zu überprüfen, dass Vorurteile nicht Während Studien untersuchen übertragbar Element Vielfalt auftreten.

Figure 1
Abbildung 1: Agarose-Gel-Bilder von A) DNA-Isolierung und (B) endgültige Sequenzierung Bibliotheken aus zehn Herbar. Für jede Fahrspur wurde 3 µL DNA oder Bibliothek benutzt. (A) DNA wurde in allen Herbarium Isolationen abgebaut, wie durch die allgemeine Abstrich zu sehen. (B) endgültige Sequenzierung Bibliotheken zeigen eine primäre Band von 300-500 Basenpaaren mit einer breiteren Verteilung der 200-1.000 Basenpaare; Letzteres ist häufiger bei Professor Bibliotheken. Fahrspuren für beide (A) und (B) wurden durch Probe identifiziert und Ergebnisse in Tabelle 2verglichen werden können. Leiter-Größe wurde in Basenpaaren (bp) dargestellt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Kreisförmige Grundstück von Schizachyrium scoparium (TK686) Chloroplast Genom mit Annotations. Das fertig montierte Genom von Schrotflinte Sequenzierung der DNA Herbarium abgeleitet ausgestellt eine Gesamtlänge von 139.296 Basenpaare (bp), einer großen Einzelkopie Region (LSC) der 81.401 bp, ein umgekehrtes Wiederholbereich (IR) der 22.669 bp und ein kleines Exemplar Region (SSC) der 12.557 BP. In der Anmerkung wurden alle standard Protein-kodierenden Gene, tRNAs und rRNAs für Mitglieder des Stammes Andropogoneae identifiziert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Tabelle 2: DNA-Extraktion und Bibliothek Vorbereitung Ergebnisse für zehn Herbarium Proben und vier Professor Bibliotheken. Die total Doppel stranded DNA an verschiedenen Schritte im Protokoll nachgewiesener wie unterschiedlicher Qualität sein kann, vor allem, wenn für Größe gefiltert. Klicken Sie hier, um diese Tabelle herunterzuladen.

Tabelle 3: Sequenzierung Statistiken für TK686 und reamplified TK686R. Reamplification hat keinen Einfluss auf die Gesamtinzidenz von pilzartige Genom Kontamination, GC Content Schätzung, Transposon Zusammensetzung Schätzung oder die Möglichkeit, ganze Chloroplasten Genome zu montieren. Klicken Sie hier, um diese Tabelle herunterzuladen.

Zusätzliche Tabelle1: DNA-Extraktion und Bibliothek Vorbereitung Ergebnisse für 40 zusätzliche Herbarium Proben, darunter zwanzig Professor Bibliotheken. Total Doppel stranded DNA an verschiedenen Schritte im Protokoll nachgewiesener wie unterschiedlicher Qualität sein kann, vor allem, wenn für Größe gefiltert. Klicken Sie hier, um diese Tabelle herunterzuladen.

Ergänzende Abbildung1: Agarose-Gel-Bilder von vierzig weitere DNA-Isolationen von Herbar. (A) und (B) zeigen zwanzig eigene DNA-Isolationen und zeigen die charakteristischen Verschlechterung der DNA Herbarium abgeleitet. Für jede Fahrspur wurde 3 µL DNA verwendet. Fahrspuren für beide (A) und (B) wurden durch Probe identifiziert und in ergänzenden Tabelle1zu Ergebnissen verglichen werden können. Leiter-Größe wird in Basenpaaren (bp) dargestellt. Weiße Flecken auf dem Bild sind durch Artefakte in der Gel-Imager, die mit der Reinigung nicht entfernt werden konnte. Klicken Sie bitte hier, um diese Zahl zu downloaden.

Ergänzende Abbildung2: Agarose-Gelbilder von vierzig weitere Sequenzierung Bibliotheken aus Herbarium abgeleitet DNA. Für jede Fahrspur wurde 3 µL der Bibliothek verwendet. Endgültige Sequenzierung Bibliotheken befinden sich in (A) und (B) mit einer durchschnittlichen Größe von 300-500 Basenpaaren. Sekundäre Bands gesehen in einigen verstärkten Proben vorschlagen "bubbling" von Bibliotheken. Fahrspuren für beide (A) und (B) werden durch Probe identifiziert und können im Vergleich zu Ergebnissen in ergänzenden Tabelle1. Leiter-Größe wird in Basenpaaren (bp) dargestellt. Klicken Sie bitte hier, um diese Zahl zu downloaden.

Ergänzende Abbildung 3: Agarose-Gelbild der sekundären Band Entfernung mit einer zusätzlichen Einzelzyklus PCR Schritt. Klicken Sie bitte hier, um diese Zahl zu downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Die hier vorgestellten Protokoll ist eine umfassende und solide Methode zur DNA-Isolierung und Sequenzierung Bibliothek Vorbereitung von getrockneten Pflanzen. Die Konsistenz des Verfahrens und des minimalen Notwendigkeit, es zu ändern basierend auf Probe Qualität machen es skalierbar für große Herbarium-basierte Sequenzierung Projekte. Die Einbeziehung eines optionalen Reamplification Schritts für geringe Ausbeute Bibliotheken ermöglicht die Aufnahme von geringer Qualität, geringe Menge, selten, oder historisch wichtigen Proben, die sonst nicht geeignet für die Sequenzierung.

Bedeutung der ersten DNA-Ertrag
Herbarium-abgeleitete DNA wird oft als Folge der ersten Probe Erhaltung11mit DNA-Proben weniger als 300 Jahre alte abgebaut als abgebaut als DNA isoliert von Tierresten, die mehrere hundert bis tausend Jahre alt31 , 32. Optimierung der ersten DNA-Ertrag deshalb wichtig genug qualitativ hochwertige DsDNA für erfolgreiche Sequenzierung Bibliothek Vorbereitung zu erhalten. Für Grasarten ein optimaler Ertrag wird erreicht durch den kombinierten Einsatz von sterilisierten Sand und flüssiger Stickstoff in das erste Schleifen Schritt, für eine tiefer gehende Zerstörung der Zellwände und Freisetzung von Nukleinsäuren. Diese Vorgehensweise erhöht wünschenswert größere DsDNA und unerwünschte kleinere Fragmente (Abbildung 1, ergänzende Abbildung1, Tabelle 2, zusätzliche Tabelle1). Nachfolgende Wulst Reinigungsschritte isolieren und bereichern für Fragmente einer Größe für Sequenzierung (300 – 500 Basenpaare), stark reduziert Erholung aber auch bereichernd für längere Fragmente (Tabelle 2, zusätzliche Tabelle1). Änderungen an den ersten Schritten der DNA-Isolierung kann basierend auf der Linie wird abgetastet, um die Auswirkungen von Sekundärmetaboliten auf downstream-Processing18reduzieren notwendig.

Optimierung der Bibliothek-Adapter
Die Konzentration von Adaptern zur Unterbindung hat einen direkten Einfluss auf die Höhe der Adapter Dimer in fertige Bibliotheken. Adapter Dimere vom Adapter selbst Ligatur führen, wenn nicht genügend Probe vorhanden ist und Sequenzierung läuft33verunreinigen. Die relativ niedrigen total DsDNA Herbarbelege ab erfordert Verdünnung der Adapter vor der Ligatur. Adapter können 50-fach verdünnt werden aus dem Lager Konzentration von 15 µM (siehe Protokoll) Erleichterung Hochdurchsatz-Bibliothek-Vorbereitung ohne die Notwendigkeit, einzeln messen und verdünnen Sie Adapter für jede Probe (Tabelle 2, zusätzliche Tabelle 1). Obwohl Sättigung der Adapter im Prinzip allgemeine Bibliothek Ertrag verringern könnte, ist es unwahrscheinlich, dass Herbar DsDNA in dieser Überschuss des Adapters erbringt.

Variation in Perle Reinigungsschritte für höhere Erträge
Größenauswahl bei Vorbereitung der Sequenzierung Bibliotheken erfolgt in der Regel nach Adapter Ligation, Verstärkung der Fragmente in erster Linie im Bereich gewünschte Größe ermöglicht; Dies geschieht durch Entfernen von Fragmenten, die sowohl größer als auch kleiner als die Zielgröße sind. Die geringe Menge an Herbarium abgeleitet DsDNA Vorbereitung Bibliothek wird nach Größenauswahl bei diesem Schritt, was zu unworkably niedrigen total DsDNA verschärft und letztlich geringe Ausbeute in der endgültigen Bibliothek. Durch die Durchführung eines standard Wulst-Reinigung Schritt mit 90 % Volumen Perlen nach Ligation, bleibt mehr total DsDNA Bereicherung in der Verstärkung Schritt. Extrem kleine DNA-Fragmente werden bevorzugt mit 90 % Volumen Perlen entfernt. Größenauswahl erfolgt im letzten Schritt auf der verstärkten Bibliothek, die Bereicherung der gewünschte Fragment Größen gewährleistet. Gesamtmengen von Perlen können eingestellt werden, um den gewünschten Bereich auszuwählen, obwohl die zweistufigen Mengen 25 µL und 6 µL Perlen, zum Abrufen von Bibliotheken von 400-500 Basenpaaren Einsätze innerhalb dieses Protokoll (optimiert sindAbbildung 1 b, ergänzende Abbildung2).

Probe-Rettung durch Reamplification der Bibliotheken
Endkonzentrationen der Sequenzierung Bibliotheken können trotz best Practices in DNA-Isolierung und Bibliothek Vorbereitung für weitere Sequenzierung nicht ausreichend sein. Der zerstörerische Charakter der Probenahme und oft begrenzten Verbrauchsmaterial von Herbar erlaubt nicht immer wiederholenden DNA-Isolierung. Von der Bibliothek bis zu reamplifying können 12 zusätzliche PCR-Zyklen auch außergewöhnlich schlechte Bibliotheken gespeichert werden. Ein standard Primerpaar dient zur Verstärkung, die mit entweder doppelte oder einzelne indizierte Bibliothek-Protokollen kompatibel ist. Ein Hauptanliegen für Reamplification ist die Einführung von Bias, oft durch Reduzierung der GC-reiche Abschnitte des Genoms20. Durch die Verwendung einer High Fidelity Polymerase (siehe Tabelle der Materialien), diese mögliche Vorurteile sind potenziell vermieden. Dies wird durch die minimale Variation der GC-Gehalt der sequenzierten Bibliotheken TK686 und TK686-R (Tabelle 3) gezeigt. Als eine zweite Überprüfung war der Transposon-Inhalt der TK686 und TK686-R geschätzt und zeigte keine erkennbaren Unterschiede (Tabelle 3). Schließlich wurde das ganze Chloroplast Genom dieses Beitritts zusammengestellt, von TK686 und TK686-R, die identische Sequenzen nach näherer Betrachtung der SNP Variation zwischen den beiden Versammlungen (Abbildung 2, Tabelle 3) geführt. Diese Tests deuten darauf hin, dass standard-genomischen Metriken, wie z. B. GC-Gehalt und Transposon-Zusammensetzung und die Fähigkeit zu montieren komplette Chloroplasten Genome, nicht durch Reamplification beeinträchtigt werden. Dies eröffnet die Möglichkeit der Einbeziehung Herbarium dachte Exemplare auch abgebaut werden oder fehlt es an Material in Phylogenomic Studien ohne Rücksicht auf eingeführten Bias durch PCR. Diese reamplified Bibliotheken könnten auch für Sequenz Capture34, verwendet werden, obwohl es wäre notwendig, um zu testen ob SNP Berufung voreingenommen ist. Es wird empfohlen, dass kleinere Tests der Voreingenommenheit durchgeführt werden, mit jedem Projekt um sicherzustellen, dass Vorurteile nicht in Sequenzierung Bibliotheken eingeführt wird.

Einschränkungen und mögliche Änderungen
Obwohl dieses Protokoll gearbeitet hat können Hunderte von Herbar, schlecht erhaltenen Gewebe noch bei jedem Schritt fehlschlagen. Es ist jedoch äußerst selten vor, dass Bibliotheken aus Geweben mit erfolgreichen DNA Extraktionen, vor allem nach Bibliothek Rettung durch Reamplification fehlschlagen. Die Größe Auswahl Schritte können auf verschiedene große Fragmente oder reduzieren Sie die breite Palette von Fragmenten gesehen in einigen abschließenden Bibliotheken geändert werden. Wie bei allen pflanzlichen Gewinnung Protokollen Schritte erforderlich sein, um Geschlecht-spezifische sekundäre Verbindungen zu entfernen, die das gesamte Protokoll behindern können. Wie dargestellt, dieses Protokoll bietet eine Standardmethode für DNA-Isolierung und Hochdurchsatz-Bibliothek Vorbereitung für Rasen Herbar und durch Überprüfung und Erprobung wird voraussichtlich amendable zu anderen pflanzlichen Linien.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine konkurrierenden Interessen haben.

Acknowledgments

Wir danken Taylor AuBuchon-Holunder, Jordan Teisher und Kristina Zudock um Hilfe bei der Probenahme Herbar und Missouri Botanical Garden Zugang zum Herbar für destruktive Probenahme. Diese Arbeit wurde unterstützt durch einen Zuschuss von der National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics