네이티브 Chromatin Immunoprecipitation Murine 뇌 종양 Neurospheres를 사용 하 여

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

후 성적인 기계 장치는 자주 glioma에서 변경 됩니다. Chromatin immunoprecipitation 히스톤 수정 chromatin 구조와 유전자 전사 조절에 따른 결과 glioma의 유전 변경의 결과 연구에 사용 될 수 있습니다. 이 프로토콜 murine 뇌 종양 neurospheres에 네이티브 chromatin immunoprecipitation을 설명합니다.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

후 성적인 수정 개발 및 glioma의 진행에 관련 될 수 있습니다. 메 틸 화 및 발기인의 acetylation oncogenes 종양 억제기의 규제 지역 변경 유전자 발현에 변화를이 끌 하 고 뇌 종양의 병 인에 중요 한 역할을 재생할 수 있습니다. 네이티브 chromatin immunoprecipitation (칩) 수정 또는 단단히 DNA에 바인딩된 다른 단백질의 검출을 허용 하는 인기 있는 기술입니다. 기본 칩에서 복사해올된 칩 달리 셀 연결할 covalently 단백질 DNA 포름알데히드와 함께 처리 되지 않습니다. 이것은 유리한 때로는 가교만 뚜렷이 DNA와 상호 작용 하 고 유전자 규칙에서 기능적 중요성을 하지 않은 단백질을 해결할 수 있습니다. 또한, 항 체는 일반적으로 고정 되지 않은 펩 티 드에 대 한 발생 합니다. 따라서, 네이티브 칩에서 항 체 특이성 증가 된다. 그러나, 그것은 네이티브 칩 히스톤 또는 DNA에 단단히 바인딩할 다른 단백질 연구에 적용 됩니다만 다는 것을 명심 하는 것이 중요. 이 프로토콜 murine 뇌 종양 neurospheres에 네이티브 chromatin immunoprecipitation을 설명합니다.

Introduction

Epigenetic 이벤트 gliomas에 자주와 가능성이 종양의 병 인에 중요 한 역할. 실제로, 소아과 고급 glioma 인코딩 히스톤 변형 H3.3 및 H3.1 유전자에 있는 돌연변이 발생 자주1. 변이는 히스톤 수정에 영향을 하 고 주요 epigenetic 결과2,3. 성인 스펙트럼에 사춘기에 isocitrate 효소 유전자 1/2 (IDH1/2), α-KG 종속 히스톤과 DNA 드-methylasaes, 억제 하는 돌연변이에 재발 돌연변이 그리고 다른 chromatin 레 귤 레이 터 ATRX 등 DAXX 유전 변경 발생 4. 따라서, 그것은 중요 한 중요성 chromatin 구조 및 규제 히스톤 수정, 차례로, 종양 세포의 transcriptome의 극적인 영향을 미칠 후 레 귤 레이 터에 영향을 주는 돌연변이 변경 하는 방법을 공부 하.

Chromatin immunoprecipitation (칩) 후 성적인 수정 게놈5,,67에 영향을 평가 하는 데 사용 하는 강력한 도구입니다. 기본 칩에서 chromatin micrococcal nuclease (MNase), 제기, 관심사의 단백질에 대 한 항 체를 사용 하 여 immunoprecipitated로 소화 하 고 DNA immunoprecipitated chromatin 복잡 한6에서 정화는 다음. 세포는 DNA6와 긴밀 하 게 상호 작용 하는 단백질의 연구에 대 한 적용만이 기술에 하지 절차 동안 고정 됩니다. Cross-linking의 부재 에이즈 항 체 특이성 항 체는 일반적으로 고정 되지 않은 펩 티 드 또는 단백질7에 대 한 발생 이후. 또한, 아무 상호 단계 때문에, 담합 일반적인 고 하지 규제7,8과도 단백질 DNA 상호 작용의 기회 줄어듭니다. 칩은 특정 게놈 지역에서 히스톤 수정의 농축을 식별 하기 위해 사용할 수 있습니다. 여기, 우리는 프로토콜 glioma의 마우스 모델 설계 유전자에서 생성 된 neurospheres (NS)에서 네이티브 칩을 수행에 대 한 선발.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

여기에 설명 된 모든 메서드는 기관 동물 관리 및 사용 위원회 (IACUC)의 미시간 대학에 의해 승인 되었습니다.

1. 뇌종양 NS 및 조건 배양의 세대.

  1. Dulbecco의 수정이 글 매체/F12B27 보충 (1x), n 2 보충 (1x) 및 항균 성 시 약으로 신경 줄기 세포 매체 (NSC)를 준비 합니다. 인간 재조합 형 내 피 성장 인자 (EGF) 및 20 ng/mL 각의 최종 농도에 기본적인 섬유 아 세포 성장 인자 (FGF)와 함께 사용의 날에 NSC 매체를 보충.
  2. 자발적인 뇌 종양9를 생성 하기 위해 신생아의 측면 뇌 실에 인코딩 oncogenes 또는 종양 억제기를 타겟팅 shRNA 플라스 미드 주입은 잠자는 미녀 transposon 시스템을 사용 하 여 마우스에 뇌종양을 유발. 생물 발광 영상으로 확인 된 큰 종양으로 마우스를 선택 합니다.
    참고: 사용 자 아름다움 Transposon 시스템 및 플라스 미드 구조에 대 한 더 자세한 정보는 Calinescu 그 외 여러분 에서 찾을 수 있습니다. 9.
    1. 이미지는 마우스, 30 mg/mL 소 솔루션 intraperitoneally 26 게이지 바늘을 사용 하 여 100 µ L를 주사.
    2. 소의 주입 후 5 분 anesthetize 동물 마 취 챔버를 사용 하 여 산소/isoflurane 흐름 2 %isoflurane 설정.
    3. 동물 마 취는 때 (일반적으로 2-3 분), 산소 isoflurane 2 %isoflurane 설정와 동물 생물 발광 챔버에 배치. 동물 5 분 보다 더 오랫동안 취하는 것입니다, 마 취 동안 건조를 방지 하기 위해 안과 연 고를 사용 합니다.
    4. 마우스는 vivo에서 광학 이미징 시스템 다음 매개 변수를 사용 하 여 이미지: 자동 노출, 큰 binning 및 조리개 f = 1. 큰 종양을 고려 하는 매개 변수는 생물 발광은 > 106 광자/s/cm2/sr.
  3. 안락사 폐쇄 실에서 isoflurane 흡입 마 취의 과다와 마우스 발가락 핀치는 동물 마 취에 의해 확인 하 고 마우스를 목을 벨.
  4. 두뇌를 추출 하 고 앞에서 설명한 Calinescu 에 그것을 해 부 9.
  5. 10 cm 배양 접시에에서 두뇌를 놓습니다. 종양 유발 형광 단백질을 표현 하 고, 해 부 현미경 형광 0.3 X 확대 및 적절 한 형광 채널을 설정 하는 사용 그렇지 않으면 종양 질량 조직 색상 및 질감의 차이 식별. 메스와 집게를 사용 하 여 정상적인 뇌에서 종양 조직 분리.
  6. 페 트리 접시에 작은 조각으로 종양을 말하다. NSC 매체의 300 µ L 1.5 mL 튜브에 해 부 종양을 놓습니다.
  7. 사용 하 여 부드럽게 균질 종양을 원뿔 microcentrifuge 튜브의 벽에 맞는 일회용 플라스틱 펠 릿 유 봉. 세포 분리 매체의 1 mL을 추가 하 고 37 ° c.에 5 분에 대 한 샘플을 품 어
    참고:는 방 앗 공이 사용 하 여 일부 셀을 죽 일 수 있습니다. 독자 세포 생존 능력을 극대화 하 고 싶다면는 유 봉 사용을 생략할 수 있습니다.
  8. 70 µ m 셀 스 트레이너를 통해 1.7 단계에서 세포 현 탁 액을 통과 하 고 NSC 매체의 25 mL와 여과기를 세척.
  9. 실 온에서 5 분에 대 한 300 x g에서 현 탁 액을 원심을 가만히 따르다는 상쾌한 다시 NSC 매체의 6 mL에 펠 릿을 일시 중단.
  10. 1.9 T-25 문화 플라스 크에 단계에서 종양 세포 현 탁 액을 접시 하 고 95% 공기와 5% CO2의 분위기와 조직 문화 인큐베이터에서 37 ° C에서 문화. 보통 3 일 후, 일부 죽은 세포, 준수 세포와 일부 셀을 형성 하는 매체에 떠 있는 NS의 혼합물이 있을 것입니다.
  11. 15 mL 원뿔 튜브에 세포 현 탁 액을 전송는 micropipette를 사용 하 여 바닥에 침 몰 된 셀만을 수집 하 고 다시 T-75 조직 배양 플라스 크에 접시.
  12. 상대적으로 높은 밀도 (1-3 배는 T-25 106 셀)에서 세포를 유지 합니다. 들은 confluent 셀을 통과.
    참고: Confluency 구체 크기에 의해 결정 됩니다. 블랙 센터 큰 분야의 중심에 죽은 세포는 고 셀 즉시 passaged 해야 합니다 나타냅니다.
  13. 추가 성장 인자 (EGF와 기본-FGF; 20 ng/mL 각) 3 일 마다. 세포는 중간 회전 빛 오렌지와 합칠 때 매체를 변경 합니다.
  14. 매체를 변경 하려면 오래 된 매체를 수집 하 고 5 분 동안 실 온에서 300 x g에서 원심 다시 NSC 중간 단계 1.1에서에서 지정 된 농도에서 EGF와 FGF 보충에 셀 펠 릿을 중단.
    참고: 만약 분야에서 중반-높은 confluency, 하지만 passaged 될 준비가 안 (영역 크기는 작은 직경 < 100 µ m), 다음 두 플라스 크로 펠 릿을 분할할 수 있습니다.
  15. 셀 통로를 실 온에서 5 분에 대 한 300 x g에서 세포를 원심, 가만히 따르다는 상쾌한 고 37 ° c.에 5 분에 대 한 셀 분리 매체에 셀을 품 어
    1. 희석 분리 매체 균형된 소금 솔루션의 5 mL을 추가 하 고 실 온에서 5 분에 대 한 300 x g에서 원심.
    2. 상쾌한 가만히 따르다 하 고 NSC 매체의 18 mL에 셀 펠 릿 resuspend 3 T-25 플라스 크에 정지를 동등 하 게 분할.
  16. 셀의 aliquots, 동결 단계 1.15에서 세포를 분리 하 고 10% 디 메 틸 sulfoxide와 90% 태아 둔감 한 혈 청 1 mL aliquots 셀을 고정 합니다. 천천히 10 분 동안 얼음에 셀을 삽입 후 30 분 동안-20 ° C 세포 세포를 진정 및 1 일-80 ° C. 다음 날, 액체 질소 저장 컨테이너에 셀을 전송 합니다.

2. 기본 칩

  1. Chromatin 준비
    1. NS confluent 될 때까지 파생된 NS의 후, 95% 공기와 5% CO2 의 분위기와 NSC 매체 조직 문화 인큐베이터에서 37 ° C에서의 15 ml에서 T-75에서 NS를 문화. 한 confluent T-75 플레이트 3-5 X 106 셀을 얻을 것입니다.
    2. 셀이 될 때 confluent, NS 5 분에 대 한 300 x g에서 원심, 가만히 따르다는 상쾌한 고 셀 분리 매체의 1 mL를 추가 합니다. 중간의 5 분 추가 5 mL에 대 한 37 ° C에서 세포를 품 어과 hemocytometer10를 사용 하 여 셀.
      참고: 1 x 106 셀 immunoprecipitation (IP) 반응 당 필요 합니다. 참고는 미리 면역 혈 청 또는 IgG를 제어 해야 합니다 또한 포함된11일.
    3. 300 x g 5 분 동안에 1 개의 1.5 mL microcentrifuge 관에서 NS 원심, 가만히 따르다는 상쾌한 다시 균형된 소금 솔루션의 1 mL와 함께 NS 펠 릿을 일시 중단 하 고 낮은 단백질 바인딩 1.5 mL microcentrifuge 관에 정지를 전송.
    4. 5 분, 300 x g에서 원심 분리기 NS는 상쾌한 가만히 따르다와 다시 1 x 106 세포 효소 보충 당 소화 버퍼 (50 mM Tris HCl, pH 8.0, 1mm CaCl2, 0.2% 폴 리 에틸렌 글리콜 octylphenyl 에테르) 95 µ L에서 셀 펠 릿을 일시 중단 억제제 높은 농도 (1: 100)에 칵테일. 즉시 피펫으로 셀을 아래로 응집을 방지 하 고 모든 거품을 만들지 마십시오.
    5. "1x" 재고 라고 될 1 mg/mL 솔루션 (1.15 단위 / µ L,-20 ° C에 저장) 50% 글리세롤에 MNase를 resuspend. 게는 "0.1 x" 주식 50% 글리세롤과 두 번째 1:9 희석 하 여 (., 900 µ L "1 x"의 MNase 및 50% 글리세롤의 100 µ L)-20 ° c.에 그것을 저장 하 고
    6. 믹스 5 µ L의 "0.1 x" MNase 및 소화 버퍼의 145 µ L. 얼음에 효소는 항상 유지. 1 x 106 셀 당 소화 버퍼에 희석된 MNase의 5 µ L를 추가 합니다. 12 분의 정확한 부 화 시간을 보장 하기 위해 한 번에 정확히 12 분 프로세스에 대 한 37 ° C 블록에 관을 혼합 튜브 샘플 하나를 터치 합니다.
    7. 10 µ L 10의 추가 1 x 106 셀 당 MNase 중지 버퍼 (110 mM Tris HCl, pH 8.0, 55 mM EDTA) x. 샘플은 앞으로이 지점에서 얼음에 유지 되어야 한다.
    8. 110 µ L "2 x RIPA 버퍼" 추가 (280 m NaCl, 1.8% 폴 리 에틸렌 글리콜 octylphenyl 에테르, 0.2% 나트륨 라우릴 황산 염 (SDS), 0.2% 나 deoxycholate, 5mm 에틸렌 글리콜-bis(β-aminoethyl ether)-N, N, m N', N'-tetraacetic 산 (EGTA); 4 ° C에서 저장 된)으로 보충 프로 테아 제 억제 물 칵테일 1 x 106 셀 당 높은 농도 (1: 100)에서 믹스에 튜브를 터치 합니다.
    9. 튜브 microfuge 4 ° C에서 15 분 동안 원심 1700 x g. (낮은 단백질 바인딩 microcentrifuge 튜브는 필요 이상) 새로운 일반 1.5 mL microcentrifuge 관에는 상쾌한을 전송 하 고 얼음에 저장. 펠 릿을 삭제 합니다.
  2. Immunoprecipitation (IP)
    1. 단백질 A, 단백질 G 자석 구슬 1:1 비율로 섞는다. 모든 IP에 대 한 구슬의 25 µ L를 준비 합니다.
    2. RIPA 버퍼의 1 mL을 추가 하 여 구슬을 세척 (10 mM Tris pH 8.0, 1 mM EDTA, 140 mM NaCl, 1% 폴 리 에틸렌 글리콜 octylphenyl 에테르, 0.1 %SDS, 0.1% 나 deoxycholate; 4 ° C에서 저장 된) 낮은 농도 (1:1000)에서 protease 억제제 보충.
    3. 자석 세탁 솔루션에서 분리 하 여 세척 솔루션 (약 1 분)을 가만히 따르다 구슬 사용. 두 번 세척 단계를 수행 합니다.
    4. 다시 프로 테아 제 억제제 (1:1000)와 보충 RIPA 버퍼를 사용 하 여 원래 볼륨에 비즈를 일시 중단 합니다.
    5. 필요한 경우 희석 chromatin protease 억제제 (1:1000)와 각 IP는 100-200의 볼륨 보충 RIPA 버퍼를 사용 하 여 µ L. 예약 입력 chromatin의 IP 당 사용 하는 볼륨의 10%.
      참고: 예를 들어 IP 당 200 µ L 사용 하는 경우 희석된 chromatin의 20 µ L 해야 예약 입력에 대 한. 4 개의 IPs의 총, 총 chromatin 볼륨 820 µ L를 희석 한다.
    6. 입력을 준비 합니다. 입력에 가수분해 K (0.5 mg/mL)와 보완의 테 버퍼 (10 mM Tris HCl pH 8.0, 1 mM EDTA) 100 µ L을 추가 하 고 입력 1 h 55 ° C에서 품 어.
      참고: 단계 2.2.6-2.2.7 단계 2.3.4 2.4.1 함께 수행할 수 있습니다.
    7. 제조업체의 지침에 따라 PCR 정화 키트를 사용 하 여 입력을 정화 하 고 키트에서 제공 하는 차입 버퍼의 50 µ L에 elute.
    8. Microvolume 분 광 광도 계를 사용 하 여 입력의 농도 측정 하 고 노트북에 결과 기록 합니다. 키트에서 차입 버퍼와 빈.
      참고: 마우스 neurospheres, 우리 사용 DNA의 약 6 µ g 각 IP에 대 한.
    9. 1% 젤에 입력 실행 하거나 표준 설정을 사용 하 여 DNA Bioanalyzer에 1 µ L을 로드 합니다. 다운스트림 응용 프로그램에 대 한 입력으로 사용 하기 위해 나머지를 저장 합니다.
    10. 모든 IP에 대 한 10 µ L 세척 단백질 A & G 자석 비즈를 추가 하 고 1 시간 4 ° c.에 대 한 IP를 품 어
      참고: 예를 들어 30 µ L의 단백질 A & G 자석 구슬 3 ips에 추가 합니다.
    11. 자석에 샘플을 놓고 분리 하 비즈를 허용 합니다. 새로운 1.5 mL 튜브에 이전 결정된 금액을 전송 하 여 chromatin를 나눕니다.
    12. 항 체를 추가 하 고 증발을 피하기 위해 플라스틱 파라핀 필름으로 모자를 포장. 회전 20 rpm으로 4 ° C에서 하룻밤 샘플을 품 어.
      참고: 농도 결정 되어야 합니다 경험적으로 제조업체 권장 사항에 따라.
    13. 다음 날, 회전 10 실내 온도에, 2000 x g, 미니 원심 분리기를 사용 하 여 튜브 s. 그런 다음 각 ip 구슬의 10 µ L을 추가 하 고 회전 20 rpm으로 4 ° C에서 3 h에 대 한 IP를 품 어.
  3. IP 세척과 단백질 소화
    1. RIPA 버퍼 각 IP에 낮은 농도 (1:1000)에서 protease 억제제와 보충의 150 µ L을 추가 하 고 마그네틱 스탠드에 샘플에 5 분 장소에 대 한 20 rpm에 회전 4 ° C에서 IP를 품 어 별도로 자석 구슬 허용. 피펫으로 사용 하 여 제거는 상쾌한 하. 이 tep 5 세척을 반복 합니다.
    2. 150 µ L LiCl 버퍼의 추가 (250mm LiCl, 10 mM Tris pH 8.0, 1 mM EDTA, 0.5 %NP-40, 0.5% 나 deoxycholate; 4 ° C에서 저장소) protease 억제제 각 IP에 낮은 농도 (1:1000)에서 보충 하 고 5 분 장소는 샘플에 대 한 20 rpm에 회전 4 ° C에서 IP를 품 어 자기에서 서 서 하 고 별도로 자석 구슬 허용. 피펫으로 사용 하 여 상쾌한 제거.
    3. 찬 테 (프로 테아 제 저 해제)의 150 µ L을 추가 하 고 5 분 장소에 대 한 20 rpm에 회전 4 ° C에서 샘플 마그네틱 스탠드에 샘플을 품 어 별도로 자석 구슬 허용. 피펫으로 사용 하 여 제거는 상쾌한 하.
    4. 최종 세척 단계 후 다시 테 버퍼 가수분해 K (0.5 mg/mL)와 보완의 100 µ L에서 샘플을 일시 중단 하 고 1 시간 55 ° C에서 샘플을 품 어.
  4. DNA의 정화 및 칩 양적 실시간 PCR (정량)
    1. Immunoprecipitated DNA는 PCR 정화 키트를 사용 하 여 정화. 각 샘플 키트에서 DNA 바인딩 버퍼의 추가, 튜브 자석에 놓고 자석 구슬 집계, 정리 열에는 상쾌한 전송 될 때까지 기다립니다. 제조업체의 지침을 따라와 키트에 제공 된 차입 버퍼의 50 µ L에 elute.
    2. IP 성공 인지 확인 하는 정량 수행 합니다. 이상적으로, 뇌관은 긍정적이 고 부정적인 제어 영역에 대 한 설계 되어야 한다.
      참고: 예를 들어 IP H3K4me3와 H3K27me3를 수행에 대 한 다음 샘플 실행 해야 합니다 수 정량에: H3K4me3, H3K27me3, 및 IgG 칩 DNA, DNA, 그리고 아무 템플릿 컨트롤 (NTC) H3K4me3와 농축 될 지역에 대 한 프라이 머를 사용 하 여 입력 (긍정적인 제어) 및 H3K4me3와 농축 수 지역 (제어 네거티브); 마찬가지로, H3K27me3에 대 한.
    3. 정량12를 수행 하려면 표준 프로토콜을 따릅니다. 간단히, 정량 SYBR 녹색 마스터 믹스, 10 µ M 작업 집중 각 정방향 및 역방향 뇌관의 0.5 µ L 및 칩 또는 입력된 DNA의 2 µ L를 사용 하 여 수행 합니다. 실시간 PCR 시스템을 사용 하 여 번호판을 읽기. 뇌관 시퀀스는 표 2에 나와 있습니다. 황 에서 Gapdh 뇌관 시퀀스. 사용된13있었다입니다.
    4. 칩 데이터 분석, 입력 기준 즉, % 입력 방법 (%IP)14. 다음 수식을 사용 하 여 입력 하는 %를 계산.
      입력 조정 평균 ct (입력) =-2(DF) 로그인
      DF가 시작 입력의 희석 비율 및
      DF = IP의 총 볼륨 / 입력 볼륨
      %IP = 100 × 2 ^ (입력-Ct (IP) 조정)
      여기서 Ct는 임계값 비율입니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

종양 뇌종양 뇌 종양 세포 Katushka 긍정적인 위치에서 생성 된 NS의 도식 대표는 그림 1에 표시 됩니다. 그림 2 는 전체 칩 기술의 도식 적인 표현입니다. 그림 3 보여 줍 뇌종양 NS에서에서 chromatin의 대표적인 결과 12 분, 모노, 디-및 트라이-nucleosomes의 대부분 저조한 MNase와 소화. 칩, 다음 한 정량 칩에서 수행 될 수 있습니다 및 DNA를 입력 샘플. 그림 4 는 glyceraldehyde-3-인산 효소 (Gapdh)에 대 한 정량에서 대표적인 칩 정량 데이터를 보여 줍니다. Gapdh는 H3K4me3, 활성 전사와 관련 된 수정와 풍부한 내부 관리 유전자 이다. 결과 Gapdh H3k4me3 농축은 억압 된 chromatin의 관련 된 수정 H3K27me3와 함께 풍성 하 게 보여줍니다.

Figure 1
그림 1: NS Katushka 긍정적인 뇌 종양에서 생성 된 종양의 도식. 밝은 분야와 마우스에서 수확 하는 두뇌의 형광 이미지를 끝점 단계에 도달 했습니다. 종양 영역 점선으로 delineated 고 형광 기자, Katushka에 대 한 긍정적인. 종양은 고립 되 고 종양 조직 1.5 mL 튜브에 수집 됩니다. 셀 해리 그리고 NSC 매체와 종양 NS 형태로 경작 된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 기본 칩에 대 한 워크플로의 도식 대표. 종양 NS는 경작 하 고 확장. 각 IP는 1 X 106 세포로 수행 됩니다. Chromatin 모노, 디-및 트라이-nucleosomes MNase 소화 하 여 조각화 되어 있습니다. chromatin 히스톤 수정 또는 관심사의 DNA 관련 된 단백질에 대 한 특정 항 체와 알을 품는. 항 체 DNA 복잡 한 자기 단백질 A/G 구슬 immunoprecipitated입니다. 마지막으로, 단백질을 소화 하 고 DNA는 히스톤 수정 또는 관심사의 DNA 관련 단백질 농축만 DNA를 정화 하 고 있다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: MNase에 의해 Chromatin 조각화. 정확히 12 분 대표 DNA 결과 Bioanalyzer 분석에서 입력된 샘플의 DNA의 대부분 모노, 디, 및 트라이-으로 조각화 되어 보여 추가 MNase에 의해 뇌종양 NS 37 ° C에 외피 chromatin 준비 했다 nucleosomes입니다. 차선 1은 기본적인 쌍 (BP)에 사다리. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: 대표 칩 정량 데이터 백분율 입력으로. 정량은 IgG, H3K4me3, 및 H3K27me3 칩 DNA glyceraldehyde-3-인산 효소 (Gapdh)에 대 한 프라이 머를 사용 하 여 수행 되었다. 대표 결과 Gapdh, 내부 관리 유전자 활성의 전사와 관련 된 H3K4me3 수정 및 하지 H3K27me3 수정, 억압 된 chromatin와 관련 된 농축만 보여 줍니다. 이 그래프는 각 3 개의 복제 우물 실행 두 생물학 실험의 결과를 나타냅니다. 오차 막대는 평균 (SEM)의 표준 오차를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

유전자 앞으로 뇌관 반전 뇌관
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

표 1: 뇌관 칩 정량 실험을 위해 사용. 뇌관 Gapdh 사용에 대 한 시퀀스는이 테이블에서 제공 됩니다.

평균 Ct (입력) 표준 편차 조정된 입력
24.265 0.071 20.943
백분율 입력
샘플 원시 평균 Ct 표준 편차 백분율 입력 = 100 * 2 ^ (조정 input-Ct(IP))
IgG 32.23 0.112 0.04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0.027
NTC 알 수 없는 알 수 없는 알 수 없는

표 2: 비율의 샘플 계산 입력 칩 정량 분석 방법. %10% 입력; 시작 수행 하는 칩에 대 한 입력의 샘플 계산 DF = 10. 이 테이블에 숫자 3 복제 웰 스 각 샘플에 대 한 실행 한 생물학 실험의 원시 값을 보여 줍니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

여기에 제시 된 프로토콜 NS 유전자 조작된 뇌 종양에서 파생 된에 네이티브 칩을 수행 하기 위해 사용자를 하면 수 있습니다. 칩, cross-linking 달리이 프로토콜은 DNA6밀접 하 게 연관 단백질의 연구에 대 한 제한입니다. 필요에 따라 사용 하는 셀의 수를 수정할 수 있습니다 하 고 프로토콜 확장할 수 있습니다. 그러나 IP 당 1 X 106 셀을 사용 하는 우리,, 네이티브 칩도 수행할 수 있습니다 작은 4 x 104 의 세포5. 이 프로토콜에서 정량; 통해 칩 DNA 분석 그러나,이 프로토콜 또한 게놈 넓은 수준에 단백질 DNA 상호 작용 연구를 다음 세대 시퀀싱 결합 될 수 있습니다. 이 칩 프로토콜 분석의 종양 세포 게놈의 특정 지역 내에서 히스톤 수정 증 착에 glioma oncogenes의 효과 성공적으로 사용 했습니다.

기본 칩을 수행할 때 몇 가지 중요 한 단계가 있습니다. 첫째, 각 세포 유형에 대 한 소화 상태는 실험적으로 결정 되어야 합니다. chromatin의 대부분 모노 nucleosomes 이어야 한다 (150 bp) 일부 디와 트라이 nucleosome 봉우리 (그림 3). 그러나, 일부 소화 되지 않은 DNA 남아 우리의 프로토콜 결과 70% 모노, 디, 또는 트라이-nucleosome 봉우리 보다 더 있습니다. 프로토콜 칩 seq 사용 됩니다, 추가 단계 소화 되지 않은 DNA를 제거 하셔야 합니다. 또한, 그것은 MNase 구입의 각 배치 활동에 차이가 있으며 따라서 소화 조건의 최적화를 필요로 명심 하는 것이 중요. 둘째, 칩의 품질 높은11사용 하는 항 체 특이성에 따라 다릅니다. 높은-품질 칩 항 체는 의도 된 대상에 대 한 높은 반응성 및 낮은 교차 반응성 다른 DNA 관련 된 단백질 또는 대상 히스톤 수정11에서 있어야 합니다. 이러한 이유로 항 체 특이성 펩 티 드 바인딩 테스트를 사용 하 여 테스트 하는 것이 좋습니다. 인코딩 지침 ten-fold 농축 다른 수정11기준의 수정에 대 한 관찰 해야 것이 좋습니다. 그것은 또한 필요한 제어 immunoprecipations, , 사전 면역 또는 IgG 제어를 수행 하는 중요 한입니다. 이러한 고려 사항을 충족 하는 경우 네이티브 칩 데이터 단백질 DNA 상호 작용에 의해 통제 하는 epigenetic 메커니즘을 연구 하는 강한 신뢰할 수 있는 방법입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgements

이 작품은 국립 연구소의 건강/국립 연구소의 신경 장애 및 뇌졸중 (NIH/NINDS) 보조금 R37-NS094804, R01-NS074387, R21-NS091555 M.G.C.;에 의해 지원 되었다 NIH/NINDS 부여 R01-NS076991, R01-NS082311, 및 R01-NS096756 P.R.L.; NIH/NINDS R01-EB022563; 신경외과 학과; 레 아의 행복 한 마음, 그리고 차드 비록 재단 M.G.C. 및 P.R.L. RNA 의학 그랜트 F046166 M.G.C. F.M.M.에 의해 한 F31 NIH/NINDS-F31NS103500 지원 됩니다. R.I.Z.-V입니다. NIH에서 지원 / NIGMS 부여 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics