जीनोम की पीढ़ी चौड़ा क्रोमेटिन अनुरूप कब्जा पुस्तकालयों जल्दी Drosophila भ्रूण का मंचन

Genetics
 

Summary

इस कार्य में उच्च संकल्प की पीढ़ी के लिए एक प्रोटोकॉल का वर्णन है सीटू हाय-सी पुस्तकालयों से कसकर मंचन पूर्व gastrulation Drosophila melanogaster भ्रूण.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hug, C. B., Vaquerizas, J. M. Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos. J. Vis. Exp. (140), e57001, doi:10.3791/57001 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

क्रोमेटिन के तीन आयामी वास्तुकला की जांच जीन विनियमन के तंत्र में अमूल्य अंतर्दृष्टि प्रदान करता है । यहां, हम सीटू हाय में क्रोमेटिन अनुरूप कब्जा तकनीक प्रदर्शन के लिए एक प्रोटोकॉल का वर्णन Drosophila melanogaster भ्रूण आबादी मंचन पर सी । परिणाम में एक एकल प्रयोग में नाभिक में होने वाली सभी क्रोमेटिन बातचीत की मैपिंग की अनुमति देता है कि एक sequencing पुस्तकालय है. भ्रूण छंटाई मैंयुअल रूप से एक फ्लोरोसेंट स्टीरियो माइक्रोस्कोप और एक ट्रांसजेनिक मक्खी एक परमाणु मार्कर युक्त लाइन का उपयोग किया जाता है । इस तकनीक का प्रयोग, प्रत्येक परमाणु विभाजन चक्र से भ्रूण आबादी, और परिभाषित कोशिका चक्र की स्थिति के साथ, बहुत उच्च शुद्धता के साथ प्राप्त किया जा सकता है । प्रोटोकॉल भी gastrulation से परे पुराने भ्रूण तरह अनुकूलित किया जा सकता है । हल भ्रूण सीटू हाय-सी में के लिए आदानों के रूप में इस्तेमाल कर रहे हैं. sequencing लाइब्रेरी तैयारी सहित सभी प्रयोगों, पांच दिनों में पूरा किया जा सकता है । प्रोटोकॉल कम इनपुट आवश्यकताओं है और मज़बूती से इनपुट सामग्री के रूप में 20 blastoderm स्टेज भ्रूण का उपयोग कर काम करता है । अंतिम परिणाम अगली पीढ़ी sequencing के लिए एक अनुक्रमण पुस्तकालय है । अनुक्रमण के बाद, डेटा जीनोम में संसाधित किया जा सकता चौड़ा क्रोमेटिन संपर्क नक्शे कि उपलब्ध उपकरणों की एक विस्तृत श्रृंखला का उपयोग कर topologically डोमेन (बालक) संरचना, क्रोमेटिन छोरों, और क्रोमेटिन संबद्ध के बारे में जानकारी प्राप्त करने के लिए विश्लेषण किया जा सकता Drosophila विकास के दौरान कंपार्टमेंट आई ।

Introduction

क्रोमेटिन क्षेऽ कैप्चर (3 सी) नाभिक1में क्रोमेटिन की टोपोलॉजी का अध्ययन करने के लिए एक असाधारण उपयोगी विधि के रूप में उभरा है । 3 सी संस्करण उच्च सी एक प्रयोग2में नाभिक में होने वाले सभी क्रोमेटिन बातचीत के संपर्क आवृत्तियों को मापने की अनुमति देता है. Hi-C के अनुप्रयोग ने क्रोमेटिन संगठन के कई मूलभूत सिद्धांतों, जैसे TADs, डिब्बों और छोरों3,4,5की खोज और लक्षण वर्णन में एक महत्वपूर्ण भूमिका निभाई है ।

विकास संक्रमण और कोशिका विभेद के संदर्भ में क्रोमेटिन वास्तुकला का अध्ययन तेजी से इन प्रक्रियाओं के दौरान जीन विनियमन के तंत्र को जानने के लिए इस्तेमाल कर रहे हैं6,7,8, 9. महान ब्याज के मॉडल जीवों में से एक Drosophila melanogaster, जिसका विकास और जीनोम अच्छी तरह से विशेषता है । हालांकि, कुछ अध्ययनों कि Drosophila में क्रोमेटिन वास्तुकला की जांच के बाहर इन विट्रो ऊतक संस्कृति सेटिंग्स10,11आयोजित किया गया है । भ्रूण में 16 – 18 ज पद निषेचन, TADs और स्तनधारियों में इसी तरह की संरचनाओं की याद ताजा डिब्बों10, जो की भूमिका वे Drosophila भ्रूण के दौरान जीन विनियमन में खेल रहे है जो सवाल उठाती की पहचान की गई विकास. विशेष रूप से विकास के प्रारंभिक दौर में, gastrulation से पहले, ऐसे अध्ययन तकनीकी रूप से चुनौतीपूर्ण हैं । gastrulation से पहले, Drosophila भ्रूण 13 तुल्यकालिक परमाणु प्रभाग है कि 8 के एक अत्यंत तीव्र गति से आगे बढ़ना-12चक्र,13प्रति 60 मिनट से गुजरना । इस के अलावा, दृश्य सुविधाओं की कमी के विभिन्न चरणों भेद करने के लिए यह मुश्किल पर्याप्त मात्रा में कसकर मंचन भ्रूण सामग्री प्राप्त करने के लिए बनाते हैं ।

आदेश में एक प्रोटोकॉल है कि परमाणु चक्र के प्रस्ताव पर जल्दी Drosophila विकास में क्रोमेटिन वास्तुकला का अध्ययन करने की अनुमति देता है विकसित करने के लिए, हम दो मौजूदा तकनीक संयुक्त: सीटू में हाय-सी है, जो उच्च संकल्प की पीढ़ी की अनुमति देता है पूरे जीनोम संपर्क5नक्शे, और भ्रूण मचान एक ट्रांसजेनिक Drosophila लाइन का उपयोग कर एक eGFP-PCNA transgene13,14व्यक्त । यह transgene स्थानीयकरण के दौरान नाभिक को और syncytial blastoderm में बँटवारा के दौरान भर में फैलाता है । इस गुण का प्रयोग, यह संभव है आसानी से अपने परमाणु घनत्व और GFP संकेत के फैलाव से mitotic भ्रूण द्वारा विभिंन चरणों भेद ।

साथ में, इन तकनीकों के रूप में कुछ के रूप में 20 Drosophila भ्रूण से उच्च संकल्प में क्रोमेटिन के तीन आयामी संरचना का अध्ययन कर सकें । इस प्रोटोकॉल कटाई और छंटाई Drosophila भ्रूण के लिए निर्देश भी शामिल है एक परमाणु विभाजन चक्र से भ्रूण की आबादी प्राप्त करते हैं । इसका आगे वर्णन है कि प्राप्त भ्रूण को सीटू हाय-सी में परफॉर्म करने के लिए कैसे इस्तेमाल किया जाता है । अंतिम परिणाम एक न्यूक्लियोटाइड अगली पीढ़ी अनुक्रमण मशीनों पर अनुक्रमण के लिए उपयुक्त पुस्तकालय है । परिणामी अनुक्रमण पढ़ता है तो विस्तृत क्रोमेटिन सहभागिता मैप्स पूरे Drosophila जीनोम को कवर में संसाधित किया जा सकता है ।

Protocol

1. Drosophila भ्रूण संग्रह

नोट: एक समकक्ष भ्रूण संग्रह किया जा सकता है के रूप में पिछले15प्रकाशन में दिखाया गया है ।

  1. स्थानांतरण युवा eGFP-PCNA मक्खियों (< 1 सप्ताह पुरानी) के साथ अंडे संग्रह पिंजरों में खमीरित संग्रह प्लेटें16 (1% इथेनॉल, 1% एसिटिक एसिड, और 4% आगर) ।
  2. एक मशीन 25 डिग्री सेल्सियस पर सेट करने के लिए संग्रह पिंजरों हटो । 1 के लिए मशीन-2 अंडे संग्रह से पहले दिन अंडे काफी उपज में सुधार । संग्रह प्लेटें दिन में दो बार बदलें ।
  3. संग्रह कक्ष से 30-60 मिनट के अंतराल में भ्रूण युक्त प्लेट निकालें । छोटे अंतराल कम भ्रूण में परिणाम है, लेकिन विकास के चरणों के कडे वितरण । समानांतर में कई पिंजरों से इकट्ठा इतना है कि आदर्श रूप से > 200 अंडे हर 30-60 मिनट रखी हैं ।
  4. 25 डिग्री सेल्सियस पर प्लेटों की दुकान जब तक भ्रूण वांछित उंर तक पहुंचने । blastoderm स्टेज भ्रूण (परमाणु चक्र 14) के लिए, लगभग 2 एच के लिए मशीन ।
  5. मशीन के 2 ज के बाद, संग्रह की थाली के लिए एक धार बोतल से नल का पानी जोड़ें ताकि पूरी सतह पानी के साथ कवर किया जाता है । भ्रूण और एक नरम ब्रश का उपयोग कर खमीर निलंबित ।
  6. संग्रह की थाली से एक भ्रूण संग्रह टोकरी में resuspend भ्रूण डालो (वाणिज्यिक सेल उपभेदों १०० µm ताकना आकार या घर का बना बास्केट के साथ17 काम अच्छी तरह से), एक धार बोतल से अतिरिक्त नल का पानी जोड़ने, यदि आवश्यक हो । इस स्तर पर, सभी प्लेटों कि समानांतर में एकत्र किए गए से भ्रूण गठबंधन । pooled नमूना एक एकल बैच का प्रतिनिधित्व करता है ।
  7. सभी खमीर अवशेषों दूर धोया जाता है जब तक 30 एस के लिए एक धार बोतल से नल के पानी के साथ टोकरी धोने के द्वारा अच्छी तरह से भ्रूण धोने ।
  8. Dechorionate पानी में एक २.५% सोडियम हाइपोक्लोराइट समाधान में संग्रह टोकरी रखकर भ्रूण । घूमता द्वारा प्रकाश आंदोलन की चोरियों को हटाने की सुविधा । जारी रखें जब तक भ्रूण पर्याप्त hydrophobic ताकि वे समाधान की सतह पर नाव जब टोकरी बाहर उठाया है और फिर से जलमग्न है, जो ~ 1.75-2 मिनट ले जाना चाहिए रहे हैं ।
    चेतावनी: सोडियम हाइपोक्लोराइट संक्षारक है । उपयुक्त व्यक्तिगत सुरक्षात्मक उपकरण पहनें । < 10% सोडियम हाइपोक्लोराइट युक्त समाधानों को आमतौर पर सिंक में निपटारा किया जा सकता है, मेजबान संस्थान के विनियमों की जांच करना सुनिश्चित करें ।
  9. समाधान से टोकरी निकालें और ब्लीच गंध अब ध्यान देने योग्य नहीं है जब तक एक धार बोतल से नल के पानी के साथ अच्छी तरह से कुल्ला ।

2. भ्रूण निर्धारण

नोट: इष्टतम निर्धारण की स्थिति, मुख्य रूप से डिटर्जेंट की एकाग्रता, formaldehyde और निर्धारण की अवधि, भ्रूण के चरण फिट करने के लिए निर्धारित empirically होना चाहिए. syncytial blastoderm के आसपास के चरणों के लिए, ०.५% ट्राइटन X-१०० और जलीय चरण में १.८% formaldehyde के अंतिम एकाग्रता अच्छी तरह से काम करते हैं । भ्रूण चरण 9 से परे बाद के चरणों के लिए, इन मापदंडों के आगे अनुकूलन आवश्यक हो सकता है । निर्धारण और छंटाई के दौरान उपयोग किए गए सभी समाधानों को छेड़ने वाले अवरोधकों को शामिल करना चाहिए ।

  1. संग्रह टोकरी पलटना और यह एक 15 मिलीलीटर शंकु केंद्रापसारक ट्यूब पर जगह है । एक पाश्चर पिपेट वितरण पंजाबियों-टी (पंजाब, ०.५% ट्राइटन एक्स-१००) का उपयोग कर ट्यूब में टोकरी से फ्लश भ्रूण ।
  2. भ्रूण नीचे बसा दो और पंजाबियों के साथ 2 मिलीलीटर के लिए कुल मात्रा को समायोजित करें टी ।
  3. पानी में ३७% formaldehyde के 6 मिलीलीटर हेप् और १०० µ एल जोड़ें ।
    चेतावनी: हेप् और formaldehyde विषाक्त जब सांस या त्वचा से संपर्क के बाद कर रहे हैं । एक धुएं डाकू में उपयुक्त व्यक्तिगत सुरक्षात्मक उपकरण पहनते है और काम करते हैं । हेप् या formaldehyde युक्त अपशिष्ट को मेजबान संस्थान के विनियमों के अनुसार अलग से निपटारा किया जाना है ।
  4. formaldehyde के अलावा के बाद, एक 15 मिनट टाइमर शुरू और तेजी से ट्यूब ऊपर और हाथ से 1 मिनट के लिए नीचे हिला । जलीय और कार्बनिक चरण एक शैंपू के रूप में स्थिरता की तरह गठबंधन होगा ।
  5. formaldehyde के अलावा 10 मिनट तक एक rotatory मिक्सर पर आंदोलन ।
  6. ट्यूब के तल पर भ्रूण इकट्ठा करने के लिए कमरे के तापमान पर 1 मिनट के लिए ५०० x g पर केंद्रापसारक ।
  7. महाप्राण पूरी शैंपू की तरह तरल और इसे त्यागना, देखभाल के लिए कोई भ्रूण महाप्राण नहीं ले । शैंपू की तरह छोटे शेष मात्रा supernatant समस्याओं का कारण नहीं है ।
  8. formaldehyde के अलावा 15 मिनट, पंजाब के 5 मिलीलीटर में भ्रूण resuspend-१२५ mM glycine के साथ टी formaldehyde बुझाने के लिए । ऊपर और नीचे 1 मिनट के लिए झटकों से जोरदार मिश्रण ।
  9. 1 मिनट और महाप्राण supernatant के लिए कमरे के तापमान पर ५०० x g पर केंद्रापसारक ।
  10. इन्हें रिसस्पेंड करके भ्रूण को धोकर 5 मिलीलीटर बर्फ में ठंडा करने वाले पंजाबियों-टी. भ्रूण को बसा दो और महाप्राण सब supernatant ।
  11. चरण २.१० में धो दो बार दोहराएं ।
  12. छंटाई जब तक बर्फ पर भ्रूण रखो । आमतौर पर, यह एक अच्छा विचार है 3 इकट्ठा करने के लिए छंटाई के लिए आगे बढ़ने से पहले मक्खी भ्रूण के 4 बैचों । हालांकि, भ्रूण एक ही दिन हल किया जाना चाहिए । बर्फ पर या फ्रिज में विस्तारित भंडारण बदल भ्रूण आकृति विज्ञान की ओर जाता है ।

3. भ्रूण छंटाई

नोट: छंटाई किसी भी फ्लोरोसेंट स्टीरियो माइक्रोस्कोप पर किया जा सकता है 60 में एक GFP फिल्टर के साथ सुसज्जित-80X आवर्धन ।

  1. एक १,००० µ एल पिपेट का प्रयोग, एक छोटे गिलास छंटाई के लिए उपयुक्त पोत के लिए लगभग १०० भ्रूण के एक बैच हस्तांतरण, एक काले रंग के अधिमानतः, और यह बर्फ पर जगह है ।
  2. एक सुई या सिरिंज टिप का उपयोग कर एक अलग ढेर में वांछनीय भ्रूण धक्का द्वारा परमाणु घनत्व और कोशिका चक्र स्थिति (चित्रा 1) द्वारा भ्रूण क्रमबद्ध करें ।
    1. eGFP-PCNA (चित्रा 1E) के बिखरे हुए, गैर परमाणु वितरण के साथ सभी भ्रूण निकालें । इसके अलावा, भ्रूण है कि आंशिक रूप से एक गैर परमाणु GFP संकेत दिखाने हटा दिया जाना चाहिए ।
    2. छँटाई में सहायता करने के लिए, एक गाइड के रूप में चित्र 1 में चित्रों का उपयोग कर प्रत्येक बैच में परमाणु चक्र 12, 13, और 14 में संदर्भ भ्रूण के एक लाइन को इकट्ठा. संदर्भ भ्रूण में से एक के साथ एक अज्ञात चरण के भ्रूण मैच के लिए इस लाइन का प्रयोग करें ताकि उनके चरण निर्धारित करने के लिए ।
    3. संदर्भ भ्रूण के लिए विकासात्मक चरण को सत्यापित करने के लिए, इमेजिंग भ्रूण द्वारा परमाणु घनत्व को मापने और २,५०० µm2 के एक क्षेत्र में भ्रूण की सतह पर नाभिक की संख्या की गिनती इमेजिंग सॉफ्टवेयर है कि दूरी की जानकारी प्रदान करता है का उपयोग कर ।
      नोट: २,५०० µm2 के किसी क्षेत्र के लिए नाभिक की अपेक्षित संख्या 12 से 16 नाभिक परमाणु चक्र 12 पर है, और 20 से 30 नाभिक परमाणु चक्र 1313पर है ।
  3. एक बार सभी उचित मंच पर भ्रूण अलग कर रहे हैं, प्रलेखन और गुणवत्ता नियंत्रण के लिए भ्रूण की तस्वीरें ले लो । स्टीरियो माइक्रोस्कोप एक कैमरा मॉड्यूल के साथ ही सुसज्जित नहीं है, तो GFP फिल्टर के साथ किसी भी epifluorescence माइक्रोस्कोप इस्तेमाल किया जा सकता है.
  4. एक १,००० µ एल पिपेट का उपयोग कर वांछित भ्रूण ऊपर पिपेट, एक ताजा ट्यूब को हस्तांतरण, और बर्फ पर जगह है ।
  5. जारी रखें जब तक पर्याप्त भ्रूण की योजना बनाई प्रयोग के लिए हल कर रहे हैं । 9 स्टेज से पुराने भ्रूण के लिए, आम तौर पर 20 भ्रूण सीटू हाय-सी प्रयोग में एक के लिए पर्याप्त हैं । परमाणु चक्र में 12, ८० भ्रूण एक अच्छा प्रारंभिक बिंदु हैं । पहले चक्र में, भ्रूण की संख्या लगभग हर चक्र के लिए दोगुनी हो जाना चाहिए ।
  6. पूल और १.५ मिलीलीटर ट्यूबों में विभाजित भ्रूण इस तरह से है कि एक ट्यूब सीटू हाय-सी प्रयोग में एक एकल के लिए पर्याप्त भ्रूण शामिल हैं । यह कम डीएनए बाध्यकारी विशेषताओं के साथ ट्यूबों का उपयोग करने के लिए सलाह दी जाती है, क्योंकि एक ही ट्यूब पूरे प्रोटोकॉल और डीएनए के सोखना के लिए इस्तेमाल किया जाएगा कम डीएनए सांद्रता में महत्वपूर्ण नुकसान के लिए नेतृत्व कर सकते हैं ।
  7. स्पिन ट्यूब पर संक्षेप में १०० x जी कमरे के तापमान पर और supernatant निकालें । भ्रूण के रूप में ठंड के लिए संभव के रूप में शुष्क होना चाहिए ।
  8. फ्लैश तरल नाइट्रोजन में ट्यूबों को विलय और दुकान पर-८० ° c द्वारा भ्रूण फ्रीज ।

4. सीटू में हाय-सी

  1. Lysis
    1. बर्फ पर जमे हुए भ्रूण के साथ ट्यूबों प्लेस ।
    2. ५०० बर्फ के µ एल में भ्रूण resuspend-शीत lysis बफर (10 मिमी Tris-सीएल पीएच ८.०, 10 मिमी NaCl, ०.२% IGEPAL सीए-६३०, चिढ़ाने अवरोधकों; पानी में घुल) । तो 1 मिनट रुको भ्रूण ट्यूब के नीचे बसा देना ।
    3. एक धातु माइक्रो खल का उपयोग कर भ्रूण पीस, बर्फ पर पूर्व ठंडा, कि कसकर एक १.५ मिलीलीटर microcentrifuge ट्यूब फिट करने के लिए डिज़ाइन किया गया है ।
      1. भ्रूण को उत्तेजित करने से बचने के लिए, मूसल को धीरे से तब तक डालें जब तक कि यह ट्यूब के नीचे न छू ले, नीचे धकेलें, और फिर दोनों दिशाओं में दो बार मूसल को घुमाकर पीस लें.
      2. मूसल को बहुत थोड़ा उठा लें, फिर से ट्यूब के नीचे धकेलें, और फिर पीस कर दोहराएं ।
      3. दोहराएं 4.1.3.2 10 बार, या जब तक भ्रूण पूरी तरह से लीजड ड हैं । समाधान समरूप होना चाहिए, और भ्रूण के कोई अवशिष्ट बड़े टुकड़े रहना चाहिए ।
    4. 15 min. स्पिन के लिए बर्फ पर homogenized निलंबन की मशीन १,००० x g, 5 मिनट के लिए 4 ° c, और supernatant त्यागें ।
    5. ५०० µ एल बर्फ ठंडा lysis बफर में resuspend द्वारा धो गोली, ऊपर और नीचे pipetting ।
    6. 4.1.4 में के रूप में फिर से स्पिन, और supernatant त्यागें ।
    7. ०.५% सोडियम dodecyl सल्फेट (एसडीएस) के १०० µ एल में धोया गोली resuspend, ऊपर और नीचे pipetting । Permeabilize एक हीटिंग ब्लॉक में ६५ डिग्री सेल्सियस पर 10 मिनट के लिए मशीन द्वारा नाभिक । 10% ट्राइटन X-१०० और १२० µ l पानी के ५० µ l को जोड़कर बुझा एसडीएस । ट्यूब को फ्लिक करके मिक्स कर लें.
    8. गर्मी ब्लॉक में 15 मिनट के लिए ३७ ° c पर मशीन ।
  2. प्रतिबंध एंजाइम पाचन
    1. 10x प्रतिबंध एंजाइम बफर के 25 µ एल जोड़ें और 20 यू के 5 यू/µ एल MboI । ट्यूब को फ्लिक करके मिक्स कर लें.
    2. थोड़ा सा आंदोलन (७५० rpm) के तहत हीट ब्लॉक में ३७ डिग्री सेल्सियस पर ९० मिनट के लिए मशीन द्वारा पचा डीएनए ।
    3. MboI के एक और 20 यू जोड़ें और ९० मिनट के लिए जारी रखने की मशीन ।
    4. 20 मिनट के लिए ६२ ° c पर मशीन द्वारा हीट MboI निष्क्रिय ।
  3. बदस्तूर भरण-में
    नोट: biotinylated dATP के साथ बदस्तूर में भरने विशिष्ट ligated टुकड़े के चयन की अनुमति देता है । बंधाव जंक्शनों पर बायोटिन-dATP टी-4 डीएनए पोलीमरेज़ (धारा ४.६) की exonuclease गतिविधि से सुरक्षित है, जबकि dATP कुंद सिरों पर बायोटिन-unligated कुशलता से हटा दिया जाता है । pulldown धारा ४.७ में streptavidin लेपित मोतियों का प्रयोग इसलिए विशेष रूप से ligated, chimeric डीएनए टुकड़े के लिए समृद्ध ।
    1. ०.४ mm बायोटिन की 18 µ l जोड़ें-14-dATP, २.२५ µ l की एक अनसंशोधित dCTP/dGTP/dTTP मिश्रण (३.३ mM प्रत्येक), और 8 µ l की 5 U/µ l डीएनए पोलीमरेज़ I Klenow अंश.
    2. हीट ब्लॉक में ९० मिनट के लिए ट्यूब और ३७ ° c पर मशीन फ़्लिक करके मिक्स ।
  4. बंधाव
    1. जोड़ें ६५७ µ एल पानी की, १२० µ एल के 10x टी-4 डीएनए Ligase बफर, १०० µ एल के 10% ट्राइटन एक्स-१००, 6 µ एल के 20 मिलीग्राम/एमएल गोजातीय सीरम एल्ब्युमिन (BSA), और ट्यूब झाड़ने से मिश्रण. अंत में 5 µ एल के 5 यू/µ एल टी-4 डीएनए Ligase और मिश्रण ट्यूब झाड़ द्वारा जोड़ें ।
    2. 2 एच के लिए कमरे के तापमान पर धीरे ट्यूब (20 rpm) घुमाएँ ।
    3. 5 U/µ एल टी-4 डीएनए Ligase के 5 µ एल की दूसरी किस्त जोड़ें और 2 अधिक एच के लिए घूर्णन जारी है ।
    4. 5 मिनट के लिए २,५०० x g पर नाभिक नीचे स्पिन और supernatant त्यागें ।
  5. डीएनए निष्कर्षण
    1. निष्कर्षण बफर के ५०० µ एल में गोली resuspend (५० mM Tris-सीएल पीएच ८.०, ५० मिमी NaCl, 1 मिमी Ethylenediaminetetraacetic एसिड (EDTA), 1% एसडीएस; पानी में घुल) और 20 µ के एल जोड़ने के २० मिलीग्राम/मिलीलीटर proteinase K. ट्यूब को झाड़ कर मिक्स कर लें.
    2. 30 मिनट के लिए ५५ ° c पर मशीन द्वारा पचाने में प्रोटीन, १,००० rpm पर मिलाते हुए ।
    3. de-crosslink, 5 एम NaCl के १३० µ एल जोड़ने और ६८ डिग्री सेल्सियस पर रात भर गर्मी, १,००० rpm में मिलाते हुए ।
    4. एक नया 2 मिलीलीटर ट्यूब में पिपेट नमूना, तरजीही कम डीएनए बाध्यकारी विशेषताओं के साथ ।
    5. इसमें 0.1 x वॉल्यूम (६३ µ l) 3 एम सोडियम एसीटेट पीएच ५.२ और 2 µ l की 15 मिलीग्राम/एमएल GlycoBlue के जोड़ें । पलटने से अच्छी तरह मिलाएं । औंधा करके शुद्ध निरपेक्ष इथेनॉल और मिश्रण के 1.6 x वॉल्यूम (१,००८ µ l) जोड़ें ।
    6. पर मशीन-८० ° c के लिए 15 min. केंद्रापसारक पर २०,००० x g पर 4 ° c कम से कम 30 मिनट के लिए । डीएनए गोली अक्सर बहुत छोटा है, लगभग अदृश्य, और केवल GlycoBlue के नीले रंग के कारण देखा जा सकता है ।
    7. supernatant बहुत ध्यान से निकालें, जहां डीएनए गोली स्थित है से विपरीत दीवार के साथ ट्यूब में पिपेट टिप चलती । छोटे शेष बूंदों अक्सर आसानी से इस कदम के दौरान हटा रहे है और उंहें एक P10 टिप का उपयोग कर के बजाय उंहें बाहर pipetting ट्यूबों के बाहर धक्का द्वारा निंनलिखित बहाकर ।
    8. ७०% इथेनॉल के ८०० µ एल जोड़कर गोली धो लें । पलटने से मिश्रण और 5 मिनट के लिए कमरे के तापमान पर २०,००० x g पर केंद्रापसारक । इस वॉश को कम से एक बार दोहराएं ।
    9. इथेनॉल के सभी निशान निकालें और हवा के लिए 5 मिनट के लिए खुला ढक्कन के साथ खड़े ट्यूब छोड़ शुष्क । एक बार कोई तरल शेष है, 10 मिमी Tris-सीएल पीएच ८.० के ५० µ एल जोड़ें । बार पिपेट ट्यूब की दीवार पर क्षेत्र पर समाधान जहां गोली डीएनए solubilize करने के लिए स्थित था ।
    10. जोड़ें 1 µ एल के 20 मिलीग्राम/एमएल RNase एक, ट्यूब झाड़ने से मिश्रण, और 15 मिनट के लिए ३७ ° c में मशीन बनाना आरएनए पचाने के लिए । नमूना अब रात भर फ्रिज में संग्रहीत किया जा सकता है या-20 डिग्री सेल्सियस अनिश्चित काल तक जमे हुए ।
    11. डीएनए की एकाग्रता की जांच करें एक फ्लोरोसेंट डाई आधारित परख का उपयोग कर निर्माता के निर्देशों के अनुसार । नमूने में डीएनए की कुल राशि कम से कम 10 एनजी होना चाहिए, अंयथा बहुत कम सामग्री प्रवर्धन और पुस्तकालय जटिलता के लिए उपलब्ध है कम होने की संभावना होगी । जब ऐसा होता है, सामग्री शुरू की राशि शायद पर्याप्त नहीं था, या सामग्री जिस तरह से साथ खो गया था, शायद lysis और वर्षा के दौरान ।
  6. बायोटिन हटाने और डीएनए कतरनी
    1. एक साथ जोड़ें 10x टी-4 डीएनए पोलीमरेज़ बफर के 12 µ एल, 1 मिमी dATP के 3 µ एल, 3 µ एल के 1 मिमी dGTP, और पानी की ४६ µ एल. ट्यूब को फ्लिक करके मिक्स कर लें. 3 U/एमएल टी-4 डीएनए पोलीमरेज़ के 5 µ एल जोड़ें, ट्यूब और 30 मिनट के लिए 20 डिग्री सेल्सियस पर मशीन झाड़ू से मिश्रण ।
    2. प्रतिक्रिया को रोकने के लिए ०.५ मीटर EDTA के 3 µ एल जोड़ें, और लगभग १२० µ एल की एक मात्रा में नमूना लाने के लिए पानी का उपयोग करें ।
    3. 200-400 बीपी के एक आकार के लिए डीएनए कतरनी निर्माता के निर्देशों के अनुसार एक sonication डिवाइस का उपयोग कर । सामग्री की तालिकामें वर्णित sonicator का प्रयोग, निंनलिखित कार्यक्रम उचित है: 2 ५० एस के प्रत्येक चक्र, 10% शुल्क, तीव्रता 5, २०० चक्र/
  7. बायोटिन pulldown
    1. पिपेट 30 µ एल के 10 मिलीग्राम/एमएल streptavidin एक नई ट्यूब में लेपित चुंबकीय मोती, उंहें एक चुंबकीय स्टैंड पर अलग है, और supernatant त्यागें ।
    2. 1x B & W बफर में मोती resuspend (5 mm Tris-सीएल पीएच ७.४, ०.५ mm EDTA, 1 M NaCl; पानी में भंग) + ०.१% ट्राइटन एक्स-१०० और भंवर द्वारा मिश्रण । एक चुंबकीय स्टैंड पर ट्यूब प्लेस और 1 के लिए प्रतीक्षा-5 मिनट तक मोती अलग कर रहे हैं, बनाओ और मॉडल पर निर्भर करता है ।
    3. महाप्राण और त्यागें supernatant जबकि मनका स्थित है जहां के विपरीत दीवार के साथ पिपेट टिप फिसलने । 2x बी और डब्ल्यू बफर के १२० µ एल में मोती resuspend (10 मिमी Tris-सीएल पीएच ७.४, 1 मिमी EDTA, और 2 एम NaCl) । भंवर द्वारा मिक्स ।
    4. स्थानांतरण एक नया कम डीएनए बंधन ट्यूब के लिए कतरनी डीएनए, और १२० 2x B और डब्ल्यू में मनका निलंबन के µ एल के साथ मिश्रण से भंवर । 15 मिनट के लिए 20 rpm पर डीएनए नमूने के साथ मोती घुमाएँ ।
    5. एक चुंबकीय खड़े पर अलग मोतियों और supernatant त्यागें ।
    6. 1x बी और डब्ल्यू के ६०० µ एल में मोती resuspend + ०.१% ट्राइटन एक्स-१००, और 2 मिनट के लिए ५५ ° c पर मशीन, १,००० rpm में मिलाते हुए । जुदाई के बाद, supernatant त्यागें । इस धोने को एक बार दोहराएं ।
    7. 10 मिमी Tris-सीएल पीएच ८.० के ६०० µ एल के साथ एक बार मोती धोने, और जुदाई के बाद supernatant त्यागें ।
    8. 10 मिमी Tris-सीएल पीएच ८.० के ५० µ एल में मोतियों resuspend ।

5. अनुक्रमण पुस्तकालय की तैयारी

नोट: सभी पुस्तकालय कदम एक वाणिज्यिक डीएनए पुस्तकालय तैयारी किट से घटकों का उपयोग किया जाता है ( सामग्री की तालिकादेखें) । हालांकि, वैकल्पिक किट या अंय एजेंट प्रतिस्थापित किया जा सकता है । वर्षा फ्रीजर भंडारण के दौरान पुस्तकालय तैयारी एजेंटों में फार्म के लिए जाता है । यह सुनिश्चित करने के लिए इसलिए महत्वपूर्ण है कि सभी वर्षा रिएजेंट का उपयोग करने से पहले भंग कर दिया है ।

  1. अंत मरंमत
    1. एक नई पीसीआर ट्यूब में 10 मिमी Tris-सीएल पीएच ८.० के ५० µ एल में मनका निलंबन स्थानांतरण ।
    2. अंत तैयारी एंजाइम मिश्रण और अंत प्रस्तुत करने की प्रतिक्रिया बफर के 7 µ एल के 3 µ एल जोड़ें । ऊपर और नीचे pipetting द्वारा मिक्स ।
    3. एक थर्मल साइकिल चालक को ट्यूब स्थानांतरण और निंनलिखित कार्यक्रम चलाने: 30 मिनट के लिए 20 डिग्री सेल्सियस, 30 मिनट के लिए ६५ डिग्री सेल्सियस, और 4 डिग्री सेल्सियस पर पकड़ ।
  2. एडेप्टर बंधाव
    1. बंधाव मास्टर मिक्स के 30 µ एल जोड़ें, १.५ µ मीटर अनुक्रमण अनुकूलक के २.५ µ एल (स्टॉक से १.५ µ मीटर करने के लिए पतला), और मनका निलंबन करने के लिए µ बढ़ाने के 1 बंधाव एल । ऊपर और नीचे pipetting द्वारा मिक्स ।
    2. एक थर्मल साइकिल चालक में 15 मिनट के लिए 20 डिग्री सेल्सियस पर मशीन ।
    3. उपयोगकर्ता एंजाइम के 3 µ एल जोड़ें । ऊपर और नीचे pipetting द्वारा मिक्स ।
    4. एक थर्मल साइकिल चालक में 15 मिनट के लिए ३७ ° c पर मशीन ।
    5. एक चुंबकीय स्टैंड पर अलग मोतियों और supernatant हटा दें ।
    6. मोती धोने के लिए, १०० µ एल 1x बी और डब्ल्यू बफर + ०.१% ट्राइटन एक्स-१०० में मोती resuspend । भंवर से मिश्रण है, और एक नया microcentrifuge ट्यूब को हस्तांतरण । एक चुंबकीय स्टैंड पर अलग मोतियों और supernatant हटा दें ।
    7. एक ही बफर के ६०० µ एल का उपयोग कर एक बार इस धोने दोहराएँ.
    8. 10 मिमी Tris के ६०० µ एल में मोतियों resuspend-सीएल पीएच ८.०, भंवर से मिश्रण, और एक नई ट्यूब के लिए मोतियों का हस्तांतरण ।
    9. एक चुंबकीय स्टैंड पर अलग मोतियों, supernatant त्यागें, और ५० µ एल में 10 मिमी Tris-सीएल पीएच ८.० के मोतियों को पुनः स्थगित ।
  3. पीसीआर प्रवर्धन
    1. दो पीसीआर ट्यूबों तैयार है और प्रत्येक में, पोलीमरेज़ मास्टर मिक्स के 25 µ एल मिक्स, १.५ µ एल के 10 µ मीटर आगे (अनइंडेक्स्ड) पीसीआर प्राइमर, और १.५ µ एल के 10 µ मीटर रिवर्स (अनुक्रमित) पीसीआर प्राइमर ।
      नोट: आगे (अनइंडेक्स्ड) पीसीआर प्राइमर:
      5 '-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC * टी-3 ´.
      रिवर्स (अनुक्रमित) पीसीआर प्राइमर:
      5 '-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC * टी-3 ´. * अनुक्रमित पीसीआर प्राइमर में phosphorothioate बांड और एनएस इंगित करता है ।
    2. प्रत्येक ट्यूब में, मनका निलंबन के 22 µ एल जोड़ें और ऊपर और नीचे pipetting द्वारा मिश्रण ।
    3. पीसीआर चलाने के लिए निंनलिखित प्रोग्राम का उपयोग: ९८ ° c 1 मिनट के लिए, (९८ ° c 15 s, ६५ ° c के लिए ७५ s, रैंप १.५ ° c/दोहराया 9-12 बार, ६५ ° c 5 मिनट के लिए, और 4 डिग्री सेल्सियस पर पकड़ो ।
      नोट: प्रवर्धन चक्र की संख्या empirically निर्धारित किया जाना है । हालांकि, हमने पाया है कि पुस्तकालयों है कि अधिक से अधिक 12 चक्र की आवश्यकता आम तौर पर कम जटिलता के थे और उच्च गुणवत्ता में परिणाम नहीं हाय-सी नक्शे । दूसरी ओर, पुस्तकालयों है कि कम 12 चक्रों की आवश्यकता है नकारात्मक एक पूर्ण 12 चक्र के लिए बढ़ाना से प्रभावित नहीं थे । इसलिए, यह प्रवर्धन के 12 चक्र के लिए डिफ़ॉल्ट करने के लिए संभव है.
    4. एक एकल microcentrifuge ट्यूब में दो पीसीआर प्रतिक्रियाओं पूल, एक चुंबकीय स्टैंड पर अलग मोतियों, और एक नई ट्यूब के लिए पुस्तकालय युक्त supernatant हस्तांतरण ।
  4. आकार चयन
    1. कमरे के तापमान और मिश्रण अच्छी तरह से मिलाने के लिए Ampure XP मनका निलंबन लाओ ।
    2. पानी के साथ बिल्कुल २०० µ l के लिए परित पीसीआर प्रतिक्रिया की मात्रा लाओ । पीसीआर और चुंबकीय जुदाई के दौरान, मूल मात्रा के कुछ आमतौर पर खो दिया है । पिपेट के लिए २०० µ l को सेट करके वॉल्यूम की जांच करें और प्रतिक्रिया का संपूर्ण वॉल्यूम महाप्राण । अगर हवा aspirated है, तो और अधिक पानी की जरूरत है जोड़ने के लिए । यदि मात्रा २०० µ l से अधिक है, तो 5.4.3 और 5.4.6 आनुपातिक चरणों में जोड़े गए मोतियों की मात्रा को समायोजित करें ।
      नोट: कोष्ठकों में वॉल्यूम मान्य है यदि pooled पीसीआर प्रतिक्रियाओं का कुल वॉल्यूम ठीक २०० µ l.
    3. Ampure XP मनका सस्पेंशन का 0.55 x वॉल्यूम (११० µ l) जोड़ें और pipetting ऊपर और नीचे से 10 गुना कम करके मिलाएं ।
    4. 5 मिनट, 5 मिनट के लिए एक चुंबकीय स्टैंड पर अलग मोतियों के लिए कमरे के तापमान पर मशीन ।
    5. एक नई ट्यूब के लिए supernatant ले जाएं । मोती युक्त ट्यूब त्यागें । मोती डीएनए > 700 बीपी, जो बहुत बड़ा है अनुक्रम होना है ।
    6. supernatant करने के लिए, 0.2 x वॉल्यूम जोड़ें (४० µ l, नमूने में 0.75 x Ampure बफ़र की कुल में जिसके परिणामस्वरूप) Ampure XP मनका निलंबन और मिश्रण के द्वारा pipetting ऊपर और नीचे 10 बार.
    7. 5 मिनट, 5 मिनट के लिए एक चुंबकीय स्टैंड पर अलग मोतियों के लिए कमरे के तापमान पर मशीन ।
    8. supernatant छोड़ें जिसमें डीएनए < 200 bp शामिल है, जिसमें नि: शुल्क प्राइमरी, प्राइमरी dimers, और टुकड़ों को अनुक्रम किया जाना बहुत छोटा होता है ।
    9. चुंबकीय स्टैंड पर ट्यूब छोड़ दें । मोती धोने के लिए, ८०% इथेनॉल के ७०० µ एल जोड़ने के लिए, देखभाल के लिए मनका गोली परेशान नहीं ले, और 30 एस के लिए मशीन ।
    10. supernatant त्यागें, तो चुंबकीय स्टैंड से ट्यूब ले और 10 मिमी Tris के १०० µ एल में मोतियों resuspend-सीएल पीएच ८.० । 10 बार ऊपर और नीचे pipetting द्वारा मिक्स, और 1 मिनट के लिए कमरे के तापमान पर गर्मी ।
    11. Ampure XP मनका निलंबन के 0.8 x खंड (८० µ l) जोड़ें । pipetting ऊपर और नीचे 10 बार और 5 मिनट के लिए कमरे के तापमान पर गर्मी से मिश्रण । लोअर बाउंड आकार चयन का यह दूसरा दौर यह सुनिश्चित करता है कि अंतिम पुस्तकालय प्राइमरी और प्राइमरी dimers से पूरी तरह मुक्त है ।
    12. 5 मिनट के लिए एक चुंबकीय खड़े पर अलग मोतियों और supernatant त्यागें ।
    13. ७०० µ एल के साथ दो बार मनका गोली धो 30 के लिए ८०% इथेनॉल के प्रत्येक एस, जबकि चुंबकीय स्टैंड पर ट्यूब छोड़ने के ऊपर के रूप में ।
    14. अब भी चुंबकीय स्टैंड पर ट्यूब के साथ, इथेनॉल के सभी निशान हटा दें । यह एक P10 पिपेट का उपयोग कर ट्यूब से बाहर इथेनॉल की बूंदों को पुश करने में मदद करता है । अवशिष्ट इथेनॉल 5 मिनट की एक अधिकतम के लिए लुप्त होने दो ।
    15. चुंबकीय स्टैंड से ट्यूब ले लो और 10 मिमी Tris-सीएल पीएच ८.० के ५० µ एल में मोतियों resuspend । ऊपर और नीचे 10 बार pipetting द्वारा मिश्रण ।
    16. 5 मिनट के लिए कमरे के तापमान पर मशीन, तो एक चुंबकीय स्टैंड पर अलग मोतियों ।
    17. एक ताजा ट्यूब करने के लिए supernatant स्थानांतरण । यह निर्माता के निर्देशों के अनुसार, quantified और अगली पीढ़ी sequencing मशीनों पर अनुक्रम किया जा करने के लिए तैयार है, अंतिम उच्च सी पुस्तकालय है.

Representative Results

हल परमाणु चक्र 12, 13, और 14 में भ्रूण आबादी (इसी 1:30, 1:45, और 2:10 घंटे के बाद निषेचन, क्रमशः12) और 3-4 एच पोस्ट निषेचन (hpf) प्रोटोकॉल में वर्णित प्रक्रियाओं के अनुसार प्राप्त किए गए । प्रत्येक हल भ्रूण बैच के eGFP-PCNA संकेत की तस्वीरें लेने के द्वारा, यह बहाव प्रयोगों में इस्तेमाल किया जाता है कि हर एक भ्रूण के सटीक चरण और कोशिका चक्र स्थिति दस्तावेज़ के लिए संभव है. क्रमबद्ध आबादी से भ्रूण के उदाहरण चित्रों चित्र 1b-Eमें दिखाए जाते हैं । सीटू हाई-सी प्रोटोकॉल में का आउटपुट एक न्यूक्लियोटाइड पुस्तकालय अगली पीढ़ी sequencing मशीनों पर अनुक्रम किया जा करने के लिए तैयार है । इस प्रयोजन के लिए, एक अंतिम पुस्तकालय एकाग्रता में कम से 2-4 एनएम आमतौर पर आवश्यक है । इनपुट सामग्री की सिफारिश की मात्रा का उपयोग करना, इस एकाग्रता मज़बूती से हासिल की है (तालिका 1).

आकार चयन के बाद डीएनए टुकड़े की उंमीद आकार वितरण 300 के बीच है-600 बीपी, लगभग ५०० बीपी (चित्रा 2a)पर एक अधिकतम के साथ, सटीक बाल काटना और आकार चयन मापदंडों पर निर्भर करता है । sequencing के लिए, हम अनुशंसा करते हैं मीन्स-end के जीनोम में अनमैपर प्रतिबंध अंशों की संख्या को कम करने के लिए कम से ७५ bp लंबाई की पढ़ता है । 1 – 2 kb बिन आकार के साथ उच्च-रिज़ॉल्यूशन मानचित्र ४००,०००,००० पढ़ता से प्राप्त किया जा सकता है । हम अनुशंसा करते हैं sequencing एकाधिक जैविक प्रतिकृति के एक कम गहराई पर ~ १५०,०००,००० पढ़ता प्रत्येक, के बजाय एक एकल प्रतिकृति बहुत उच्च गहराई पर अनुक्रमण । यह जैविक भिन्नता के आकलन की अनुमति देता है और पीसीआर दोहराव के कारण खारिज कर दिया की एक कम संख्या की ओर जाता है. दृश्य प्रतिनिधित्व के लिए, प्रतिकृति संयोजित किया जा सकता है । उच्च गहराई पर एक नमूना sequencing करने से पहले, हम के रूप में चित्रा बीमें बुनियादी पुस्तकालय गुणवत्ता मानकों का निर्धारण करने के लिए उथले अनुक्रमण (नमूना प्रति कुछ लाख पढ़ता है) का उपयोग कर नमूने चल सिफारिश.

Hi-C डेटा के विश्लेषण में महत्वपूर्ण गणनात्मक संसाधनों और bioinformatics विशेषज्ञता की आवश्यकता होती है । किसी न किसी सिंहावलोकन के रूप में, युग्मित पढ़ता संदर्भ जीनोम के लिए स्वतंत्र रूप से मैप कर रहे हैं, जिसके परिणामस्वरूप संरेखण गुणवत्ता और अभिविन्यास के लिए फ़िल्टर कर रहे हैं, तो एक दिया बिन संकल्प या टुकड़ा स्तर पर संपर्कों की एक मैट्रिक्स से उत्पन्न किया जा सकता है फ़िल्टर प्रियपात्र. संपर्क मैट्रिक्स सभी आगे बहाव TADs, छोरों, और डिब्बों की खोज विश्लेषण के लिए आधार है । के प्रारंभिक विश्लेषण के लिए sequencing पढ़ता, कई bioinformatics पाइपलाइन उपलब्ध है जो raw पढ़ता के संसाधन से संपर्क मैट्रिक्स में बहुत विशिष्ट bioinformatics ज्ञान के बिना सक्षम करें18,19, 20,21,22,23. कैसे आगे विश्लेषण किया जाता है मोटे तौर पर अध्ययन के तहत सटीक जैविक प्रश्न पर निर्भर करता है और प्रोग्रामिंग में महत्वपूर्ण अनुभव और आर या पायथन में पटकथा की आवश्यकता हो सकती है । हालांकि, कई उपकरण और एल्गोरिदम TADs कॉल करने के लिए उपलब्ध हैं5,24,25,26,27,28, साथ ही सॉफ्टवेयर का विश्लेषण करने के लिए और वेब ब्राउज़र में और स्टैंड-अलोन डेस्कटॉप अनुप्रयोगों के रूप में उच्च-C डेटा का अन्वेषण करें29,30,31,३२.

एक बार संसाधित, पुस्तकालय की गुणवत्ता के विभिंन मैट्रिक्स (चित्रा बी) का उपयोग कर निर्धारित किया जा सकता है । सबसे पहले, पीसीआर डुप्लिकेट की दर है, जो एक ही मूल अणु से उत्पंन अनुक्रम पढ़ें जोड़े की संख्या है, के रूप में संभव के रूप में व्यर्थ अनुक्रम की मात्रा की सीमा के रूप में कम होना चाहिए पढ़ता है । डुप्लिकेट फ़िल्टर कर रहे हैं, तो हालांकि, > 40% पीसीआर दोहराव के साथ भी पुस्तकालयों उच्च गुणवत्ता वाले संपर्क नक्शे में संसाधित किया जा सकता है । दूसरा, फ़िल्टर की दर उनके अभिविंयास के कारण पढ़ता है, के रूप में4में वर्णित है, लगातार संरेखित पढ़ें जोड़े के 10% से कम होना चाहिए ।

परमाणु चक्र के बीच Drosophila के पूर्व gastrular विकास के दौरान 12 और 14, परमाणु वास्तुकला काफी३३ remodeled है (चित्रा 3) । परमाणु चक्र में 12, कुछ TADs का पता चला रहे हैं, और संपर्कों के समग्र वितरण कई समझदार सुविधाओं के बिना बहुत चिकनी है । यह नाटकीय रूप से परमाणु चक्र 13 और 14 में बदल गया है, जब TADs तेजी से प्रमुख है और विशिष्ट लंबी दूरी के संपर्क समाप्त हो रहे हैं ।

Figure 1
चित्रा 1: eGFP के प्रतिनिधि तस्वीरें-PCNA छंटाई के दौरान भ्रूण । () eGFP-PCNA के बाद भ्रूण का एक अनसुलझा जनसंख्या से संकेत ६० मिनट और 25 डिग्री सेल्सियस (बी ई) में 2 ज की मशीन के बाद एक हल आबादी से परमाणु चक्र 12 में भ्रूण के उदाहरण (ख), परमाणु चक्र 13 (), परमाणु चक्र 14 ( ), और से तुल्यकालिक बँटवारा () के दौर से गुजर भ्रूण । स्केल बार्स = २०० µm. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

Figure 2
चित्रा 2: सीटू हाय-सी पुस्तकालय गुणवत्ता मैट्रिक्स में के उदाहरण । (एक) एक सफल हाय-सी पुस्तकालय (पुस्तकालय 1, शीर्ष) और एक पुस्तकालय है कि टुकड़ों के एक चोटी है कि अनुक्रमण के लिए बहुत बड़े है दिखाता है से (लाइब्रेरी 2, नीचे) से डीएनए टुकड़ा आकार के वितरण दिखा 2 लाइब्रेरी सफलतापूर्वक अनुक्रम किया गया था, लेकिन अवांछित डीएनए अंशों की भी बड़ी मात्रा में कम sequencing पैदावार के लिए नेतृत्व कर सकते हैं । () दो हाय-सी पुस्तकालयों के आँकड़े को छानने: प्रदर्शित संरेखित पढ़ें जोड़े की संख्या है कि आगे के विश्लेषण से बाहर रखा गया है अभिविंयास और दूरी पढ़ें (आवक, जावक)4 या पीसीआर दोहराव (डुप्लिकेट) के कारण । प्रत्येक बार में, फ़िल्टर (शेष) और विफल (फ़िल्टर किए गए) को पास कर रहा है पढ़ता की संख्या प्लॉट की गई हैं । फ़िल्टर गुजर पढ़ता का प्रतिशत इसके अतिरिक्त पाठ के रूप में दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: हाय-सी मंचन भ्रूण से बातचीत के नक्शे । Hi-C इंटरैक्शन मैप्स 10 kb रिज़ॉल्यूशन पर और३३से पहले बताए अनुसार संतुलित किया जाता है । दिखाया गुणसूत्र 2L पर एक क्षेत्र है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए

लायब्रेरी चरण भ्रूण की संख्या कतरन से पहले राशि डीएनए (एनजी) पीसीआर साइकिल अंतिम पुस्तकालय एकाग्रता (एनएम)
1 परमाणु चक्र 12 ७१ ४६ 12 २८.२
2 परमाणु चक्र 12 ४६ ४० 12 २२.२
3 परमाणु चक्र 12 ६० 13 13 १२.३
4 परमाणु चक्र 13 ३६ ३९ 12 २२.२
5 परमाणु चक्र 13 ३५ 10 12 ५.०
6 परमाणु चक्र 13 ४८ 18 12 ८.७
7 परमाणु चक्र 14 ३३ 30 12 ३९.८
8 परमाणु चक्र 14 24 ३६ 12 २०.४
9 परमाणु चक्र 14 14 8 12 ४.२
10 3-4 hpf 17 30 12 २४.०
11 3-4 hpf 18 ४२ 11 १९.१
12 3-4 hpf 22 ६३ 11 ४८.४

तालिका 1: प्रतिनिधि sequencing लाइब्रेरी आँकड़ों की सूची । सूची में प्रत्येक पुस्तकालय के लिए, भ्रूण है कि अपनी पीढ़ी के लिए इस्तेमाल किया गया की संख्या, बायोटिन pulldown और Qubit द्वारा मापा बाल काटना से पहले कुल डीएनए की राशि, प्रवर्धन के लिए इस्तेमाल किया पीसीआर चक्र की संख्या, और अनुक्रमण पुस्तकालय के अंतिम एकाग्रता शुद्धि और आकार चयन के बाद संकेत दिया जाता है ।

Discussion

यहां प्रस्तुत प्रोटोकॉल जल्दी Drosophila भ्रूण में क्रोमेटिन वास्तुकला के उच्च गुणवत्ता वाले नक्शे पैदा करने में बहुत प्रभावी है । एक पूर्व प्रोटोकॉल३४की तुलना में, यहां वर्णित दृष्टिकोण एक अप-टू-डेट का उपयोग करता है सीटू हाय-C प्रक्रिया5, जल्दी प्रसंस्करण में जिसके परिणामस्वरूप, उच्च संकल्प, और कम एजेंट का उपयोग. सीटू हाई-सी प्रोटोकॉल में शामिल समग्र प्रक्रिया Drosophilaके अलावा चरणों और प्रयोगात्मक प्रणालियों की एक विस्तृत श्रृंखला पर काम करने की उम्मीद है. चूंकि प्रोटोकॉल एक कम इनपुट की आवश्यकता है, यह भी अलग कोशिका आबादी पर इस्तेमाल किया जा सकता है । Drosophilaमें, जब सीमा के बाहर भ्रूण के लिए प्रोटोकॉल का उपयोग यहां वर्णित है, कुछ मानकों, विशेष रूप से सामग्री के निर्धारण में समायोजित करने की आवश्यकता हो सकती है । के बाद से बड़े भ्रूण एक उच्च अभेद्य छल्ली का विकास, formaldehyde और लंबे समय तक निर्धारण की एकाग्रता की स्थापना उचित हो सकता है । परमाणु चक्र के अलावा अंय चरणों में भ्रूण के संग्रह के लिए 14, १.४ कदम में 25 डिग्री सेल्सियस पर भ्रूण की मशीन समय इस प्रकार के रूप में समायोजित करने की आवश्यकता: परमाणु चक्र 12, ७० मिनट; नाभिकीय चक्र 13, ९० min; ३ – ४ hpf, 3:30 एच.

13 क्लीवेज डिवीजनों (स्टेज 1-4) के दौरान, नाभिक घनत्व मोटे तौर पर प्रत्येक प्रभाग के साथ डबल्स । नाभिक को आसानी से उनकी ब्राइट GFP प्रतिदीप्ति से पहचाना जा सकता है । बँटवारा के दौरान, eGFP-PCNA नाभिक में स्थित नहीं है, और इसके संकेत भ्रूण भर में फैलाया जाता है. इस सुविधा का भ्रूण है कि एक तुल्यकालिक दरार संभव विभाजन के दौर से गुजर रहे है की पहचान करता है । क्रोमेटिन अनुरूप अध्ययन के लिए, इन mitotic भ्रूण आम तौर पर वांछनीय नहीं हैं, क्रोमेटिन के mitotic संगठन के बाद से भारी है चरण संगठन३५से अलग है । यह विशेष रूप से एक तुल्यकालिक mitotic विभाजन के दौर से गुजर भ्रूण का चयन करने के लिए प्रोटोकॉल अनुकूलन संभव है । इस मामले में, केवल फैलाया हुआ, eGFP-PCNA के गैर-परमाणु वितरण के साथ भ्रूण रखा जाना चाहिए, और अन्य सभी भ्रूण को छोड़ दिया जाना चाहिए । परमाणु घनत्व निर्धारित नहीं किया जा सकता है के बाद से, उनके संचारित प्रकाश माइक्रोस्कोपी में देखा आकृति विज्ञान द्वारा मंच भ्रूण के लिए वैकल्पिक तरीकों कार्यरत होना चाहिए. ध्रुव कोशिकाओं और भ्रूण परिधि में नाभिक की उपस्थिति से संकेत मिलता है कि भ्रूण कम परमाणु चक्र 9 पूरा कर लिया है, जबकि दिखाई cellularization परिधि में परमाणु चक्र 1412इंगित करता है ।

उच्च सी प्रयोगों सफलतापूर्वक प्रतिबंध एंजाइमों की एक विस्तृत चयन5का उपयोग कर किया जा सकता है । वर्तमान approaches आमतौर पर कोई 4-आधार अनुक्रम, जैसे MboI, या कोई 6-आधार पहचान साइट, जैसे कि HindIII पहचान एंजाइमों का उपयोग करें । 6-आधार कटर पर 4-आधार कटर का लाभ यह है कि वे उच्च क्षमता के संकल्प की पेशकश, पर्याप्त अनुक्रमण गहराई दी, और एक अधिक भी कवरेज के जीनोम भर में प्रतिबंध साइटों की । एक और5,23,३६,३७पर एक 4-बेस कटर चुनने में कोई स्पष्ट लाभ नहीं है । दो सबसे अधिक इस्तेमाल किया एंजाइमों, MboI और DpnII, दोनों एक ही GATC मांयता साइट पहचान । DpnII CpG मिथाइल के प्रति कम संवेदनशील है, जो Drosophilaमें कोई चिंता का विषय नहीं है । यहां प्रस्तुत प्रोटोकॉल को भी सफलतापूर्वक एक प्रतिबंध एंजाइम के रूप में DpnII का उपयोग कर पूरा किया जा सकता है । धारा ४.२ में । प्रतिबंध एंजाइम और बफर DpnII संगतता के लिए समायोजित किया जा करने के लिए है, निर्माता की सिफारिशों के अनुसार.

यदि sequencing लायब्रेरी का अंश आकार काफी संख्या में चित्र 2aदिखाया गया से विचलित, अनुक्रमण के दौरान क्लस्टर गठन कम कुशल या पूरी तरह से विफल हो सकता है । इस मामले में, बाल काटना के बाद आकार वितरण की जांच की जानी चाहिए और कतरनी मानकों तदनुसार समायोजित । बहुत छोटा (< 100 bp) या बहुत बड़ा (> 1, 000 bp) के डीएनए अंशों के वितरण में चोटियों आकार चयन के साथ समस्याओं को इंगित करता है, जैसे मोतियों या supernatant के ऊपर ले जाने के लिए छोड़ दिया जाना चाहिए रहे हैं । अक्सर इन पुस्तकालयों पर छोटे चोटियों के साथ इन अवांछनीय आकार, इस तरह के एक चित्र के रूप में, अभी भी clustering दक्षता में केवल एक छोटी सी कमी के साथ सफलतापूर्वक अनुक्रम ।

पीसीआर दोहराव की उच्च दरों से बचना चाहिए क्योंकि यह काफी प्रयोग करने योग्य अनुक्रम की संख्या को कम कर देता है पढ़ता है । पीसीआर डुप्लीकेट की दर सीधे इनपुट मटेरियल की मात्रा से संबंधित है । अधिक इनपुट का उपयोग इसलिए आमतौर पर पीसीआर दोहराव के साथ समस्याओं को दूर ।

पढ़ने के उंमुखीकरण के कारण फ़िल्टर की उच्च संख्या (चित्रा बी) अपर्याप्त पाचन, जो बहुत कम एंजाइम, बहुत अधिक इनपुट सामग्री, या भ्रूण के अधूरे homogenization का उपयोग करने का परिणाम हो सकता है संकेत मिलता है ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

इस शोध को मैक्स प्लैंक सोसाइटी ने वित्त पोषित किया । C.B.H. इंटरनेशनल मैक्स प्लैंक रिसर्च स्कूल से एक फैलोशिप द्वारा समर्थित था-आणविक चिकित्सा । हम Shelby Blythe और एरिक Wieschaus धंयवाद के लिए कृपया eGFP-PCNA Drosophila melanogaster लाइन प्रदान करते हैं ।

Materials

Name Company Catalog Number Comments
Biotin-14-dATP Life Technologies 19524016
MboI New England Biolabs R0147L
DNA Polymerase I Klenow Fragment New England Biolabs M0210L
T4 DNA Ligase Thermo Fisher EL0012 T4 DNA Ligase Buffer included
T4 DNA Polymerase New England Biolabs M0203L
Proteinase K AppliChem A4392
GlycoBlue Life Technologies AM9516
Complete Ultra EDTA-free protease inhibitors Roche 5892791001
NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) New England Biolabs E7335 Sequencing Adaptor, Forward (unindexed) PCR primer and Reverse (indexed) PCR primer and USER enzyme used in the Library preparation section are components of this kit
NEBNext Ultra II DNA Library Prep Kit New England Biolabs E7645 End Prep Enzyme Mix, End Prep Reaction Buffer, Ligation Enhancer, Ligation Master Mix and Polymerase Master Mix used in the Library preparation section are components of this kit
Covaris S2 AFA System Covaris
DNA LoBind Tubes, 1.5 mL Eppendorf 0030108051
Falcon cell strainer 100 µm Corning 352360 Embryo collection baskets
37% formaldehyde VWR 437536C
Heptane AppliChem 122062.1612
M165 FC fluorescent stereo microscope Leica
M165 FC DFC camera Leica
Metal micro pestle Carl Roth P985.1 Used to lyse embryos in step 4.1.4
RNase A AppliChem A3832,0050
Dynabeads MyOne Streptavidin C1 Life Technologies 65002 Streptavidin coated magnetic beads
Ampure XP beads Beckman Coulter A63881
Qubit 3.0 Fluorometer Thermo Fisher Scientific Q33216
Qubit assay tubes Thermo Fisher Scientific Q32856
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Q32854
Phosphate buffered saline (PBS) Sigma-Aldrich P4417
eGFP-PCNA flies Gift from S. Blythe and E. Wieschaus
Sodium hypochlorite 13% Thermo Fisher AC219255000
Triton X-100 AppliChem A4975
Tris buffer pH 8.0 (1 M) for molecular biology AppliChem A4577
NaCl AppliChem A2942
IGEPAL CA-630 Sigma-Aldrich I8896
1.5 mL microcentrifuge tubes Greiner Bio-One 616201
SDS for molecular biology AppliChem A2263
10x CutSmart buffer New England Biolabs B7204S Restriction enzyme buffer
PCR Nucleotide Mix Sigma-Aldrich 11814362001 Unmodified dCTP, dGTP, dTTP
BSA, Molecular Biology Grade New England Biolabs B9000S
EDTA 0.5 M solution for molecular biology AppliChem A4892
Sodium acetate 3 M pH 5.2 Sigma-Aldrich S7899
DynaMag-2 Magnet Life Technologies 12321D Magnetic stand
Intelli-Mixer RM-2L Omnilab 5729802 Rotator
ThermoMixer F1.5 Eppendorf 5384000012 Mixer
Small Embryo Collection Cages Flystuff.com 59-100 Egg collection cage
Centrifuge 5424 R Eppendorf 5404000413
C1000 Touch Thermal Cycler Bio-Rad 1851148
PCR tube strips Greiner Bio-One 673275
NEBuffer 2.1 New England Biolabs B7202S T4 DNA Polymerase buffer

DOWNLOAD MATERIALS LIST

References

  1. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nat Rev Genet. 17, (11), 661-678 (2016).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, (5950), 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  4. Jin, F., et al. A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature. (2013).
  5. Rao, S. S. P., et al. A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping. Cell. 159, (7), 1665-1680 (2014).
  6. Darbellay, F., Duboule, D. Topological Domains, Metagenes, and the Emergence of Pleiotropic Regulations at Hox Loci. Current topics in developmental biology. 116, 299-314 (2016).
  7. Beagan, J. A., et al. Local Genome Topology Can Exhibit an Incompletely Rewired 3D-Folding State during Somatic Cell Reprogramming. Cell stem cell. 18, (5), 611-624 (2016).
  8. Andrey, G., et al. Characterization of hundreds of regulatory landscapes in developing limbs reveals two regimes of chromatin folding. Genome Res. 27, (2), 223-233 (2017).
  9. Krijger, P. H. L., de Laat, W. Regulation of disease-associated gene expression in the 3D genome. Nature Reviews. Molecular Cell Biology. 17, (12), 771-782 (2016).
  10. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148, (3), 458-472 (2012).
  11. Ghavi-Helm, Y., et al. Enhancer loops appear stable during development and are associated with paused polymerase. Nature. 512, (7512), 96-100 (2014).
  12. Foe, V. E., Alberts, B. M. Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J Cell Sci. 61, 31-70 (1983).
  13. Blythe, S. A., Wieschaus, E. F. Zygotic Genome Activation Triggers the DNA Replication Checkpoint at the Midblastula Transition. Cell. 160, (6), 1169-1181 (2015).
  14. Blythe, S. A., Wieschaus, E. F. Establishment and maintenance of heritable chromatin structure during early Drosophila embryogenesis. eLife. 5, e20148 (2016).
  15. JoVE Science Education Database. Embryo and Larva Harvesting and Preparation. Biology I: yeast, Drosophila and C. elegans. Drosophila melanogaster. JoVE, Cambridge, MA. (2017).
  16. Sicaeros, B., O'Dowd, D. K. Preparation of Neuronal Cultures from Midgastrula Stage Drosophila Embryos. Journal of Visualized Experiments. (5), (2007).
  17. Shermoen, A. W. Preparation of Baskets for Drosophila Egg Collections, Treatments, and Incubations. Cold Spring Harbor Protocols. (10), (2008).
  18. Ay, F., Noble, W. S. Analysis methods for studying the 3D architecture of the genome. Genome biology. 16, (1), 183 (2015).
  19. Lazaris, C., Kelly, S., Ntziachristos, P., Aifantis, I., Tsirigos, A. HiC-bench: comprehensive and reproducible Hi-C data analysis designed for parameter exploration and benchmarking. BMC Genomics. 18, (1), (2017).
  20. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biology. 16, (1), (2015).
  21. Durand, N. C., et al. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell systems. 3, (1), 95-98 (2016).
  22. Lajoie, B. R., Dekker, J., Kaplan, N. The Hitchhiker's guide to Hi-C analysis: Practical guidelines. Methods. 72, 65-75 (2015).
  23. Schmitt, A. D., Hu, M., Ren, B. Genome-wide mapping and analysis of chromosome architecture. Nature Reviews. Molecular Cell Biology. 17, (12), 743-755 (2016).
  24. Shin, H., et al. TopDom: an efficient and deterministic method for identifying topological domains in genomes. Nucleic Acids Res. 44, (7), e70 (2016).
  25. Kruse, K., Hug, C. B., Hernández-Rodríguez, B., Vaquerizas, J. M. TADtool: visual parameter identification for TAD-calling algorithms. Bioinformatics. 32, (20), 3190-3192 (2016).
  26. Lévy-Leduc, C., Delattre, M., Mary-Huard, T., Robin, S. Two-dimensional segmentation for analyzing Hi-C data. Bioinformatics. 30, (17), Oxford, England. i386-i392 (2014).
  27. Filippova, D., Patro, R., Duggal, G., Kingsford, C. Identification of alternative topological domains in chromatin. Algorithms for molecular biology: AMB. 9, (1), 14 (2014).
  28. Crane, E., et al. Condensin-driven remodelling of X chromosome topology during dosage compensation. Nature. 523, (7559), 240-244 (2015).
  29. Durand, N. C., et al. Juicebox Provides a Visualization System for Hi-C Contact Maps with Unlimited Zoom. Cell systems. 3, (1), 99-101 (2016).
  30. Zhou, X., et al. Exploring long-range genome interactions using the WashU Epigenome Browser. Nature Methods. 10, (5), 375-376 (2013).
  31. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. bioRxiv. 115063 (2017).
  32. Kerpedjiev, P., et al. HiGlass: Web-based Visual Comparison And Exploration Of Genome Interaction Maps. bioRxiv. 121889 (2017).
  33. Hug, C. B., Grimaldi, A. G., Kruse, K., Vaquerizas, J. M. Chromatin Architecture Emerges during Zygotic Genome Activation Independent of Transcription. Cell. 169, (2), (2017).
  34. Berkum, N. L., et al. Hi-C: a method to study the three-dimensional architecture of genomes. Journal of Visualized Experiments: JoVE. (39), (2010).
  35. Naumova, N., et al. Organization of the mitotic chromosome. Science. 342, (6161), 948-953 (2013).
  36. Denker, A., de Laat, W. The second decade of 3C technologies: detailed insights into nuclear organization. Genes & development. 30, (12), 1357-1382 (2016).
  37. Belaghzal, H., Dekker, J., Gibcus, J. H. Hi-C 2.0: An optimized Hi-C procedure for high-resolution genome-wide mapping of chromosome conformation. Methods (San Diego, Calif). 123, 56-65 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics