Поколение генома общесистемной Chromatin конформации захвата библиотек из плотно поставил раннего дрозофилы эмбрионов

Genetics
 

Summary

Эта работа описывает протокол для поколения высокого разрешения в situ Hi-C библиотек из плотно поставил перед гаструляция Drosophila melanogaster эмбрионов.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hug, C. B., Vaquerizas, J. M. Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos. J. Vis. Exp. (140), e57001, doi:10.3791/57001 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Расследование трехмерную архитектуру хроматина предлагает бесценный понимание механизмов регуляции генов. Здесь мы описываем протокол для выполнения хроматина конформации захвата технику в situ Hi-C на постановке популяций Drosophila melanogaster эмбриона. Результатом является последовательность Библиотека, которая позволяет отображение всех взаимодействий хроматина, которые встречаются в ядре в одном эксперименте. Сортировка эмбрионов выполняется вручную с помощью флуоресцентных стерео микроскоп и трансгенных летать строку, содержащую маркер ядерного. Используя эту технику, эмбриона населения от каждого цикла Ядерная дивизия и статус определенных клеточного цикла, можно получить с очень высокой чистоты. Протокол также может быть адаптирована для сортировки старых эмбрионов за пределами гаструляция. Отсортированный эмбрионов используются в качестве входных данных для в situ Hi-C. Все эксперименты, включая секвенирование библиотека подготовки, может быть завершена в течение пяти дней. Протокол имеет низкие требования к входным данным и работает надежно используя 20 бластодермы стадии эмбрионов в качестве входного материала. Конечным результатом является библиотека последовательности для следующего поколения последовательности. После выполнения виртуализации, данные могут быть обработаны в геном общесистемной хроматина взаимодействия карт, которые могут быть проанализированы с помощью широкий спектр доступных инструментов для получения информации о топологически сопоставление структуры доменов (TAD), петли хроматина и хроматина отсеков во время разработки дрозофилы .

Introduction

Хроматин конформации захвата (3C) стала исключительно полезным методом для изучения топологии хроматина в ядро1. Вариант 3C Hi-C позволяет измерения контактной частоты всех взаимодействий хроматина, которые встречаются в ядре в одном эксперименте2. Приложение Hi-C играет важную роль в открытии и характеристика многих фундаментальных принципов организации хроматина, например TADs, отсеков и циклы3,4,5.

Исследования по хроматину архитектуры в контексте развития переходы и дифференцировки клеток все чаще используются для разгадать механизмы регуляции генов в ходе этих процессов6,,78, 9. Один из модельных организмов большой интерес — Drosophila melanogaster, чье развитие и геном хорошо характеризуются. Однако несколько исследований, которые расследуют хроматина архитектуры в дрозофилы вне в vitro культуры ткани, параметры были проведены10,11. В эмбрионы 16 – 18 ч пост оплодотворение, TADs и отсеков напоминает аналогичные структуры в млекопитающих были определены10, который поднимает вопрос о роли, которую они играют в регуляции генов во время зародыша дрозофилы развития. Особенно на ранних стадиях развития, до гаструляция такие исследования являются технически сложным. До гаструляция дрозофила эмбрионов пройти 13 синхронных ядерных дивизий, которые действовать чрезвычайно быстрыми темпами 8 – 60 минут за цикл12,13. В дополнение к этому отсутствие визуальных особенностей различать различные этапы сделать его трудно получить материал плотно поставил эмбриона в достаточных количествах.

Для того, чтобы разработать протокол, который позволяет изучать архитектуру хроматина в начале развития дрозофилы на урегулирование ядерного цикла, мы объединили два существующих методов: в situ Hi-C, который позволяет всего поколения высокого разрешения геном контактной карты5и постановка эмбриона, используя трансгенные линии дрозофилы , выражая eGFP-PCNA трансген13,14. Этот трансген локализуется в ядро во время межфазной и рассеивает во всем-синцитиальный бластодермы во время митоза. С помощью этого свойства, можно легко отличить различные этапы их ядерная плотность и митотического эмбрионов диспергированием GFP сигнала.

Вместе эти методы позволяют изучать трехмерную структуру хроматина в высоком разрешении от всего лишь 20 дрозофилы эмбрионов. Этот протокол включает в себя инструкции для уборки и сортировки дрозофилы эмбрионов для получения населением эмбрионов от одного Ядерная дивизия цикла. Далее описывается, как полученные эмбрионы используются для выполнения в situ Hi-C. Конечным результатом является библиотекой нуклеотидов подходит для виртуализации на следующее поколение виртуализации машин. Результирующая последовательность читает затем могут быть обработаны в подробных хроматина взаимодействия карт, охватывающих весь геном дрозофилы .

Protocol

1. Коллекция зародыша дрозофилы

Примечание: Эквивалент эмбриона коллекции может быть выполнено как показано в предыдущей публикации15.

  1. Передавать молодым eGFP-PCNA мух (< 1 неделя старый) в коллекции клетки яйцо с дрожжевого коллекции пластины16 (1% этанола, уксусная кислота 1% и 4% агар).
  2. Перемещение коллекции клетки инкубатора в 25 ° C. Инкубации 1 – 2 дней до сбора яиц значительно повышает урожайность яйцо. Изменить коллекцию пластины дважды в день.
  3. Снимите крышки, содержащего эмбрионы из коллекции камеры с интервалом 30-60 мин. Меньшие промежутки времени привести к меньшее количество эмбрионов, но крепче распределение стадии развития. Собирать, от нескольких клеток параллельно так идеально и что > 200 яйца откладываются каждые 30 – 60 мин.
  4. Храните пластины при 25 ° C до достижения желаемого эмбрионов. Бластодермы стадии эмбрионов (ядерного цикла 14) Проинкубируйте примерно 2 ч.
  5. После 2 ч инкубации добавьте водопроводной воды от шприц бутылку к пластине коллекции так, что вся поверхность покрыта водой. Приостановить эмбрионов и дрожжей, мягкой щеткой.
  6. Наливайте ресуспензированы эмбрионы от коллекции пластины в корзину коллекции эмбриона (коммерческие ячейки сита с 100 мкм поры или домашнее корзины17 работают хорошо), добавив дополнительные водопроводную воду из шприц бутылку, при необходимости. На данном этапе объединить эмбрионов от всех плит, которые были собраны в параллельном режиме. Обобщённые образец представляет собой единый пакет.
  7. Вымойте эмбрионов хорошо промыв корзину с водопроводной водой из бутылки шприц для 30 s пока не смыл все остатки дрожжей.
  8. Dechorionate эмбрионы, помещая корзина коллекции в 2,5% раствор гипохлорита натрия в воде. Легкие агитации, закрученной облегчает удаление хориона. Продолжать до тех пор, пока эмбрионов достаточно гидрофобны, так что они плавают на поверхности раствора, когда корзина поднял и погруженной снова, который должен занять ~1.75–2 мин.
    Предупреждение: Гипохлорит натрия обладает коррозионными свойствами. Носите соответствующие средства индивидуальной защиты. Растворы, содержащие < гипохлорита натрия 10% обычно может быть удален в раковину, не забудьте проверить правила принимающей института.
  9. Выньте корзину из раствора и промыть водопроводной воды от шприц бутылку до тех пор, пока запах отбеливателя больше не заметно.

2. эмбриона фиксации

Примечание: Условия оптимальной фиксации, главным образом концентрации моющего средства, формальдегида и длительность фиксации, нужно быть эмпирически установлено подходят на стадии эмбриона. Для этапов вокруг-синцитиальный Бластодерма конечная концентрация 0,5% Тритон X-100 и 1,8% формальдегида в водной фазе работают хорошо. Для более поздних этапов стадию эмбриона 9 дальнейшая оптимизация этих параметров может быть необходимым. Все решения, используемые во время фиксации и сортировка должна содержать ингибиторов протеазы.

  1. Инвертировать корзина коллекции и поместите его над 15 мл конические центрифугирования. Флеш эмбрионов из корзины в трубку с помощью пипетки Пастера дозирования PBS-T (PBS, 0,5% X-100 Тритон).
  2. Пусть эмбрионов оседают на дне и отрегулировать общий объем по 2 мл с PBS-T.
  3. Добавьте 6 мл гептана и 100 мкл 37% формальдегида в воде.
    Предупреждение: Гептана и формальдегид токсичных при вдыхании или после кожи контакт. Носите соответствующие средства индивидуальной защиты и работать в зонта. Отходы, содержащие Гептан или формальдегид должно утилизироваться отдельно согласно правилам принимающей Институт.
  4. После добавления формальдегида запустить таймер 15 мин и энергично встряхнуть трубу вверх и вниз за 1 мин вручную. Водные и органические фазы будет объединить формы шампунь как последовательности.
  5. Агитируйте на вращательное мешалке до 10 мин после нанесения формальдегида.
  6. Центрифуга на 500 x g 1 мин при комнатной температуре для сбора эмбрионов в нижней части трубки.
  7. Аспирационная весь шампунь как жидкости и отменить его, стараясь не аспирационная любой эмбрионов. Оставшиеся в небольших количествах супернатант шампунь как не вызывают проблем.
  8. 15 мин после нанесения формальдегида, Ресуспензируйте эмбрионы в 5 мл PBS-T с 125 мм глицин для утоления формальдегида. Смешайте энергично встряхивая вверх и вниз на 1 мин.
  9. Центрифуга на 500 x g при комнатной температуре в течение 1 мин и удалить супернатант.
  10. Вымойте эмбрионов, resuspending их в 5 мл ледяной PBS-t. Пусть эмбрионов поселиться и аспирата все супернатант.
  11. Повторите мыть в шаге 2.10 еще два раза.
  12. Держите эмбрионов на льду до сортировки. Обычно это хорошая идея, чтобы собирать 3 – 4 серий летать эмбрионов, прежде чем приступать к сортировке. Однако эмбрионы должны быть отсортированы в тот же день. Длительное хранение на льду или в холодильнике приводит к морфологии изменены эмбриона.

3. эмбриона сортировка

Примечание: Сортировка может быть сделано на любой флуоресцентные стерео микроскоп с GFP фильтром при увеличении X 60 – 80.

  1. С помощью пипетки 1000 мкл, передать пакет примерно 100 эмбрионов подходит для сортировки, желательно темного цвета, небольшой стеклянный сосуд и поместите его на льду.
  2. Сортировка эмбрионов ядерной плотности и клеточный цикл статус (рис. 1), нажав желательно эмбрионов в отдельную кучу, используя кончик иглы или шприца.
    1. Удалите все эмбрионы с дисперсных, не обладающих ядерным распространением eGFP-PCNA (Рисунок 1E). Кроме того эмбрионов, которые частично Показать неядерных GFP сигнал должны быть удалены.
    2. Для оказания помощи в сортировке, соберите линейку ссылка эмбрионов в ядерного цикла 12, 13 и 14 в каждом пакете, используя в качестве руководства фотографии в Рисунок 1 . Используйте этот состав эмбрионов Неизвестный этап с одним из эмбрионов ссылку для того, чтобы определить их этапе.
    3. Чтобы проверить стадии развития эмбрионов ссылку, измерьте ядерная плотность изображений эмбриона и подсчета числа ядер на поверхности эмбриона в районе 2500 мкм2 с использованием изображений программное обеспечение, которое предоставляет сведения о расстоянии.
      Примечание: Ожидаемое количество ядер для площадью 2500 мкм2 — 12 до 16 ядер на ядерного цикла 12 и 20-30 ядер ядерного цикла 1313.
  3. После того, как все эмбрионы на соответствующем этапе разделены, принимать фотографии эмбрионов для документации и контроля качества. Если стерео Микроскоп само по себе не оснащен модулем камеры, могут использоваться любые эпифлуоресцентного микроскопа с GFP фильтры.
  4. Пипетка до желаемого эмбрионов, с помощью пипетки 1000 мкл, передача свежих пробки и место на льду.
  5. Продолжайте, пока достаточное количество эмбрионов сортируются для запланированного эксперимента. Для эмбрионов старше чем этап 9, как правило 20 эмбрионов достаточно для одного в situ эксперимент Привет-C. На ядерного цикла 12 80 эмбрионов являются хорошей отправной точкой. В ранее циклов необходимо приблизительно удвоить количество эмбрионов для каждого цикла.
  6. Бассейн и разделения эмбрионов в 1,5 мл пробирок таким образом, что одна трубка содержит достаточное количество эмбрионов для одного в situ Hi-C эксперимент. Рекомендуется использовать трубы с низкими характеристиками привязки ДНК, так как же трубка будет использоваться для всего протокола и адсорбции ДНК может привести к значительным потерям при низких концентрациях ДНК.
  7. Спин трубы кратко на 100 x g при комнатной температуре и удалить супернатант. Эмбрионы должны быть как сухой, как можно скорее для замораживания.
  8. Флэш замораживания эмбрионов, погрузив трубы в жидком азоте и хранить при температуре-80 ° C.

4. в Situ Привет C

  1. Лизис
    1. Место труб с замороженных эмбрионов на льду.
    2. Ресуспензируйте эмбрионов в 500 мкл буфера lysis ледяной (10 мм трис-Cl рН 8,0, 10 мм NaCl, 0,2% IGEPAL CA-630, Ингибиторы протеаз, растворенных в воде). Подождите 1 мин, чтобы позволить эмбрионов поселиться в нижней части трубки.
    3. Измельчить эмбрионов, с помощью металлических микро пестиком, предварительно охлажденный на льду, который предназначен для плотно пробки microcentrifuge 1,5 мл.
      1. Чтобы избежать агитацию эмбрионы, медленно вставьте пестиком, пока он не коснется нижней части трубки, сместите вниз и затем шлифуют, вращая пестик дважды в обоих направлениях.
      2. Очень слегка приподнимите пестиком, снова нажмите в нижней части трубки и повторять шлифования.
      3. 4.1.3.2 повторить 10 раз или до тех пор, пока эмбрионы полностью лизированы. Раствор должен быть однородным, и должна оставаться без остаточных большие куски эмбрионов.
    4. Инкубировать гомогенизированные подвеска на льду на 15 мин спина на 1000 x g, 4 ° C на 5 мин и удалить супернатант.
    5. Стирать Пелле resuspending 500 мкл ледяной литического буфера, закупорить вверх и вниз.
    6. Снова спина как 4.1.4 и удалить супернатант.
    7. Ресуспензируйте промывают Пелле в 100 мкл 0,5% лаурилсульфат натрия (SDS), закупорить вверх и вниз. Разрушения ядер по инкубации в течение 10 минут при температуре 65 ° C в блоке Отопление. Утолите SDS, добавляя 50 мкл 10% Тритон X-100 и 120 мкл воды. Смешать, стряхивая трубки.
    8. Инкубируйте при 37 ° C 15 мин в блоке тепла.
  2. Пищеварение энзима ограничения
    1. 25 мкл 10 x буфер энзима ограничения и 20 U 5 U/мкл Мбои. Смешать, стряхивая трубки.
    2. Дайджест ДНК путем инкубации в течение 90 минут при 37 ° C в блоке тепла под легким агитации (750 об/мин).
    3. Добавить еще 20 U Мбои и продолжать инкубации 90 мин.
    4. Тепло инактивирует Мбои по инкубации на 62 ° C в течение 20 мин.
  3. Свес заполнить
    Примечание: Заполнение навеса с биотинилированным dATP позволяет выбор конкретных перевязаны фрагментов. Биотин dATP на лигирование узлов защищен от деятельность при exonuclease T4 ДНК-полимеразы (раздел 4.6), тогда как биотин dATP на unligated тупым концами эффективно удаляется. Пулдаун, используя стрептавидина покрытием бусины в разделе 4.7 поэтому специально обогащает перевязаны, химерных фрагментов ДНК.
    1. Добавьте 18 мкл 0,4 мм биотин-14-dATP, 2,25 мкл неизмененном дЦТФ/dGTP/dTTP смеси (по 3,3 мм) и 8 мкл 5 U/мкл ДНК-полимераза I фрагменты фрагмента.
    2. Смешать, стряхивая трубки и инкубировать при 37 ° C 90 мин в блоке тепла.
  4. Перевязка
    1. Добавить 657 мкл воды, 120 мкл 10 x T4 ДНК лигаза буфера, 100 мкл 10% Тритон X-100, 6 мкл 20 мг/мл, бычьим сывороточным альбумином (БСА), и смесь, стряхивая трубки. Наконец добавьте 5 мкл 5 U/мкл T4 ДНК лигаза и микс, стряхивая трубки.
    2. Поворот трубы аккуратно (20 мин) при комнатной температуре в течение 2 ч.
    3. Добавьте второй взнос 5 мкл 5 U/мкл T4 ДНК лигаза и продолжайте вращать для 2 более h.
    4. Спин вниз ядер на 2500 x g 5 минут и удалить супернатант.
  5. Экстракции ДНК
    1. Ресуспензируйте Пелле в 500 мкл буфера извлечения (50 мм трис-Cl рН 8,0, 50 мм NaCl, 1 мм Этилендиаминтетрауксусная кислота (ЭДТА), 1% SDS; растворенных в воде) и 20 мкл 20 мг/мл протеиназы K. Mix, стряхивая трубки.
    2. Дайджест белка с инкубации при температуре 55 ° C за 30 мин, тряски на 1000 об/мин.
    3. Де crosslink 130 мкл 5 М NaCl и Инкубируйте на ночь на 68 ° C, тряски на 1000 об/мин.
    4. Образец в пипетку в новом 2-мл пробирку, преимущественно с низкими характеристиками связывания ДНК.
    5. Добавьте 0,1 x томов (63 мкл) 3 M натрия ацетата рН 5.2 и 2 мкл 15 мг/мл GlycoBlue. Смешайте хорошо переворачивать. Добавьте 1.6 x томов (1008 мкл) чистого абсолютного этанола и микс, инвертирование.
    6. Инкубируйте на-80 ° C на 15 мин центрифуги на 20000 x g при 4 ° C для по крайней мере 30 минут. Пелле ДНК часто очень маленький, практически невидимый, а только может быть выставлен за синий цвет GlycoBlue.
    7. Удалите супернатант очень тщательно, перемещение наконечник пипетки в трубку вдоль противоположной стены от где находится Пелле ДНК. Маленькие капельки оставшиеся часто легко удаляются во время этот шаг и следующий моет, нажав их из трубы, используя кончик P10 вместо закупорить их.
    8. Вымойте Пелле, добавляя 800 мкл на 70% спирте. Смешать, инвертирование и центрифуги на 20000 x g при комнатной температуре на 5 мин повторить это мыть по крайней мере один раз.
    9. Удалите все следы этанола и оставить постоянный трубки с открытой крышкой для воздушно-сухой до 5 мин. После того, как остальные не жидкость, 50 мкл 10 мм трис-Cl рН 8.0. Неоднократно Пипетка решение над районом на стенке трубки расположение гранул чтобы солюбилизировать последнего ДНК.
    10. 1 мкл 20 мг/мл РНКазы A, смесь, стряхивая трубки и инкубировать при 37 ° C на 15 минут, чтобы дайджест РНК. Теперь образец можно хранить в холодильнике на ночь или замороженные при температуре-20 ° C на неопределенный срок.
    11. Проверка концентрации ДНК Люминесцентную краску на основе анализа согласно инструкциям производителя. Общее количество ДНК в образце должна быть по крайней мере 10 нг, в противном случае слишком мало материал доступен для амплификации и библиотека сложности, вероятно, будет низкой. Когда это произойдет, количество исходного материала, вероятно, не достаточно, или материал был потерян в пути, возможно во время лизис и осадков.
  6. Удаление биотина и ДНК стрижка
    1. Добавьте вместе 12 мкл 10 x буфер T4 ДНК-полимеразы, 3 мкл dATP 1 мм, 3 мкл dGTP 1 мм и 46 мкл воды. Смешать, стряхивая трубки. 5 мкл 3 ед/мл T4 ДНК-полимеразы, смешивать, стряхивая трубки и Инкубируйте на 20 ° C за 30 мин.
    2. 3 мкл ЭДТА 0,5 М для остановки реакции и использовать воду для принести объемом около 120 мкл пример.
    3. Сдвига ДНК до размера 200 – 400 bp с помощью sonication устройства в соответствии с инструкциями производителя. С помощью sonicator, упомянутых в Таблице материалов, следующая программа подходит: 2 циклов, каждый из 50 s, 10% пошлины, интенсивность 5, 200 циклов/взрыв.
  7. Биотин пулдаун
    1. Пипетка 30 мкл 10 мг/мл стрептавидина покрытием магнитные шарики в новой трубки, разделите их на магнитную подставку и удалить супернатант.
    2. Ресуспензируйте бусины в 1 x B & W буфера (5 мм трис-Cl рН 7,4, ЭДТА 0,5 мм, 1 M NaCl, растворенных в воде) + 0,1% тритон X-100 и микс на vortexing. Место труб на магнитную подставку и ждать 1 – 5 мин, до тех пор, пока бисер разделены, в зависимости от марки и модели.
    3. Аспирационная и удалить супернатант сдвинув наконечник пипетки вдоль стены напротив где расположены шарики. Ресуспензируйте бусины в 120 мкл 2 x B & W-буфера (10 мм трис-Cl рН 7,4, ЭДТА 1 мм и 2 М NaCl). Смешайте vortexing.
    4. Передача стриженый ДНК в новой низким трубки связывания ДНК и смешать с 120 мкл подвески из бисера в буфере 2 X B & W, vortexing. Вращайте бусины с образца ДНК в 20 об/мин, 15 мин.
    5. Отдельные шарики на магнитную подставку и удалить супернатант.
    6. Ресуспензируйте бисер в 600 мкл 1 x B & W + 0.1% тритон X-100 и Инкубируйте на 55 ° C за 2 мин, тряски на 1000 об/мин. После разделения, удалить супернатант. Повторите это мыть раз.
    7. Вымойте бусины с 600 мкл 10 мм трис-Cl рН 8.0 и отбросить надосадке после разделения.
    8. Ресуспензируйте бусины в 50 мкл 10 мм трис-Cl рН 8.0.

5. последовательности библиотеки подготовка

Примечание: Все библиотеки шаги делаются с использованием компонентов от коммерческой подготовки библиотеки ДНК комплекта (см. Таблицу материалы). Однако может быть заменен альтернативные наборы или других реагентов. Осадков, как правило, форму в библиотеку подготовка агентов во время хранения морозильник. Поэтому важно, чтобы убедиться, что все осадков растворяется перед использованием реагентов.

  1. Конец ремонт
    1. Передача подвески из бисера в 50 мкл 10 мм трис-Cl рН 8,0 в новой ПЦР-пробирку.
    2. Добавьте 3 мкл конце приготовительный фермент смесь и 7 мкл буфера конце подготовительные реакции. Смешайте закупорить вверх и вниз.
    3. Передача труба тепловая велосипедист и запустите следующую программу: 20 ° C в течение 30 мин, 65 ° C для 30 минут и провести на 4 ° C.
  2. Перешнуровка адаптер
    1. 30 мкл лигирование Мастер микс, 2,5 мкл 1,5 мкм секвенирования адаптер (разбавляют до 1,5 мкм со склада) и 1 мкл лигирование Enhancer для подвески из бисера. Смешайте закупорить вверх и вниз.
    2. Инкубируйте на 20 ° C 15 мин в тепловая велосипедист.
    3. 3 мкл пользователя фермента. Смешайте закупорить вверх и вниз.
    4. Инкубируйте при 37 ° C 15 мин в тепловая велосипедист.
    5. Отдельные шарики на магнитную подставку и удалить супернатант.
    6. Мыть бусы, Ресуспензируйте бусины в 100 мкл 1 x B & W буфера + 0.1% тритон X-100. Смесь vortexing, и передача новых пробки microcentrifuge. Отдельные шарики на магнитную подставку и удалить супернатант.
    7. Повторите это мыть один раз, используя 600 мкл же буфера.
    8. Ресуспензируйте бусины в 600 мкл 10 мм трис-Cl рН 8,0, микс, vortexing и передача бусы на новой трубки.
    9. Отделить бусы на магнитную подставку, удалить супернатант и Ресуспензируйте бусины в 50 мкл 10 мм трис-Cl рН 8.0.
  3. Амплификации PCR
    1. Подготовить два ПЦР трубы и в каждом, смешать 25 мкл полимеразы Мастер микс, 1.5 мкл 10 мкм вперед (неиндексированные) PCR праймер и 1,5 мкл 10 мкм обратный (индексный) PCR праймер.
      Примечание: Вперед (неиндексированные) праймера PCR:
      5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC * T-3´.
      Реверс (индексный) праймера PCR:
      5'-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC * T-3´. * Указывает фосфоротиоат облигаций и Ns в индексированные праймера PCR.
    2. В каждой тюбике мкл 22 подвески из бисера и микс, закупорить вверх и вниз.
    3. Запуск ПЦР, используя следующую программу: 98 ° С в течение 1 мин, (98 ° C 15 s, 65 ° C для 75 s, наращивает 1,5 ° C/s) повторил 9 - 12 раз, 65 ° C за 5 мин и провести на 4 ° C.
      Примечание: Количество усиления циклов должно быть установлено эмпирически. Однако мы обнаружили, что библиотеки, которые необходимы более чем 12 циклов в целом низкой сложности и не привели к высоким качеством, которую Hi-C карты. С другой стороны библиотек, которые требуют менее чем 12 циклов не были затронуты отрицательно усиления для полного 12 циклов. Таким образом это можно по умолчанию до 12 циклов амплификации.
    4. Объединить две реакции PCR в одном microcentrifuge трубки, отдельные шарики на магнитную подставку и передачи супернатанта, содержащий библиотеку новой трубки.
  4. Выбор размера
    1. Принесите Ampure XP бусины подвеска до комнатной температуры и перемешать хорошо встряхнув.
    2. Довести объем пула реакции PCR ровно 200 мкл с водой. Во время ПЦР и магнитной сепарации некоторые из первоначального объема обычно теряется. Проверьте объем, установив пипетки для 200 мкл и аспирационная весь объем реакции. Если атмосферный воздух, воды должна быть добавлена. Если объем превышает 200 мкл, отрегулируйте громкость бисер добавлены в шагах 5.4.3 и 5.4.6 пропорционально.
      Примечание: Объемы в скобках являются действительными, если общий объем пула реакций PCR ровно 200 мкл.
    3. Добавьте 0.55 x тома (110 мкл) подвески из бисера Ampure XP и смешивать, закупорить вверх и вниз по крайней мере 10 раз.
    4. Инкубации при комнатной температуре в течение 5 мин, отдельными валиками на магнитные постоять 5 мин.
    5. Супернатант переход к новой пробке. Выбросите трубка, содержащая бисер. Бисер связали ДНК > 700 bp, который слишком велик для виртуализации.
    6. Супернатант, добавьте 0.2 x томов (40 мкл, что приводит к в общей сложности 0,75 x Ampure буфера в образце) подвески из бисера Ampure XP и микс от закупорить вверх и вниз по 10 раз.
    7. Инкубации при комнатной температуре в течение 5 мин, отдельными валиками на магнитные постоять 5 мин.
    8. Отменить супернатанта, которая содержит ДНК < 200 bp, которая включает в себя бесплатный грунтовки, Димеры праймера и фрагменты слишком мал для виртуализации.
    9. Оставьте трубки на магнитную подставку. Мыть бусы, 700 мкл 80% этанола, заботясь не беспокоить шарик Пелле и Инкубируйте 30 s.
    10. Отменить супернатанта, затем взять трубку от магнитного стенд и Ресуспензируйте бусины в 100 мкл 10 мм трис-Cl рН 8.0. Смешать, закупорить вверх и вниз в 10 раз и инкубации при комнатной температуре в течение 1 мин.
    11. Добавьте 0.8 x тома (80 мкл) подвески из бисера Ampure XP. Смешать, закупорить вверх и вниз в 10 раз и инкубации при комнатной температуре в течение 5 мин. Этот второй раунд выбор размера нижней границы гарантирует, что окончательный библиотека является полностью бесплатным, грунтовки и Димеры праймера.
    12. Отдельные бусы на магнитные постоять 5 мин и удалить супернатант.
    13. Помыть лепешка из бисера дважды с 700 мкл 80% этанола для 30 s каждая, при этом оставляя трубки магнитного стенд, как указано выше.
    14. С трубки еще на магнитного стенд удалите все следы этанола. Это помогает подтолкнуть капли этанола из трубки с помощью пипетки P10. Пусть остаточного этанола испаряются максимум 5 мин.
    15. Возьмите трубку от магнитного стенд и Ресуспензируйте бусины в 50 мкл 10 мм трис-Cl рН 8,0. Смешайте закупорить вверх и вниз по 10 раз.
    16. Инкубации при комнатной температуре за 5 мин, затем отдельными валиками на магнитную подставку.
    17. Супернатант передать свежие трубки. Это окончательный Привет-C библиотека, готовы быть количественно и виртуализации на следующее поколение виртуализации машин, согласно инструкциям производителя.

Representative Results

Сортировка эмбрионов населения на ядерного цикла, 12, 13 и 14 (соответствующий к 1:30, 1:45 и 2:10 часов должность оплодотворение, соответственно12) и 3-4 h пост оплодотворение (hpf) были получены в соответствии с процедурами, изложенными в протоколе. Принимая фотографии eGFP-PCNA сигнала каждой партии отсортированных эмбриона, возможна документ точное стадии и клеточного цикла статус каждого одного эмбриона, который используется в нижнем течении экспериментов. Пример фотографии эмбрионов от отсортированных населения представлены в Рисунок 1B-E. Выход в situ Hi-C протокола — это библиотека нуклеотидов готовы к виртуализации на следующее поколение виртуализации машин. Для этой цели обычно требуется окончательное библиотека концентрации по крайней мере 2-4 Нм. Использование рекомендуемых сумм входного материала, эта концентрация является надежно достичь (таблица 1).

Ожидаемый размер распределение фрагментов ДНК после выбора размера между 300-600 ВР, с максимум около 500 bp (рисунок 2A), в зависимости от точной стрижки и параметры выбора размера. Для виртуализации, мы рекомендуем в паре конец читает по крайней мере 75 bp длины, чтобы свести к минимуму количество фрагментов несопоставимого ограничение в геноме. Высоким разрешением карты с 1-2 kb размера Бен можно получить из 400 миллионов читает. Мы рекомендуем, что виртуализация несколько биологических реплицирует на глубине ниже ~ 150 миллионов читает каждый, вместо секвенирование одной репликации на большой глубине. Это позволяет оценки биологических отклонений и приводит к меньшее количество выброшенных читает из-за дублирования ПЦР. Для визуального представления реплицирует могут быть объединены. До совершения секвенирования образец на высокой глубине, рекомендуется запускать образцы с использованием мелкой последовательности (несколько миллионов чтений на сэмпл) для определения параметров качества базовой библиотеки, как показано на рисунке 2B.

Анализ данных Hi-C требует значительных вычислительных ресурсов и биоинформатики экспертизы. Как грубый обзор, парных читает самостоятельно сопоставляются с геном ссылка, результирующие ряды фильтруются на качество и ориентацию, а затем матрицу контактов на уровне резолюции или фрагмент данного Бен может быть создан из отфильтрованных ряды. Контактная матрица является основой для всех дальнейших течению анализа, изучения TADs, петли и отсеков. Для первоначального анализа считывает последовательность, доступны несколько биоинформатики трубопроводов, позволяющие обработки сырья читает в контакт матрицы без много специализированных биоинформатики знаний18,19, 20,21,22,23. Как проводится дальнейший анализ во многом зависит от точных биологических вопрос изучается и может потребоваться значительный опыт в программировании и сценариев в R или Python. Тем не менее, некоторые инструменты и алгоритмы для вызова TADs являются доступны5,24,25,26,27,28, а также программное обеспечение для анализа и Исследуйте Hi-C данные в веб-браузере и как автономных настольных приложений29,30,,3132.

После обработки, качество библиотеки может быть определена с помощью разных метрик (рис. 2B). Во-первых стоимость ПЦР дубликатов, который является номером последовательного чтения пар, вытекающих из той же молекулы исходного, должна быть как низкий, как можно ограничить количество впустую последовательности чтения. Однако, даже библиотек с > 40% ПЦР дублирования могут быть обработаны в контактной карты высокого качества, если фильтруются дубликаты. Во-вторых скорость отфильтрованных читает из-за их ориентации, как описано в4, неизменно следует ниже, чем 10% соответствие чтения пар.

В процессе предварительного gastrular разработки дрозофилы между 12 и 14 ядерного цикла ядерных архитектура является резко перестроенный33 (рис. 3). В ядерного цикла 12 несколько TADs обнаруживаются и общее распределение контактов очень гладкой, без многих заметных особенностей. Это резко изменилось на ядерного цикла 13 и 14, когда TADs все более заметную и неспецифическим загрязнении контактов истощаются.

Figure 1
Рисунок 1: представитель фотографии eGFP-PCNA эмбрионов во время сортировки. (A) eGFP-PCNA сигнал от несортированные населения эмбрионов после 60 мин коллекции и 2 ч инкубации на 25 ° C (B-E) примеры эмбрионов из отсортированных населения на ядерного цикла 12 (B), ядерного цикла 13 (C), 14 (ядерного цикла D) и из эмбрионов, проходит синхронная митоз (E). Масштаб баров = 200 µm. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Примеры в situ Hi-C библиотека качества метрик. (A) Bioanalyzer следы, показывающий распределение размеров фрагмента ДНК от успешного Hi-C библиотека (1, топ) и библиотеки, которая отображает пик фрагментов, которые слишком велики для виртуализации (библиотека 2, снизу). Успешно был секвенирован библиотека 2, но даже большее количество нежелательных фрагментов ДНК может привести к виртуализации снижение урожайности. (B) фильтрация статистики двух Hi-C библиотек: отображается количество унифицированных чтения пар, которые исключены из дальнейшего анализа из-за чтения ориентация и расстояния (внутрь, наружу)4 или ПЦР дублирования (дубликат). В каждом баре строятся количество чтений, проходя фильтр (остальные) и отсутствии (отфильтрованные). Процент операций чтения, проходя фильтр дополнительно отображается как текст. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Привет-C взаимодействие карты от поставил эмбрионов. Привет-C взаимодействие карты сегментирования с разрешением 10 КБ и сбалансированной как описано до33. Показано это регион на хромосоме 2 л пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Библиотека Этап Количество эмбрионов Количество ДНК до сдвига (НГ) Циклов PCR Окончательный библиотека концентрация (Нм)
1 ядерного цикла 12 71 46 12 28.2
2 ядерного цикла 12 46 40 12 22.2
3 ядерного цикла 12 60 13 13 12.3
4 ядерного цикла 13 36 39 12 22.2
5 ядерного цикла 13 35 10 12 5.0
6 ядерного цикла 13 48 18 12 8.7
7 ядерного цикла 14 33 30 12 39,8
8 ядерного цикла 14 24 36 12 20.4
9 ядерного цикла 14 14 8 12 4.2
10 3-4 hpf 17 30 12 24.0
11 3-4 hpf 18 42 11 19,1
12 3-4 hpf 22 63 11 48,4

Таблица 1: Список представительных последовательности библиотечной статистики. Для каждой библиотеки в списке, количество эмбрионов, которые использовались для его поколения, количество всего ДНК до пулдаун биотина и стрижка, измеряется кубит, количество PCR циклов, используется для усиления и конечная концентрация последовательности библиотеки После очистки и выбор размера указаны.

Discussion

Протокол, представленные здесь очень эффективен при генерации карты высокого качества архитектуры хроматина в начале дрозофилы эмбрионов. По сравнению с ранее протокол34, описанный подход здесь использует современные в situ Hi-C процедуры5, быстрее обработки, высокое разрешение, и менее использование реагента. Ожидается, что общая процедура, включая протокол Hi-C в situ работать на широкий спектр этапов и экспериментальных систем помимо дрозофилы. Поскольку протокол имеет низкое требование ввода, он также может использоваться на изолированных клеточных популяций. У дрозофилыкогда с помощью протокола для эмбрионов за пределами диапазона описанных здесь, некоторые параметры, в частности фиксация материала, может потребоваться скорректировать. Поскольку старые эмбрионов разработать весьма непроницаемой для кутикулы, повышение концентрации формальдегида и продлевая фиксации может быть уместным. Для коллекции эмбрионов на этапах помимо ядерного цикла 14, время инкубации эмбрионов при 25 ° C в шаге 1.4 необходимо будет скорректировать следующим образом: ядерного цикла 12, 70 мин; ядерного цикла 13, 90 мин; 3 – 4 hpf, 3:30 ч.

В течение 13 расщепления дивизий (этап 1-4) плотность ядер примерно удваивается с каждым отделом. Ядра могут легко идентифицированы по их ярко GFP флуоресценции. Во время митоза eGFP-PCNA не расположен в ядре, и его сигнал рассредоточивались эмбриона. Эта особенность делает определение эмбрионов, которые осуществляют синхронное расщепления разделение возможно. Для изучения конформации хроматина, эти митотическая эмбрионов обычно не желательно, так как митотической организации хроматина резко отличается от Организации межфазной35. Это позволяет адаптировать протокол конкретно выбрать эмбрионов, переживает синхронной митотическая отдел. В этом случае должны храниться только эмбрионов с рассредоточенной, не обладающих ядерным распространением eGFP-PCNA, и все другие эмбрионы должны быть отброшены. Поскольку ядерная плотность не может определяться, должны быть использованы альтернативные методы для стадии эмбриона путем их морфологии, в передаваемых световой микроскопии. Наличие клеток полюса и ядер на периферии эмбриона указывают, что эмбрион было завершено по крайней мере ядерного цикла 9, тогда как видимый cellularization на периферии указывает ядерного цикла 1412.

Привет-C может быть успешно эксперименты с использованием широкий выбор энзимов ограничения5. Нынешние подходы обычно используют ферменты, которые признают либо 4-база последовательности, например Мбои, или признание 6-база сайта, например HindIII. Преимуществом базы 4 фрезы над 6-база фрезы является, что они предлагают больше потенциальных резолюции, учитывая достаточно последовательности глубины и более равномерное освещение места ограничения по всему геному. Существует нет явное преимущество в выборе одной базы 4 резак над еще5,23,,3637. Два наиболее часто используемых ферментов, Мбои и DpnII, оба признают тот же сайт признание GATC. DpnII менее чувствителен к метилирования CpG, которая не касается у дрозофилы. Протокола, представленные здесь может также быть успешно завершен с помощью DpnII как энзима ограничения. В разделе 4.2. энзима ограничения и буфера должны корректироваться для обеспечения DpnII совместимости, согласно рекомендациям изготовителя.

Если размер фрагмента последовательности библиотеки значительно отличается от диапазона, показано на рисунке 2А, формирования кластера во время виртуализации может быть менее эффективным или не полностью. В этом случае распределение размеров после сдвига должны быть проверены и стрижка параметры соответствующим образом скорректированы. Пики в распределении фрагментов ДНК очень маленьких (< 100 bp) или очень большие (> 1000 bp) размеры указывает проблемы с выбором размера, такие как нести над бусы или супернатанта, которые должны быть отброшены. Часто эти библиотеки с мелких пиков на этих нежелательных размеров, как один изображенные, являются по-прежнему успешно виртуализации с лишь незначительные снижением эффективности кластеризации.

Высокие темпы ПЦР дублирования следует избегать, поскольку это резко снижает количество операций чтения можно использовать последовательности. Скорость ПЦР дубликаты напрямую связана с количество исходного материала. Поэтому с помощью более ввода обычно облегчает проблемы с ПЦР дублирования.

Большее число чтений, отфильтрован чтения ориентация ()Рисунок 2B) свидетельствуют о недостаточной пищеварение, которая может быть результатом использования слишком мало фермента, слишком много материала или неполной гомогенизации эмбрионов.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Это исследование финансировалось Общество Макса Планка. C.B.H. была поддержана стипендии от международной Макс Planck исследований школы – молекулярной биологии. Мы благодарим Shelby Блайт и Эрик Wieschaus за любезно предоставление eGFP-PCNA Drosophila melanogaster линии.

Materials

Name Company Catalog Number Comments
Biotin-14-dATP Life Technologies 19524016
MboI New England Biolabs R0147L
DNA Polymerase I Klenow Fragment New England Biolabs M0210L
T4 DNA Ligase Thermo Fisher EL0012 T4 DNA Ligase Buffer included
T4 DNA Polymerase New England Biolabs M0203L
Proteinase K AppliChem A4392
GlycoBlue Life Technologies AM9516
Complete Ultra EDTA-free protease inhibitors Roche 5892791001
NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) New England Biolabs E7335 Sequencing Adaptor, Forward (unindexed) PCR primer and Reverse (indexed) PCR primer and USER enzyme used in the Library preparation section are components of this kit
NEBNext Ultra II DNA Library Prep Kit New England Biolabs E7645 End Prep Enzyme Mix, End Prep Reaction Buffer, Ligation Enhancer, Ligation Master Mix and Polymerase Master Mix used in the Library preparation section are components of this kit
Covaris S2 AFA System Covaris
DNA LoBind Tubes, 1.5 mL Eppendorf 0030108051
Falcon cell strainer 100 µm Corning 352360 Embryo collection baskets
37% formaldehyde VWR 437536C
Heptane AppliChem 122062.1612
M165 FC fluorescent stereo microscope Leica
M165 FC DFC camera Leica
Metal micro pestle Carl Roth P985.1 Used to lyse embryos in step 4.1.4
RNase A AppliChem A3832,0050
Dynabeads MyOne Streptavidin C1 Life Technologies 65002 Streptavidin coated magnetic beads
Ampure XP beads Beckman Coulter A63881
Qubit 3.0 Fluorometer Thermo Fisher Scientific Q33216
Qubit assay tubes Thermo Fisher Scientific Q32856
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Q32854
Phosphate buffered saline (PBS) Sigma-Aldrich P4417
eGFP-PCNA flies Gift from S. Blythe and E. Wieschaus
Sodium hypochlorite 13% Thermo Fisher AC219255000
Triton X-100 AppliChem A4975
Tris buffer pH 8.0 (1 M) for molecular biology AppliChem A4577
NaCl AppliChem A2942
IGEPAL CA-630 Sigma-Aldrich I8896
1.5 mL microcentrifuge tubes Greiner Bio-One 616201
SDS for molecular biology AppliChem A2263
10x CutSmart buffer New England Biolabs B7204S Restriction enzyme buffer
PCR Nucleotide Mix Sigma-Aldrich 11814362001 Unmodified dCTP, dGTP, dTTP
BSA, Molecular Biology Grade New England Biolabs B9000S
EDTA 0.5 M solution for molecular biology AppliChem A4892
Sodium acetate 3 M pH 5.2 Sigma-Aldrich S7899
DynaMag-2 Magnet Life Technologies 12321D Magnetic stand
Intelli-Mixer RM-2L Omnilab 5729802 Rotator
ThermoMixer F1.5 Eppendorf 5384000012 Mixer
Small Embryo Collection Cages Flystuff.com 59-100 Egg collection cage
Centrifuge 5424 R Eppendorf 5404000413
C1000 Touch Thermal Cycler Bio-Rad 1851148
PCR tube strips Greiner Bio-One 673275
NEBuffer 2.1 New England Biolabs B7202S T4 DNA Polymerase buffer

DOWNLOAD MATERIALS LIST

References

  1. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nat Rev Genet. 17, (11), 661-678 (2016).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, (5950), 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  4. Jin, F., et al. A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature. (2013).
  5. Rao, S. S. P., et al. A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping. Cell. 159, (7), 1665-1680 (2014).
  6. Darbellay, F., Duboule, D. Topological Domains, Metagenes, and the Emergence of Pleiotropic Regulations at Hox Loci. Current topics in developmental biology. 116, 299-314 (2016).
  7. Beagan, J. A., et al. Local Genome Topology Can Exhibit an Incompletely Rewired 3D-Folding State during Somatic Cell Reprogramming. Cell stem cell. 18, (5), 611-624 (2016).
  8. Andrey, G., et al. Characterization of hundreds of regulatory landscapes in developing limbs reveals two regimes of chromatin folding. Genome Res. 27, (2), 223-233 (2017).
  9. Krijger, P. H. L., de Laat, W. Regulation of disease-associated gene expression in the 3D genome. Nature Reviews. Molecular Cell Biology. 17, (12), 771-782 (2016).
  10. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148, (3), 458-472 (2012).
  11. Ghavi-Helm, Y., et al. Enhancer loops appear stable during development and are associated with paused polymerase. Nature. 512, (7512), 96-100 (2014).
  12. Foe, V. E., Alberts, B. M. Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J Cell Sci. 61, 31-70 (1983).
  13. Blythe, S. A., Wieschaus, E. F. Zygotic Genome Activation Triggers the DNA Replication Checkpoint at the Midblastula Transition. Cell. 160, (6), 1169-1181 (2015).
  14. Blythe, S. A., Wieschaus, E. F. Establishment and maintenance of heritable chromatin structure during early Drosophila embryogenesis. eLife. 5, e20148 (2016).
  15. JoVE Science Education Database. Embryo and Larva Harvesting and Preparation. Biology I: yeast, Drosophila and C. elegans. Drosophila melanogaster. JoVE, Cambridge, MA. (2017).
  16. Sicaeros, B., O'Dowd, D. K. Preparation of Neuronal Cultures from Midgastrula Stage Drosophila Embryos. Journal of Visualized Experiments. (5), (2007).
  17. Shermoen, A. W. Preparation of Baskets for Drosophila Egg Collections, Treatments, and Incubations. Cold Spring Harbor Protocols. (10), (2008).
  18. Ay, F., Noble, W. S. Analysis methods for studying the 3D architecture of the genome. Genome biology. 16, (1), 183 (2015).
  19. Lazaris, C., Kelly, S., Ntziachristos, P., Aifantis, I., Tsirigos, A. HiC-bench: comprehensive and reproducible Hi-C data analysis designed for parameter exploration and benchmarking. BMC Genomics. 18, (1), (2017).
  20. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biology. 16, (1), (2015).
  21. Durand, N. C., et al. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell systems. 3, (1), 95-98 (2016).
  22. Lajoie, B. R., Dekker, J., Kaplan, N. The Hitchhiker's guide to Hi-C analysis: Practical guidelines. Methods. 72, 65-75 (2015).
  23. Schmitt, A. D., Hu, M., Ren, B. Genome-wide mapping and analysis of chromosome architecture. Nature Reviews. Molecular Cell Biology. 17, (12), 743-755 (2016).
  24. Shin, H., et al. TopDom: an efficient and deterministic method for identifying topological domains in genomes. Nucleic Acids Res. 44, (7), e70 (2016).
  25. Kruse, K., Hug, C. B., Hernández-Rodríguez, B., Vaquerizas, J. M. TADtool: visual parameter identification for TAD-calling algorithms. Bioinformatics. 32, (20), 3190-3192 (2016).
  26. Lévy-Leduc, C., Delattre, M., Mary-Huard, T., Robin, S. Two-dimensional segmentation for analyzing Hi-C data. Bioinformatics. 30, (17), Oxford, England. i386-i392 (2014).
  27. Filippova, D., Patro, R., Duggal, G., Kingsford, C. Identification of alternative topological domains in chromatin. Algorithms for molecular biology: AMB. 9, (1), 14 (2014).
  28. Crane, E., et al. Condensin-driven remodelling of X chromosome topology during dosage compensation. Nature. 523, (7559), 240-244 (2015).
  29. Durand, N. C., et al. Juicebox Provides a Visualization System for Hi-C Contact Maps with Unlimited Zoom. Cell systems. 3, (1), 99-101 (2016).
  30. Zhou, X., et al. Exploring long-range genome interactions using the WashU Epigenome Browser. Nature Methods. 10, (5), 375-376 (2013).
  31. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. bioRxiv. 115063 (2017).
  32. Kerpedjiev, P., et al. HiGlass: Web-based Visual Comparison And Exploration Of Genome Interaction Maps. bioRxiv. 121889 (2017).
  33. Hug, C. B., Grimaldi, A. G., Kruse, K., Vaquerizas, J. M. Chromatin Architecture Emerges during Zygotic Genome Activation Independent of Transcription. Cell. 169, (2), (2017).
  34. Berkum, N. L., et al. Hi-C: a method to study the three-dimensional architecture of genomes. Journal of Visualized Experiments: JoVE. (39), (2010).
  35. Naumova, N., et al. Organization of the mitotic chromosome. Science. 342, (6161), 948-953 (2013).
  36. Denker, A., de Laat, W. The second decade of 3C technologies: detailed insights into nuclear organization. Genes & development. 30, (12), 1357-1382 (2016).
  37. Belaghzal, H., Dekker, J., Gibcus, J. H. Hi-C 2.0: An optimized Hi-C procedure for high-resolution genome-wide mapping of chromosome conformation. Methods (San Diego, Calif). 123, 56-65 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics