Robuuste DNA isolatie en High-throughput Sequencing bibliotheek bouw voor Herbarium Specimens

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Dit artikel demonstreert een gedetailleerd protocol voor DNA isolatie en hoge gegevensdoorvoer sequencing bibliotheek bouw van herbarium materiaal met inbegrip van de redding van uitzonderlijk slechte kwaliteit DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria zijn een onschatbare bron van plantaardig materiaal dat kan worden gebruikt in een verscheidenheid van biologische studies. Het gebruik van herbarium specimens wordt geassocieerd met een aantal uitdagingen met inbegrip van monster behoud kwaliteit gedegradeerde DNA en destructieve bemonstering van zeldzame exemplaren. Om effectiever gebruiken herbarium materiaal grote sequencing projecten, een betrouwbare en schaalbare methode van DNA isolatie en bibliotheek voorbereiding nodig. Deze paper toont een robuuste, begin-to-end protocol voor DNA isolatie en hoge gegevensdoorvoer bibliotheek constructie van herbarium specimens die geen wijziging voor afzonderlijke monsters vereist. Dit protocol is op maat gemaakt voor lage kwaliteit gedroogde plant materiaal en neemt profiteren van bestaande methoden door het optimaliseren van weefsel slijpen, bibliotheek maat keuze wijzigen en invoering van een optionele reamplification stap voor lage opbrengst bibliotheken. Reamplification van lage opbrengst DNA bibliotheken kan redden monsters afgeleid van onvervangbare en potentieel waardevolle herbarium specimens, ontkenning van de noodzaak voor extra destructieve bemonstering en zonder merkbare sequencing bias voor common fylogenetische toepassingen. Het protocol is getest op honderden soorten gras, maar wordt verwacht om flexibel te zijn voor gebruik in andere geslachten van de plant na verificatie. Dit protocol kan worden beperkt door de uiterst aangetaste DNA, waar fragmenten niet bestaan in het bereik van de gewenste grootte, en secundaire metabolieten in sommige plantaardige materiaal aanwezig die een remmende werking schoon DNA isolatie. Globaal, is dit protocol introduceert een snelle en uitgebreide methode waarmee voor DNA isolatie en voorbereiding van de bibliotheek voor 24 samples in minder dan 13 h, met slechts 8 h van actieve hands-on tijd met minimale wijzigingen.

Introduction

Herbarium collecties zijn een potentieel waardevolle bron van zowel de soorten en de genomische diversiteit voor studies inclusief fylogenie1,2,3, populatie genetica4,5, instandhouding biologie6, invasieve soorten biologie7en trek evolutie8. De mogelijkheid om het verkrijgen van een rijke diversiteit aan soorten, populaties, geografische locaties en tijdstippen hoogtepunten de "schatkamer"9 thats het herbarium. Historisch, heeft de aangetaste aard van herbarium afkomstige DNA PCR-gebaseerde projecten, vaak indelings onderzoekers aan het gebruik van alleen markeringen gevonden in hoge exemplaar, zoals regio's van de chloroplast genoom- of de interne getranscribeerde spacer (ITS) voor de ribosomal belemmerd RNA. Kwaliteit van specimens en DNA variëren uitgebreid op basis van methoden van behoud9,10, met double-stranded pauzes en versnippering van warmte in het droogproces wordt de meest voorkomende vormen van schade, het creëren van gebruikt de zogenaamde 90% DNA lock-up die PCR gebaseerde studies11heeft bezwaard. Afgezien van fragmentatie is het tweede meest voorkomende probleem in herbarium genomics besmetting, zoals die afkomstig is van endophytic schimmels13 of schimmels postmortale verworven na collectie maar vóór de montage in het herbarium12, hoewel Dit probleem kan worden opgelost bioinformatically gegeven de juiste schimmel database (zie hieronder). Een derde, en minder vaak, probleem is wijziging van de volgorde via cytosine (C/G→T/A) deamination14, hoewel het wordt geschat op lage (~ 0,03%) in herbarium specimens11. Met de komst van high-throughput sequencing (HTS), kan het probleem van de versnippering worden overwonnen met korte leest en sequencing diepte12,15, waardoor genomic-niveau data-acquisitie van talrijke exemplaren met lage kwaliteit DNA, en soms zelfs het hele genoom sequencing15toelaat.

Herbarium monsters worden steeds vaker gebruikt en zijn een grotere component fylogenetische projecten16. Een uitdaging van dit moment herbarium exemplaren te gebruiken voor HTS is consequent voldoende dubbele gestrande DNA, een noodzakelijke voorwaarde voor sequencing protocollen, verkrijgen van talrijke soorten in een tijdig, zonder te optimaliseren van methoden voor het individu exemplaren. In deze paper wordt een protocol voor DNA-extractie en bibliotheek voorbereiding van herbarium specimens die profiteert van bestaande methoden en hen te voorzien van snelle en repliceerbaar resultaten wijzigt aangetoond. Deze methode zorgt voor volledige verwerking vanaf specimen aan een bibliotheek voor 24 samples in 13 h, met 8 h hands-on tijd, of 16 h, met 9 h hands-on tijd, wanneer de optionele reamplification stap nodig is. Gelijktijdige verwerking van meer monsters is haalbaar, al is de beperkende factor centrifuge capaciteit en technische vaardigheid. Het protocol is ontworpen om alleen typische laboratoriumapparatuur (thermocycler centrifuge en magnetische stands) in plaats van gespecialiseerde apparatuur, zoals een vernevelaar of ultrasoonapparaat, voor het scheren van DNA vereisen.

DNA kwaliteit, fragment grootte en het aantal beperken factoren voor het gebruik van herbarium specimens in high-throughput sequencing experimenten. Andere methoden voor het isoleren van herbarium DNA en het maken van high-throughput sequencing bibliotheken hebben aangetoond dat het nut van het gebruik van zo weinig als 10 ng DNA16; maar ze vereisen het optimale aantal PCR experimenteel te bepalen cycli vereist voor de voorbereiding van de bibliotheek. Dit wordt onpraktisch als omgaan met buitengewoon kleine hoeveelheden van levensvatbare dubbele strandde DNA (dsDNA), zoals sommige herbarium exemplaren alleen voldoende DNA voor een preparaat één bibliotheek produceren. De methode die hier gepresenteerd maakt gebruik van een enkel getal van cycli ongeacht monster kwaliteit, dus geen DNA is verloren in bibliotheek optimization stappen. In plaats daarvan, is een stap in de reamplification wordt aangeroepen wanneer bibliotheken niet voldoen aan de minimale bedragen die nodig zijn voor het rangschikken. Vele herbarium monsters zijn zeldzaam en weinig materiaal, waardoor het moeilijk te rechtvaardigen destructieve bemonstering in veel gevallen bezitten. Om dit tegen te, kunt het gepresenteerde protocol dsDNA ingang maten van minder dan 1,25 ng in het voorbereidingsproces van de bibliotheek, uitbreiding van het toepassingsgebied van levensvatbare monsters voor high-throughput sequencing en het minimaliseren van de noodzaak voor destructieve bemonstering van specimens.

Het volgende protocol is geoptimaliseerd voor grassen en getest op honderden verschillende soorten van herbarium monsters, hoewel we verwachten dat het protocol kan worden toegepast op vele andere plantengroepen. Het bevat een optionele herstelstap, die kan worden gebruikt voor het opslaan van lage kwaliteit en/of zeldzame exemplaren. Gebaseerd op meer dan tweehonderd herbarium exemplaren getest, werkt dit protocol op monsters met lage weefsel input en kwaliteit, waardoor het behoud van zeldzame specimens via minimale destructieve bemonstering. Hier is het aangetoond dat dit protocol kan bieden hoge kwaliteit Bibliotheken, die kunnen worden sequenced voor phylogenomics gebaseerde projecten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. voorafgaand aan de Start

  1. Maken van verse cetyl trimethylammoniumformiaat bromide (CTAB) buffer17 door toevoegen van 20 g CTAB, 10 g van polyvinylpyrrolidon (PVP) 40, 100.0 mL 1 M Tris pH 8.0, 40 mL 0,5 M ethyleendiamminetetra azijnzuuroplossing (NA2EDTA) pH 8,0 280,0 mL van 5 M NaCl en 400,0 milliliters reagens water samen, en het totale volume aan 1 L met behulp van reagens-grade water brengen. Breng de pH op 8.0.
    Opmerking: Extra reagentia kunnen worden toegevoegd aan CTAB afhankelijk van secundaire verbindingen in afzonderlijke taxa. Zie Allen et al. 18 voor een grondige lijst van additieve reagentia.
  2. Voeg 10 µL van β-mercaptoethanol per 5 mL CTAB buffer.
    Opmerking: dit kan worden bereid in batches van 50 mL en 3-4 weken bij kamertemperatuur bewaard.
    1. Verwarm de CTAB oplossing in een waterbad van 65 ° C.
  3. Chill mortieren en pestles in-20 ° C gedurende ten minste 20 minuten.
  4. Label 4 sets van 2 x n 2 mL buizen (waar n = het aantal monsters). 1 set van de gelabelde buizen op ijs gezet.
  5. Chill isopropanol en op ijs of in een vriezer van-20 ° C.
  6. Vaste fase omkeerbare immobilisatie (SPRI) kralen (Zie Tabel van materialen) te verwijderen uit de koelkast en laten equilibreer tot kamertemperatuur (minstens 30 min).
  7. 80% ethanol te bereiden.
  8. Selecteer herbarium exemplaren voor extractie en ~ 1 cm2of 10 mg, weefsel per model, bij voorkeur blad materiaal op te halen.

2. DNA-extractie

  1. Slijpen ~ 1 cm,2 van vooraf geselecteerde herbarium weefsel met behulp van prechilled mortieren en pestles. Vloeibare stikstof en 30-50 mg gesteriliseerd zand toevoegen. Grind totdat weefsel in fijn poeder verandert.
    Opmerking: 10 mg of meer weefsel is wenselijk, maar minder werkte ook in sommige gevallen. Zodra de vloeibare stikstof verdampt, voeg meer tot weefsel volledig wordt gemalen. Een andere gemeenschappelijke methode voor het verstoren van cellen en weefsels is het gebruik van een kraal-beater. Echter bleek deze methode niet werken goed voor de specimens gebruikt in deze experimenten.
  2. Breng het bevroren poeder in twee 2 mL buizen (niet meer dan de helft van de buis van volume toevoegen). Voeg 600 µL van warme CTAB oplossing aan elke buis en mengeling van de buizen grondig door inversie en vortexing.
    Opmerking: Aangezien de kwantiteit en kwaliteit van materiaal van het herbarium is vaak laag, uitvoeren van DNA isolatie in twee herhalingen helpt bij het verkrijgen van hogere opbrengsten.
  3. Incubeer de monsters in een waterbad van 65 ° C gedurende 1-1,5 uur, vortexing elke 15 min.
  4. Centrifugeer steekproeven bij 10.000 x g gedurende 5 min. overbrengen het supernatant in een verse set van gelabelde buizen (~ 500 µL). Gooi de pellet met behulp van een standaard niet-gechloreerde verwijdering-procedure.
  5. Voeg 4 µL van RNase-A (10 mg/mL) aan elke buis en mengeling door omkeren of pipetteren. Incubeer de monsters bij 37 ° C in een warmte blok of water bad gedurende 15 minuten.
  6. Voeg een gelijk volume (~ 500 µL) uit een mengsel van 25:24:1 fenol: chloroform: isoamyl alcohol zodra de buizen kamer temperatuur heeft bereikt. Meng door omhoog en omlaag pipetteren en/of met inversie. Centrifuge die de buizen bij 12.000 x g gedurende 15 min. de waterige laag (bovenste laag) overbrengen in een nieuwe reeks van label buizen (~ 400 µL). Gooi de organische laag in een gechloreerd afval container.
    Opmerking: Stap 2.6 kan worden herhaald als grote hoeveelheden van secundaire verbindingen worden verwacht in plantmateriaal.
  7. Voeg een gelijk volume (~ 400 µL) uit een mengsel van chloroform: isoamyl 24:1 alcohol. Meng door omhoog en omlaag pipetteren en/of met inversie. Centrifugeer de buizen bij 12.000 x g gedurende 15 min. overdracht de waterige laag (bovenste laag) een nieuwe reeks van prechilled, gelabelde buizen (~ 300 µL). Gooi de organische laag in een gechloreerd afval container.
  8. Voeg een gelijk volume (~ 300 µL) van prechilled isopropanol en 12 µL van 2,5 M Natriumacetaat aan elke buis. Incubeer monsters bij-20 ° C gedurende 30-60 min.
    Opmerking: De incubatie tijden kunnen worden uitgebreid (tot overnachting incubatie), maar DNA kwaliteit zal verminderen, hoe langer de monsters uit te broeden.
  9. Neem de monsters uit de vriezer en centrifuge de buizen bij 12.000 x g gedurende 15 min. verwijderen en verwijder het supernatant voorzichtig zonder de pellet te verstoren. De pellet wassen door ophanging met verse 70% ethanol (ongeveer 300-500 µL). Samenvoegen voor elk verdubbelde monster, de twee afzonderlijke pellets in een met bijbehorende ethanol.
    Opmerking: Monsters moeten worden geconsolideerd in één buis met behulp van ethanol eerst en dan verder. Het is niet nodig om elk monster met ethanol apart wassen.
  10. Centrifugeer de buizen bij 12.000 x g gedurende 10 min. verwijderen en verwijder het supernatant voorzichtig zonder de pellet te verstoren. Lucht drogen de pellets.
    Opmerking: Monsters kunnen worden gedroogd sneller met een droge warmte blok (niet hoger dan 65 ° C). Zorg ervoor dat de monsters niet overdreven doen drogen, als dit de uiteindelijke opbrengst van DNA kan verminderen.
  11. De geïsoleerde DNA in 50 µL voor 1 x TE schorsen. Bewaren in de vriezer van-20 ° C voor lange termijn opslag of 4 ° C voor gebruik in de volgende week.

3. kwaliteitscontrole (QC)

  1. Voer een agarose gel voor kwaliteitscontrole.
    1. Bereiden van een buffer van de Tris/boraat/EDTA (FSME) 1 x door het toevoegen van 54 g Tris base, 27.5 g boorzuur en 3,75 g EDTA Dinatrium zout, het totale volume om 5 L met behulp van reagens rang water.
    2. Bereiden van een 1% agarose gel door toevoeging van 1 g agarose tot 100 mL voor 1 x TBE. Magnetron de oplossing totdat geen agarose zichtbaar is. Toevoegen van 0,01% nucleïnezuur gel vlek (Zie Tabel van materialen). Laat de kolf afkoelen totdat het warm aanvoelt. Meng goed door roeren. Agarose giet in een gel-lade en laat het zitten totdat het stolt.
    3. Mix 3 µL van monster, 2 µL van reagens rang water en 1 µL van 6 x laden kleurstof. Laden van de monsters in de gel-matrix, vaststellend van hun orde.
    4. De voorbeelden voor 60 – 70 min uitvoeren bij 60 – 70 V. beeld, wordt de gel onder UV-licht met de juiste belichting en focus.
      Opmerking: Aanwezigheid van een duidelijk ultrahoog moleculair gewicht band is een teken van hoge kwaliteit DNA, terwijl uitstrijkjes meestal de aantasting van het DNA geven. De meeste exemplaren van het herbarium zijn gedegradeerd.
  2. Een analyse van de kwantificering dsDNA uitvoeren (zie tabel van materialen) om te bepalen van de hoeveelheid dubbele strandde DNA.
    1. Gebruik 2 µL van monster voor analyse.
      Opmerking: Verdunningen niet nodig zijn voor de analyse van de kwantificering van materiaal van het herbarium aangezien zij neigen te worden in minimale hoeveelheden. Succesvolle bibliotheken zijn van zo weinig zoals 1.26 ng totale dsDNA van deze stap vervaardigd.

4. DNA schuintrekken

Nota: Dit is een geoptimaliseerde versie van een commerciële double-stranded fragmentase protocol (Zie Tabel van materialen).

  1. Plaats dsDNA fragmentatie enzym op ijs na vortexing voor 3 s.
  2. In een steriele 0,2 mL polymerase kettingreactie (PCR) buis geïsoleerd mix 1 – 16 µL DNA met 2 µL van de begeleidende fragmentatie reactie buffer. Zodat het totale volume 18 µL door nuclease gratis water toe te voegen. Voeg 2 µL van dsDNA fragmentatie enzym en vortex het mengsel voor 3 s.
    Opmerking: De hoeveelheid DNA die nodig zijn varieert afhankelijk van DNA-concentratie (aim voor 200 ng totaal in de buis).
  3. Incubeer de monsters bij 37 ° C gedurende 8,5 minuten. Voeg vervolgens 5 µL van het EDTA 0.5 M aan de buizen.
    Opmerking: Deze stap moet worden uitgevoerd zodra de incubatietijd is over het beëindigen van de reactie en voorkomen dat DNA-monsters te scheren.

5. kraal Clean-up

  1. Meng de SPRI kralen door vortexing.
  2. Het totale volume van de sheared DNA brengen met 50 µL door 25 µL van nuclease gratis water toe te voegen. Toevoegen 45 µL van kamertemperatuur SPRI parels (90% volume) aan 50 µL sheared DNA en meng grondig door pipetteren omhoog en omlaag.
    Opmerking: Toevoegen van parels op 90% van de totale monstervolume wordt gedaan om de kleinste van de fragmenten van DNA, vaak onder 200 basenparen verwijderen.
  3. Laat de monsters Incubeer voor 5 min. de buizen op een magnetische plaat zet en laat ze zitten voor 5 min. zorgvuldig verwijderen en verwijder het supernatant.
    Opmerking: Wees voorzichtig niet te verstoren, de parels, omdat zij de gewenste doelstellingen van DNA bevatten.
  4. 200 µL van verse 80% ethanol toevoegen aan de buizen terwijl op de magnetische stand. Incubeer bij kamertemperatuur voor 30 s en vervolgens zorgvuldig te verwijderen en verwijder het supernatant. Herhaal deze stap eenmaal. Lucht drogen de kralen voor 5 minuten, terwijl de buis is op de magnetische stand met het deksel open.
    Opmerking: Vermijd overdreven drogen de kralen. Dit kan resulteren in lagere herstel van DNA.
  5. Verwijder de buizen van de magneet. Het DNA van de kralen in 55 µL van 0.1 x TE elueren en meng door pipetteren omhoog en omlaag. Incubeer bij kamertemperatuur voor 5 min. plaats buizen op de magnetische stand en wachten tot de oplossing om te zetten schakelt (~ 2 min).
  6. Trek 52 µL van het supernatans. Een analyse van de kwantificering van DNA worden uitgevoerd op de monsters te controleren van het herstel en de beginconcentratie dat in bibliotheek prep gaat.
    Opmerking: Bibliotheken hebben geboekt met totale dsDNA geschat op minder dan 1,25 ng, maar in elk geval reamplification was vereist.

6. bibliotheek voorbereiding

Nota: Dit is een gewijzigde versie van een commercieel beschikbare bibliotheek kit (Zie Tabel van materialen protocol).

  1. Einde Prep
    1. 3 µL van endonuclease en fosfaat residuvijvers enzymen en 7 µL van de begeleidende reactie buffer tot 50 µL van gereinigd, sheared DNA toevoegen. Meng door pipetteren omhoog en omlaag. Draai de buizen om te bellen te verwijderen.
      Opmerking: Het totale volume moet 60 µL.
    2. Leg de monsters in een thermocycler met het volgende programma: 30 minuten bij 20 ° C, 30 min bij 65 ° C, houd vervolgens bij 4 ° C.
      Opmerking: Verwarmde deksel is ingesteld op ≥75 ° C
  2. Adapter afbinding
    1. Verdun de adapter 25 – 50 vouwen (werken adapter concentratie van 0,6 – 0,3 µM). 30 µL van afbinding master mix, 1 µL van afbinding enhancer en 2.5 µL van adapter voor high-throughput korte Lees sequencing toevoegen aan de buizen.
      Opmerking: Het totale volume moet 93.5 µL.
    2. Meng door pipetteren omhoog en omlaag. Draai de buizen om te bellen te verwijderen. Incubeer de buizen bij 20 ° C gedurende 15 minuten.
    3. Voeg 3 µL van commerciële mengsel van uracil DNA glycosylase (UDG) en het DNA glycosylase-lyase Endonuclease VIII (Zie Tabel van materialen) de buizen. Zorg ervoor dat het totale volume 96,5 µL. Meng en Incubeer bij 37 ° C gedurende 15 minuten met behulp van een thermocycler.
      Opmerking: De klep moet worden ingesteld op ≥47 ° C. De oorspronkelijke versie van het commerciële protocol heeft maat keuze na de adapter afbinding stap, gevolgd door een kraal opruimen als de laatste stap. Dit protocol, die hogere opbrengsten bereikt, schakelt de volgorde van deze stappen en maat keuze als laatste stap implementeert.
  3. Cleanup enzymen en kleine fragmenten verwijderen
    1. Meng magnetische kralen door vortexing.
    2. Voeg 78 µL van SPRI magnetische kralen (80 volumeprocenten) en meng door pipetteren omhoog en omlaag.
      Opmerking: Toevoegen van parels op 80% van de totale monstervolume wordt gedaan om het verwijderen van de kleinste DNA-fragmenten, die vaak korter is dan 250 basenparen. De strengere verwijdering van kleine fragmenten van DNA is (i) het verwijderen van overtollige adapters en (ii) het benadrukken van versterking van grotere fragmenten in de volgende stappen uit.
    3. Laat die de monsters Incubeer gedurende 5 min. Zet de buizen op een magnetische plaat voor 5 min. zorgvuldig verwijderen en verwijder het supernatant waarin het DNA buiten het bereik van de gewenste grootte.
      Opmerking: Wees voorzichtig niet te verstoren, de kralen die de gewenste doelstellingen van DNA bevatten.
    4. 200 µL van verse 80% ethanol toevoegen aan de buizen terwijl op de magnetische stand. Incubeer bij kamertemperatuur voor 30 s en vervolgens zorgvuldig te verwijderen en verwijder het supernatant. Herhaal deze stap eenmaal. Lucht drogen de kralen voor 5 minuten, terwijl de buis is op de magnetische stand met deksel open.
      Opmerking: Voorkomen over het drogen van de kralen. Dit kan resulteren in lagere herstel van DNA.
    5. Verwijder de buizen van de magneet. Elueer de DNA-doelstelling van de kralen door 17 µL van 0.1 x TE toe te voegen en meng door pipetteren omhoog en omlaag.
    6. Incubeer bij kamertemperatuur voor 5 min. plaats buizen op de magnetische stand en wachten tot de oplossing om te zetten schakelt (~ 2 min).
    7. Trek 15 µL van het supernatans.
  4. PCR versterking
    1. 25 µL van high-fidelity PCR master mix, 5 µL van korte Lees high-throughput sequencing bibliotheek prep 5' primer en 5 µL van high-throughput korte Lees sequencing bibliotheek prep 3' primer, toevoegen aan 15 µL van het schoongemaakte adapter-afgebonden DNA.
      Opmerking: Totale volume moet 50 µL.
    2. Meng goed door vortexing. Leg de monsters in een thermocycler met behulp van de instellingen die worden gevonden in tabel 1: Thermocycler amplificatie instelling.
      Opmerking: Een groot aantal cycli nodig is als gevolg van de lage hoeveelheid input DNA.
Cyclus stap Temp. Tijd Cycli
Eerste denaturatie 98 ° C 30 s 1
Denaturatie 98 ° C 10 s 12
Gloeien/extensie 65 ° C 75 s 12
Final Extension 65 ° C 5 min 1
Houd 4 ° C

Tabel 1: PCR protocol denaturatie, gloeien en uitbreiding tijden en temperaturen. Temperatuur en de tijden werden geoptimaliseerd voor de reagentia gepresenteerd in dit protocol. Als de reagentia worden gewijzigd, moeten temperaturen en tijden opnieuw worden geoptimaliseerd.

  1. Maat keuze voor de grootte van de gewenste bibliotheek
    Opmerking: Deze stap kraal verwijdert fragmenten zowel boven als onder het doelbereik.
    1. Meng SPRI kralen door vortexing.
    2. Voeg 25 µL (50% volume) van kamertemperatuur magnetische kralen en meng door pipetteren omhoog en omlaag. Laat de monsters Incubeer voor 5 min. de buizen op een magnetische plaat zet en laat ze zitten voor 5 min. zorgvuldig verwijderd en het supernatant overbrengen in een nieuwe reeks van gelabelde buizen.
      Opmerking: Dit volume kan worden aangepast op basis van de grootte van de gewenste bibliotheek. De bovendrijvende vloeistof bevat DNA-fragmenten van de gewenste grootte. In de eerste kraal incubatie, zijn de kralen bindend grotere fragmenten van de bibliotheek. Deze worden verwijderd om zich te concentreren op die in het bereik van 400-600 basenpaar. De bovendrijvende vloeistof bevat kleinere fragmenten.
    3. Toevoegen 6 µL van kamertemperatuur SPRI parels aan de bovendrijvende substantie en meng grondig door pipetteren omhoog en omlaag. Laat die de monsters Incubeer voor 5 min. de buizen op een magnetische plaat zet en laat ze zitten voor 5 minuten.
      Opmerking: Dit volume kan worden aangepast op basis van de grootte van de gewenste bibliotheek overeenkomstig stap 6.5.2.
    4. Verwijder voorzichtig en verwijder het supernatant.
      Opmerking: Wees voorzichtig niet te verstoren, de kralen die de gewenste DNA bevatten. In de tweede parel incubatie, zijn de kralen bindend voor de fragmenten die overblijft na de eerste verwijdering van de grootste DNA fragmenten. Deze set van fragmenten is meestal in het bereik van de gewenste grootte.
    5. 200 µL van verse 80% ethanol toevoegen aan de buizen terwijl op de magnetische stand. Incubeer bij kamertemperatuur voor 30 s, vervolgens zorgvuldig verwijderen en verwijder het supernatant. Herhaal deze procedure. Lucht drogen de kralen voor 5 minuten, terwijl de buis is op de magnetische stand met deksel open.
      Opmerking: Vermijd overdreven drogen de kralen. Dit kan resulteren in lagere herstel van DNA.
    6. Verwijder de buizen van de magneet. Elueer de DNA-doelstelling van de kralen in 33 µL van 0.1 x TE en meng door pipetteren omhoog en omlaag.
    7. Incubeer bij kamertemperatuur voor 5 min. plaats buizen op de magnetische stand en wachten tot de oplossing om te zetten schakelt (~ 2 min). Trek 30 µL van het supernatant en overdracht van 2 mL buizen (Zie Tabel of Materials) voor opslag.
      Opmerking: De bibliotheken kunnen worden bewaard bij-20 ˚C voor langdurige opslag.
  2. Kwaliteitscontrole
    1. Voer een test van de kwaliteitscontrole op de DNA-bibliotheken. Verwijzen naar stap 3.1 en 3.2.
      Opmerking: Voor DNA Bibliotheken, voert u de gel voor ~ 45 min op 96 V.
  3. Bibliotheek reamplification: optioneel als bibliotheek hoeveelheid niet voldoende is.
    Opmerking: Monsters met bibliotheek concentraties beneden 10 nM kan worden reamplified aan de hand van de volgende stappen. Reamplification van lage concentratie bibliotheken werkbare resultaten voor het rangschikken kan bereiken, maar reamplification kan veroorzaken een bescheiden verschuiving in basis samenstelling diversiteit, hoewel verzamelde gegevens (tabel 3) suggereren dat dit verwaarloosbaar voor bepaalde statistieken .
    1. Verdun de inleidingen van de universele reamplification 10-fold 0.1 x TE gebruiken.
    2. 25 µL van high-fidelity PCR master mix, 5 µL van verdunde universele reamplification primer 1 (AATGATACGGCGACCACCGA) en 5 µL van verdunde universele reamplification primer 2 (CAAGCAGAAGACGGCATACGA) aan 15 µL van lage concentratie bibliotheken toevoegen. Opmerking: Totale volume moet op 50 µL.
    3. Meng goed door vortexing. Leg de monsters in een thermocycler met behulp van de instellingen die worden gevonden in tabel 1: Thermocycler amplificatie instelling
      Opmerking: Het grote aantal cycli nodig is als gevolg van lage hoeveelheid input DNA.
    4. Kraal-opschonen
    5. Meng SPRI kralen door vortexing. Voeg 45 µL van kamertemperatuur SPRI parels (90% volume) en meng door pipetteren omhoog en omlaag.
    6. Laat de monsters Incubeer gedurende 5 min. Zet de buizen op een magnetische plaat voor 5 min.
    7. Verwijder voorzichtig en verwijder het supernatant waarin het ongewenste DNA.
      Opmerking: Wees voorzichtig niet te verstoren, de kralen die de gewenste doelstellingen van DNA bevatten.
    8. 200 µL van verse 80% ethanol toevoegen aan de buizen terwijl op de magnetische stand. Incubeer bij kamertemperatuur voor 30 s, en vervolgens zorgvuldig te verwijderen en verwijder het supernatant. Herhaal deze stap eenmaal.
    9. Lucht drogen de kralen voor 5 minuten, terwijl de buis is op de magnetische stand met het deksel open.
      Opmerking: Vermijd overdreven drogen de kralen. Dit kan resulteren in lagere herstel van het DNA-doel.
    10. Verwijder de buizen van de magneet. Elueer de DNA-doelstelling van de kralen in 33 µL van 0.1 x TE en meng door pipetteren omhoog en omlaag.
    11. Incubeer bij kamertemperatuur voor 5 min. plaats buizen op de magnetische stand en wachten tot de oplossing om te zetten schakelt (~ 2 min).
    12. Trek 30 µL van het supernatans. De bibliotheken kunnen worden opgeslagen bij-20 ° C voor langdurige opslag.
  4. Kwaliteitscontrole
    1. Voer een test van de kwaliteitscontrole op de DNA-bibliotheken. Verwijzen naar stap 3.1 en 3.2. Voor DNA Bibliotheken, voert u de gel voor ~ 45 min op 96 V.
      Opmerking: Als een dubbele band wordt gezien in de gel, dit is waarschijnlijk een gevolg van uitputting van de primer van de reamplification stap. De bands kunnen worden verwijderd door herhalende 6,9, maar met behulp van slechts één cyclus in het programma van de PCR afgebeeld in tabel 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

DNA isolatie en definitieve bibliotheek opbrengst
In deze studie werd de doeltreffendheid van het protocol voor de isolatie van DNA van het herbarium en het herstel van hoge kwaliteit sequencing bibliotheken aangetoond door middel van vijftig verschillende monsters met de oudste van 1920 en de jongste vanaf 2012 (tabel 2). Voor elk monster werd ongeveer 10 mg blad weefsel gebruikt voor DNA-isolatie. Groener blad weefsel werd begunstigd, indien beschikbaar, en geen weefsel met de hand liggende schimmel besmetting werd geselecteerd. Succesvolle isolatie kunnen worden samengesteld met behulp van de gele of bruine weefsel, hoewel opbrengst mag worden verwacht dat lager. Totaal dubbele strandde DNA (dsDNA) van de oorspronkelijke isolatie varieerden van 3.56 ng 2,610 ng. Zoals verwacht, DNA herbarium specimens verkregen zeer was gedegradeerd (figuur 1A, Supplemental Figuur 1). Een deel van deze isolatie werden gebruikt voor enzymatische scheren (1.26-464 ng). Hoewel herbarium DNA reeds door het conserveringsproces geschoren is, vereist optimalisatie van het protocol extra schuintrekken ter verbetering van de algehele bibliotheek opbrengst. De volledige terugvordering van dsDNA na scheren varieerden van < 1 tot 51% van de invoer dsDNA, resulterend in een minimum van minder dan 1,25 ng van het starten van DNA voor de voorbereiding van de bibliotheek en een maximum van 328 ng. Het extreme verlies van DNA in sommige monsters kan worden toegeschreven aan de grootte van de al kleine fragment van een groot deel van het DNA vóór enzymatische shearing (figuur 1A, aanvullende figuur 1). Het gebruik van een 90% volume kraal opruiming op de sheared DNA verwijderd met opzet de kleinste fragmenten van DNA te verrijken voor grotere, meer wenselijk fragment maten. Deze kleine fragmenten werden vooral gezien in monsters TK463, TK657 en TK694, zoals aangegeven door een intense signaal op de 100 basenpaar merk (figuur 1A).

De totale hoeveelheid van de bibliotheek bericht grootte selectie varieerden van 1.425 ng 942.5 ng (tabel 2, aanvullende tabel 1). Voor 23 van de monsters, de eerste extractie en bibliotheek voorbereiding niet opbrengst een passend bedrag van bibliotheek (< 10 nM; Tabel 2, aanvullende tabel 1), zodat deze monsters werden onderworpen aan de stappen van het reamplification en het herstel van het protocol, wat resulteert in een 14-680 x stijging van de totale bibliotheek (tabel 2, aanvullende tabel 1). Definitieve bibliotheken resulteerde in een band tussen 350 en 500 basenparen (figuur 1B, Supplemental Figuur 2). Soms een tweede band die werd groter is dan de verwachte bibliotheek werd gezien (figuur 1B, Supplemental Figuur 2). Dit gebeurde toen de reamplification PCR beschikbaar inleidingen uitgeput en begon gloeien bibliotheek adapters van niet-homologe DNA-fragmenten. Hierdoor ontstaat een molecule waar de uiteinden (de adapters) waren goed gloeien, maar het invoegen van DNA niet. Dit "geborreld" molecuul leek groter op een gel, want het bewoog zich langzamer door de gel-matrix. Deze onthardende fouten werden vastgesteld bij de voorbereiding van een andere reamplification reactie van de reeds reamplified bibliotheek en draaien voor een single-cyclus. Deze single-cyclus voorziet inleidingen juiste gloeien en versterking, het verwijderen van de tweede band (aanvullende figuur 3).

Reamplification van bibliotheken vergemakkelijkt definitieve bibliotheek concentraties van minstens 10 nM. Deze concentraties toegestaan bibliotheken verdund moet worden voor een gelijke molarity en gegroepeerd in gelijke vertegenwoordiging, te helpen bij het ontkennen van de problemen die zich hebben voorgedaan met ongelijke monster kwaliteit en rangschikking van de opbrengst van de bibliotheek. Als het doel van een project chloroplast genoom is sequencing, dan de totale hoeveelheid sequencing nodig zal variëren als verschillende geslachten en weefsels verschillen in het totale percentage van luidt die afkomstig van chloroplast DNA19 zijn. Meestal 50-100 x verwachte dekking van het genoom chloroplast is voldoende voor assemblage, en sequencing punten kunnen worden samengevoegd tot maar liefst 70 personen afhankelijk van soort en sequencing methode.

Testen voor besmetting, Bias en variatie, veroorzaakt door Reamplification
Een bekende voor het rangschikken van HTS gaat binnenbrengen van bias bibliotheken via uitgebreide PCR versterking20. Om te testen van de gevolgen van reamplification en identificeren van potentiële bias gemeen fylogenetische toepassingen van herbarium materiaal, vergeleken we een succesvol gesequenceerd bibliotheek (TK686) met de dezelfde bibliotheek verdund 1:5 en reamplified (aangewezen TK686-R). Zowel TK686 en TK686-R waren sequenced op een Illumina HiSeq4000 bij de Universiteit van Illinois Roy J. Carver biotechnologie Center en de Michigan State University onderzoek ondersteuning Technologiefaciliteit, respectievelijk, met behulp van de gepaarde einde 150 basenpaar leest (Zie Tabel 3 voor sequencing details). Ruwe leest zijn neergelegd in de NCBI SRA (SRP128083). Leest waren gereinigd met behulp van Trimmomatic v.0.3621 adapter trimmen NEB adapter toetsencombinatie, kwaliteit filtering voor een gemiddelde phred score van 20 voor een 10 base-paar glijden van venster, waaronder en een minimale grootte van 40 basenparen afgesneden. Als één van de primaire problemen met herbarium specimens schimmel besmetting is, verontreiniging werd geschat door leest tegen een deel van de JGI MycoCosm schimmel genoom database22 (312 nucleair genoom en 79 mitochondriaal genoom) toe te wijzen met behulp van bowtie2 v . 2.2.923 met behulp van de "zeer-gevoelige-local" parameter ingesteld. TK686 en TK686-R bibliotheken waren niet te onderscheiden in nucleaire contaminatie van de schimmel (9.24% en 9.68% respectievelijk) en mitochondriale schimmel besmetting (0.94 tot 0,8%) (Tabel 3). Hoewel dit slechts één voorbeeld is, suggereert het dat schimmel verontreiniging van monsters van het herbarium niet te verwaarlozen is en moet worden verwijderd voordat u herbarium afkomstige sequencedata. De database en de opdrachten gebruikt voor het identificeren en verwijderen van schimmel verontreiniging kunnen worden gevonden in M. R. McKain van GitHub repository Herbarium Genomics24.

Chloroplast genoom sequencing wordt meestal gebruikt voor fylogenetische analyses en herbarium exemplaren worden steeds vaker gebruikt als bron materiaal12. Om te testen de trouw van reamplification in de vergadering van de chloroplast genoom, werden chloroplast genomen voor zowel TK686 als TK686-R geassembleerd met behulp van Fast-Plast v.1.2.525 onder standaardinstellingen met de bowtie index ingesteld op Poales. Een volledige chloroplast genoom is verkregen voor TK686-R, maar het TK686 chloroplast genoom werd geassembleerd in zeven contigs als gevolg van lagere Lees diepte. De TK686 contigs werden geassembleerd handmatig na McKain et al. 26 volledig geassembleerd chloroplast genomen waren uitgelijnd met elkaar in een uitlijning GUI gebaseerde software (Zie Tabel van materialen) en variatie tussen vergaderingen werd beoordeeld. Totaal 12 SNPs en één indel werden geïdentificeerd tussen chloroplast assemblages voor TK686 en TK686-R. Voor iedere variant, werd dekking beoordeeld in Lees sets van zowel TK686 als TK686-R. In alle gevallen was de meest voorkomende variant hetzelfde tussen de twee bibliotheken. TK686 aangetoond dat één T→C, een G→A, een G→T, een G→-, één C→A, een T→A en vier varianten van de C→A. Vijf van deze varianten is opgetreden binnen een tekenreeks homopolymeer, suggereren dat hun opneming in de vergadering kan geweest zijn het resultaat van sequencing fout en lage totale dekking. De anderen kunnen zijn het resultaat van chloroplast haplotype variatie, sequencing fout, of cytosine deamination, of een combinatie van deze factoren. TK686-R had een C→T, een G→T en een A→G. De C→T en G→T varianten werden gevonden in een homopolymeer als hierboven. Uiteindelijk, identiek volledige chloroplast genomen werden geïdentificeerd uit beide Lees sets. Een enkele chloroplast genoom bij TK686 was van aantekeningen voorzien met behulp van groene21 en vergeleken met andere leden van de stam Andropogoneae. Alle standaard chloroplast functies waren geannoteerde: 8 rRNAs, 38 tRNAs en 84 eiwit codering genen. Het volledige chloroplast genoom is verkrijgbaar bij GenBank (MF170217) en groene27.

Potentiële vertekening van de reamplification van de bibliotheken was ook vastbesloten door middel van schatting van percentage GC en totale geschatte transposon inhoud. Percentage GC werd geschat aan de hand van een aangepast script24. Verschillen in GC inhoud van de twee monsters waren te verwaarlozen, met 49,7% GC in TK686 en 51,2% GC in TK686-R. Transposon samenstelling was geschat aan de hand van de Transposome28. Voor beide bibliotheken, 100.000 leest werden willekeurig subsampled transposon samenstelling was geschat aan de hand van een percentage identiteit van 90, een deel-dekking van 0,55, een clustergrootte van 100 en de RepBase 21,10 gras herhalen verwijzing instellen29. Dit werd 100 keer herhaald voor het uitvoeren van de bootstrap op transposon schatting van deze datasets. Percentages van het totale genoom voor grote onderfamilies van transposons werden gehaald uit Transposome uitvoer, en het gemiddelde en de standaarddeviatie van deze voor de 100 replicatieonderzoeken werden geraamd. Alle scripts die worden gebruikt voor het genereren van deze uitgangen kunnen worden gevonden in M. R. McKain van Github repository Transposons30, en alle resultaten zijn nedergelegd in Dryad (doi:10.5061/dryad.r8t2m). De twee meest voorkomende transposon onderfamilies als indicatoren (Copia en Gypsy lange terminal herhalen retrotransposons) gebruikt, waren de resultaten bijna identiek met Copia 33.52 ± 4,00% 31.68 Gypsy en ± 2,94% bij 24.83 ± 2,72 tot 24.00 ± 2,35% in TK686 en TK686-R, respectievelijk (tabel 3). Deze test resultaten suggereren dat de stap van de reamplification van dit protocol geen zinvolle sequencing bias voor op hoog niveau genoom statistieken hebt gemaakt. Echter, opgemerkt moet worden dat dit enkel voorbeeld mogelijk niet volledig representatief voor alle reamplified bibliotheken. Deze single-test toont aan dat de stap van reamplification genoom statistieken in TK686/TK686-R. niet inherent was vertekenende Geïntroduceerde vooroordeel zou geen invloed op de vergadering van een chloroplast genoom gegeven voldoende dekking van sequencing, maar het wordt aanbevolen dat experimenten, zoals gepresenteerd in deze studie met TK686/TK686-R, worden uitgevoerd op doel lineages om te verifiëren dat vooroordeel niet is die zich voordoen tijdens studie onderzoekt transposons element diversiteit.

Figure 1
Figuur 1: Agarose gel beelden van A) DNA isolatie en B) laatste sequencing bibliotheken uit tien monsters van het herbarium. Voor elke lane, werd 3 µL van DNA of bibliotheek gebruikt. (A) DNA in alle herbarium isolatie werd afgebroken, zoals gezien door de algemene uitstrijkjes. (B) laatste sequencing bibliotheken verbeelden een primaire band van 300-500 basenparen met een bredere distributie van 200-1000 basenparen; dat laatste is vaker in reamplified bibliotheken. Rijstroken voor zowel (A) en (B) door monster werden geïdentificeerd en kan worden vergeleken met de resultaten in tabel 2. Ladder grootte werd afgebeeld in basenparen (bp). Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Circulaire plot van Schizachyrium scoparium (TK686) chloroplast genoom met annotatie. Het volledig geassembleerd genoom van shotgun rangschikken van DNA herbarium afkomstige tentoongesteld een totale lengte van 139,296 baseparen (bp), een regio van de grote één exemplaar (LSC) van 81,401 bp, een omgekeerde herhalingsgebied (IR) van 22,669 bp, en een kleine één kopie gebied (WS) van 12,557 BP. Alle standaard eiwit-codeert genen, tRNAs en rRNAs voor leden van de Andropogoneae-stam werden geïdentificeerd in de aantekening. Klik hier voor een grotere versie van dit cijfer.

Tabel 2: DNA-extractie en bibliotheek voorbereiding-resultaten voor tien herbarium monsters en vier reamplified bibliotheken. De totale dubbele gestrande DNA op verschillende stappen in het protocol aangetoond hoe variabele kwaliteit, vooral als ze worden gefilterd op grootte. Klik hier om te downloaden van deze tabel.

Tabel 3: rangschikking van de statistieken voor de TK686 en de reamplified TK686R. Reamplification heeft geen invloed op de totale incidentie van schimmel genoom besmetting, GC inhoud schatting, transposon samenstelling schatting of de mogelijkheid om het monteren van de hele chloroplast genomen. Klik hier om te downloaden van deze tabel.

Aanvullende tabel 1: DNA-extractie en bibliotheek voorbereiding-resultaten voor veertig extra herbarium monsters, met inbegrip van twintig reamplified bibliotheken. Totale dubbele gestrande DNA op verschillende stappen in het protocol aangetoond hoe variabele kwaliteit, vooral als ze worden gefilterd op grootte. Klik hier om te downloaden van deze tabel.

Aanvullende figuur 1: Agarose gel beelden van veertig extra DNA isolatie van herbarium specimens. Zowel (A) en (B) verbeelden twintig afzonderlijke DNA-isolatie en de karakteristieke afbraak van herbarium afkomstige DNA aan te tonen. Voor elke lane, werd 3 µL van DNA gebruikt. Rijstroken voor zowel (A) en (B) door monster werden geïdentificeerd en kan worden vergeleken met de resultaten in de aanvullende tabel 1. Ladder grootte wordt afgebeeld in basenparen (bp). Witte vlekjes op de afbeelding zijn te wijten aan artefacten in de gel imager die niet kunnen worden verwijderd met het schoonmaken. Klik hier voor het downloaden van dit cijfer.

Aanvullende figuur 2: Agarose gel beelden van veertig extra sequencing bibliotheken van DNA herbarium afkomstige. Voor elke lane, werd 3 µL van bibliotheek gebruikt. Definitieve sequencing bibliotheken zijn te vinden in zowel (A) en (B) met een gemiddelde grootte van 300-500 basenparen. Secundaire bands gezien in sommige versterkte monsters suggereren "borrelen" van bibliotheken. Rijstroken voor zowel (A) en (B) door monster worden geïdentificeerd en kan worden vergeleken met de resultaten in de aanvullende tabel 1. Ladder grootte wordt afgebeeld in basenparen (bp). Klik hier voor het downloaden van dit cijfer.

Aanvullende figuur 3: Agarose gel imago van secundaire band verwijdering met een stap in de PCR extra enkele cyclus. Klik hier voor het downloaden van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het protocol hier gepresenteerd is een uitgebreide en robuuste methode voor DNA isolatie en het rangschikken van bibliotheek bereiding op basis van gedroogde plant exemplaren. De consistentie van de methode en de minimale behoefte te wijzigen op basis van specimen kwaliteit maken het schaalbare voor groot herbarium gebaseerde sequencing projecten. De opname van een optionele reamplification stap voor lage opbrengst bibliotheken kan de opname van lage kwaliteit, geringe hoeveelheid, zeldzame, of historisch belangrijke voorbeelden die anders niet geschikt voor het rangschikken zouden.

Belang van oorspronkelijke DNA opbrengst
Herbarium afkomstige DNA is vaak aangetast als gevolg van de initiële specimen behoud11, met DNA van specimens minder dan 300 jaar oude niet zo aangetast als DNA geïsoleerd uit dierlijke resten die enkele honderden tot duizenden jaren oude31 , 32. bijgevolg optimalisatie van oorspronkelijke DNA opbrengst is van vitaal belang bij het verkrijgen van voldoende hoge kwaliteit dsDNA succesvolle sequencing bibliotheek voorbereiding. Voor soorten gras, een optimale rendement wordt bereikt door het gecombineerd gebruik van gesteriliseerde zand en vloeibare stikstof in de initiële slijpen stap, een grondiger vernietiging van celwanden en vrijlating van nucleïnezuren. Deze aanpak verhoogt zowel wenselijk grotere dsDNA en ongewenste kleinere fragmenten (Figuur 1, aanvullende figuur 1, tabel 2, aanvullende tabel 1). Latere kraal schoonmaak stappen isoleren en verrijken voor fragmenten van een grootte die geschikt is voor rangschikken (300 – 500 basenparen), sterk verminderen herstel maar ook verrijken voor langere fragmenten (tabel 2, aanvullende tabel 1). Wijzigingen in de eerste DNA isolatie stappen kunnen nodig zijn op basis van het geslacht wordt bemonsterd teneinde de effecten van secundaire metabolieten op downstream processing18.

Optimalisatie van bibliotheek adapters
De concentratie van adapters gebruikt voor afbinding heeft een directe invloed op de hoeveelheid adapter dimeer in afgewerkte bibliotheken. Adapter Dimeren resultaat van de adapter zelf Afbinding wanneer onvoldoende monster aanwezig is, en sequencing punten33besmetten. De relatief lage totale dsDNA beschikbaar uit herbarium monsters vereist verdunning van adapters vóór afbinding. Adapters kunnen worden verdund 50-fold uit de voorraad concentratie van 15 µM (Zie Protocol sectie) faciliterende high-throughput bibliotheek voorbereiding zonder de noodzaak om individueel meten en Verdun-adapter voor elk monster (tabel 2, aanvullende tabel 1). Hoewel verzadiging van adapters in principe algemene bibliotheek opbrengst dalen kan, is het onwaarschijnlijk dat herbarium specimens dsDNA in dergelijke overmaat van adapter zal opleveren.

Variatie in de kraal schoonmaak stappen voor hogere opbrengsten
Maat keuze in voorbereiding van sequencing bibliotheken gebeurt meestal na adapter afbinding, waardoor voor versterking van fragmenten voornamelijk binnen het bereik van de gewenste grootte; Dit wordt gedaan door het verwijderen van fragmenten die zowel groter als kleiner zijn dan de doelgrootte. De lage hoeveelheid herbarium afkomstige dsDNA bibliotheek voorbereiding is verergerd na maat keuze bij deze stap, resulterend in unworkably lage totale dsDNA en uiteindelijk lage rendement in de definitieve bibliotheek. Door het uitvoeren van een standaard kraal-reiniging stap met behulp van 90% volume kralen na afbinding, blijft meer totale dsDNA voor verrijking in de amplificatie stap. Extreem kleine fragmenten van DNA worden netcongestieproblemen verwijderd met behulp van 90% volume kralen. Maat keuze wordt uitgevoerd in de laatste stap op de versterkte bibliotheek, die zorgt voor een verrijking van het gewenste fragment maten. Totale hoeveelheid kralen kunnen worden aangepast om te selecteren van het gewenste bereik, hoewel de volumes van de twee stappen van 25 µL en 6 µL van parels zijn geoptimaliseerd voor het ophalen van de bibliotheken van 400-500 basenpaar tussenvoegsels binnen dit protocol (figuur 1B, aanvullende figuur 2).

Monster redding door middel van de Reamplification van bibliotheken
Ondanks de beste praktijken in DNA isolatie en voorbereiding van de bibliotheek mogelijk de eindconcentraties van sequencing bibliotheken onvoldoende voor verdere sequencing. De destructieve aard van de bemonsterings- en vaak beperkte eenmalig materiaal uit herbarium monsters niet altijd toe dat herhalende DNA isolatie. Door reamplifying de bibliotheek tot kunnen 12 extra PCR cycli, zelfs uitzonderlijk slechte bibliotheken worden opgeslagen. Een paar standaard primer wordt gebruikt voor amplificatie, die compatibel met beide dual- of single geïndexeerde bibliotheek-protocollen is. Een primaire zorg voor reamplification is de invoering van bias, vaak door middel van vermindering van GC-rijke gedeelten van het genoom20. Met behulp van een hifi-polymerase (Zie Tabel of Materials), deze potentiële vertekeningen zijn potentieel vermeden. Dit is aangetoond door de minimale variatie van GC inhoud van de gesequenceerd bibliotheken TK686 en TK686-R (tabel 3). Als een tweede verificatie, was de transposon inhoud van zowel TK686 als TK686-R geschat en toonde geen merkbare verschillen (tabel 3). Tot slot, de hele chloroplast genoom van deze toetreding was samengesteld uit TK686 en TK686-R, wat in identieke sequenties na nauwe inzage van SNP variatie tussen de twee vergaderingen (Figuur 2, tabel 3 resulteerde). Deze tests suggereren dat standaard genomic metrics, zoals GC inhoud en transposon samenstelling, en het vermogen te monteren complete chloroplast genomen, kunnen niet worden beïnvloed door reamplification. Dit opent de mogelijkheid van integratie van herbarium specimens gedacht te worden gedegradeerd of ontbreekt in materiaal in phylogenomic studies zonder zorg voor geïntroduceerde bias door middel van PCR. Deze reamplified bibliotheken kunnen ook worden gebruikt voor volgorde vastleggen34, hoewel het zou nodig zijn om te testen of SNP roeping is bevooroordeeld. Het wordt aanbevolen dat kleinschalige proeven van bias worden uitgevoerd met elk project om te verifiëren dat bias sequencing bibliotheken niet is binnengebracht.

Beperkingen en eventuele wijzigingen
Hoewel dit protocol heeft gewerkt op kunnen honderden herbarium specimens, slecht bewaarde weefsels nog steeds niet bij elke stap. Het is echter uiterst zeldzaam voor bibliotheken te mislukken uit weefsels met succesvolle DNA extracties, vooral na de redding van de bibliotheek via reamplification. De grootte selectiestadia als kunnen worden gewijzigd om te richten van verschillende grootte fragmenten of om het brede scala van fragmenten gezien in sommige definitieve bibliotheken. Zoals met alle protocollen van de extractie op basis van planten, kunnen stappen nodig zijn om het verwijderen van geslacht-specifieke secundaire verbindingen die het algemene protocol kunnen belemmeren. Zoals gepresenteerd, dit protocol biedt een standaardmethode voor DNA-isolatie en hoge gegevensdoorvoer bibliotheek-voorbereiding voor gras herbarium specimens, en door middel van verificatie en experimenten dreigt te worden geamendeerd om andere geslachten van de plant.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat zij hebben geen concurrerende belangen.

Acknowledgments

Wij danken Taylor AuBuchon-Elder, Jordanië Teisher, en Kristina Zudock voor hulp bij bemonstering herbarium exemplaren en de Missouri Botanical Garden voor toegang tot herbarium exemplaren voor destructieve bemonstering. Dit werk was ondersteuning door een subsidie van de National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics