Иммунопреципитация родной Chromatin, с использованием Neurospheres опухоли мозга мышиных

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Эпигенетические механизмы часто изменяются в глиомы. Иммунопреципитации Chromatin может использоваться для изучения последствий генетических изменений в глиомы, которые в результате изменения гистона модификации, которые регулируют хроматина структуры и Джин транскрипции. Этот протокол описывает родной хроматина иммунопреципитации мышиных мозга опухоль neurospheres.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Эпигенетические изменения могут быть вовлечены в развитии и прогрессировании глиомы. Изменения в метилирования и ацетилирование промоутеров и регулирования регионов онкогенов и супрессоров опухолевого роста может привести к изменения в экспрессии генов и играют важную роль в патогенезе опухолей головного мозга. Иммунопреципитации родной chromatin (обломока) является популярный метод, который позволяет обнаруживать изменения или другие белки, тесно привязанный к ДНК. В отличие от сшитого чип, в родной чип клетки не обрабатываются с формальдегидом для ковалентно связывать белок с ДНК. Это выгодно, потому что иногда сшивки может исправить белки, которые только временно взаимодействуют с ДНК и не иметь функциональное значение в регуляции генов. Кроме того антитела обычно поднимаются против нефиксированных пептиды. Таким образом специфичность антитела увеличивается в родной чип. Однако важно иметь в виду, что родной чип применима только для изучения гистонами или других белков, которые плотно связывать ДНК. Этот протокол описывает родной хроматина иммунопреципитации мышиных мозга опухоль neurospheres.

Introduction

Эпигеномные события являются частыми в глиомы и вероятно играть важную роль в патогенезе опухоли. Действительно в педиатрических полноценного глиомы, мутации генов, кодирующих гистона варианты H3.3 и H3.1 часто происходят1. Мутации влияют изменения гистона и имеют крупные эпигенетические последствия2,3. В подростка взрослый спектра рецидивирующий мутации гена isocitrate дегидрогеназа в 1/2 (IDH1/2), мутации, которая тормозит α-кг зависимых гистона и ДНК-де methylasaes и генетические изменения в другие регуляторы хроматина, как ATRX и DAXX происходят 4. Таким образом, оно имеет решающее значение для изучения, как мутации, которые влияют на эпигеномный регуляторы изменить структуру хроматина и регулирования гистона модификации, которые, в свою очередь, имеют сильное влияние опухолевых клеток транскриптом.

Иммунопреципитации Chromatin (обломока) является мощным инструментом, используемым для оценки влияния эпигеномные изменения в геноме5,6,7. В родной чип хроматина переваривается с Микрококковая Нуклеаза (MNase), immunoprecipitated, с использованием антител против протеина интереса, и затем ДНК очищается от immunoprecipitated хроматина комплекс6. Клетки не устанавливается во время процедуры, поэтому этот метод применим только для изучения белков, которые тесно взаимодействуют с ДНК6. Отсутствие cross-linking СПИДа специфичность антитела, так как антитела обычно поднимаются против нефиксированных пептидов и белков7. Кроме того так как нет никаких сшивки шаг, это уменьшает шансы установления переходных протеин дна взаимодействий, которые являются неспецифическими и не регулирования в7,8. Чип может использоваться для идентификации обогащения изменения гистона в определенном регионе геномной. Здесь мы подробно протокол для выполнения родной чип в neurospheres (NS) генерируется из генетически инженерии мыши модели глиомы.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все методы, описанные здесь были одобрены институциональный уход животных и использование Комитет (IACUC) из университета штата Мичиган.

1. поколение опухоли мозга НС и культивирования условий.

  1. Подготовьте среднего нервных стволовых клеток (НСК) с Дульбекко изменение Eagle среднего/F12B27 дополнение (1 x), N2 дополнение (1 x) и противомикробные реагента. Дополнение НСК среднего в день использования с человеческого рекомбинантного эндотелиальный фактор роста (EGF) и basic фибробластический фактор роста (ФБП) в конечной концентрации 20 нг/мл каждый.
  2. Вызвать опухоль мозга мыши, используя Спящая красавица transposon системы, в которой вводится плазмид кодирования онкогенов или индуцируемый ориентации супрессоров в боковых желудочков новорожденных для создания спонтанной мозга опухоли9. Выберите мышь с большой опухоли, что подтверждается с работой с биолюминесценции образами.
    Примечание: Можно найти более подробную информацию о конструкции Спящая красоты Transposon системы и плазмиды, используемые в Кэлинеску и др. 9.
    1. Чтобы изображение мышей, придать 100 мкл раствора люциферин 30 мг/мл, внутрибрюшинно с помощью 26 иглы.
    2. 5 мин после инъекции люциферин, анестезировать животное, используя камеру анестезии с потока кислорода/изофлюрановая равным 2% изофлюрановая.
    3. Когда животные находятся под наркозом (обычно 2-3 мин), место животных в зале биолюминесценции с кислородом изофлюрановая равным 2% изофлюрановая. Если животные будет под наркозом дольше 5 минут, используйте глазная мазь для предотвращения сухости во время под наркозом.
    4. Изображение мышей, с использованием в vivo оптических изображений системы со следующими параметрами: автоматической экспозиции, большой биннинга и диафрагмы f = 1. Значение параметра считать большой опухоли — биолюминесценции > 10 /sr6 фотоны/s/см2.
  3. Усыпить мышь с передозировкой изофлюрановая ингаляционного анестетика в закрытой камере, проверьте, щепотка мыс, что животное наркозом и обезглавить мыши.
  4. Экстракт мозга и вскрыть его, как описано ранее в Кэлинеску и др. 9.
  5. Место мозга в 10 см Петри. Если опухоли индуцированные выражает флуоресцентный белок, использовать люминесцентные, рассекает микроскопом набор соответствующий канал флуоресцентные и 0,3 X увеличение, иначе определить массу опухоли на различия в ткани цвета и текстуры. Используйте скальпель и щипцы для разделения опухолевой ткани от нормального мозга.
  6. Фарш опухоли на мелкие кусочки в чашке Петри. Место расчлененных опухоли в 1,5 мл трубку с 300 мкл НСК среды.
  7. Используйте одноразовые пластиковые гранулы пестик, который подходит к стенкам трубки конические microcentrifuge нежно гомогенизировать опухоли. Добавьте 1 mL клеток отряд среды и Проинкубируйте образцы для 5 минут при 37 ° C.
    Примечание: Использование пестиком могут убить некоторых клеток. Если читатель хочет максимизировать жизнеспособность клеток, использование пестиком может быть пропущена.
  8. Передайте суспензию клеток от шаге 1.7 через стрейнер ячейки 70 мкм и мыть сито с 25 мл среды НСК.
  9. Центрифуга для подвески на 300 g x 5 мин при комнатной температуре, сцеживаться супернатант и вновь приостановить гранулы в 6 мл среды НБК.
  10. Пластина суспензию клеток опухоли из шага 1.9 в T-25 колбу культуры и культуры при 37 ° C в инкубатор культуры ткани с атмосферой 95% воздуха и 5% CO2. Обычно после 3 дней будет смесь некоторых мертвых клеток, придерживался клеток и некоторых клеток, образующих NS, которые плавают в среде.
  11. Передача в коническую пробирку 15 мл суспензии клеток, собирать только те ячейки, которые опускаться на дно с помощью микропипеткой и повторно пластины их на колбе культуры ткани T-75.
  12. Сохранить клетки на относительно высокой плотности (1-3 Х 106 клеток в T-25). Проход клеток, когда они вырожденная.
    Примечание: Confluency определяется размер сферы. Черный центров больших сферах означает что есть мертвых клеток в центре и указывают, что клетки должны быть пассированной немедленно.
  13. Добавьте факторы роста (EGF и basic ФБП; 20 нг/мл) каждые три дня. Изменение среднего когда клетки не притока и средних поворотов оранжевый свет.
  14. Чтобы изменить носитель, собирать старые среднего и центрифуги на 300 x g при комнатной температуре в течение 5 минут и вновь приостановить Пелле клеток в среде НБК, дополненная EGF и ФБП в концентрации, указанные в шаге 1.1.
    Примечание: Если сферы находятся в середине-высокой confluency, но не готовы быть пассированной (сфера размер мал с диаметром < 100 мкм), то гранулы могут быть разделены на две фляги.
  15. Для прохода клетки, центрифуга клетки на 300 g x 5 мин при комнатной температуре, декантируют супернатант и инкубации клеток в среде отряд ячейки для 5 минут при 37 ° C.
    1. Добавьте 5 мл сбалансированного солевого раствора разбавить отряд среднего и центрифуги на 300 g x 5 мин при комнатной температуре.
    2. Декант супернатанта, Ресуспензируйте Пелле клеток в 18 мл среды НСК и поровну разделить подвеска три колбы T-25.
  16. Чтобы заморозить аликвоты клеток, разбить ячейки как шаг 1.15 и заморозить клеток в 1 мл аликвоты плода бычьим сывороточным 90% с 10% диметилсульфоксида. Медленно остыть клетки, поместив клетки на льду за 10 мин, затем клеток-20 ° C на 30 мин и -80 ° C за 1 день. Следующий день, передачи клетки в контейнер для хранения жидкого азота.

2. родной чип

  1. Подготовка хроматину
    1. После внесения запас производных NS, культура NS в T-75 в 15 мл среды НСК при 37 ° C в инкубатор культуры ткани с атмосферой воздуха 95% и 5% CO2 до тех пор, пока NS стать вырожденная. Одна пластина вырожденная T-75 принесут 3-5 Х 106 клеток.
    2. Когда клетки становятся вырожденная, центрифуга NS на 300 g x 5 мин, декантируют супернатант и добавьте 1 mL среды диссоциации клеток. Инкубировать клетки при 37 ° C за 5 минут добавить 5 мл среды и подсчитать количество ячеек с помощью Горяева10.
      Примечание: 1 x 106 клеток необходимы в иммунопреципитации (IP) реакции. Обратите внимание, что предварительно иммунной сыворотки или IgG управления также должны быть включены11.
    3. Центрифуга NS в одной из труб microcentrifuge 1,5 мл на 300 x g 5 мин, сцеживаться супернатант и вновь приостановить NS лепешка с 1 мл раствора сбалансированного солевого раствора и передать низкопротеиновое привязки 1.5 мл пробирок microcentrifuge подвеска.
    4. Центрифуга NS на 300 x g 5 мин, декантируют супернатант и вновь приостановить Пелле клеток в 95 мкл буфера пищеварения (50 мм трис-HCl, рН 8,0, 1 мм2CaCl, 0,2% полиэтиленгликоль octylphenyl эфира) за 1 х 106 клеток дополнена протеазы ингибитор коктейль в высокой концентрации (1: 100). Сразу же накапайте клетки вверх и вниз для предотвращения слипания и избегать создания любые пузыри.
    5. Ресуспензируйте MNase в 50% глицерина сделать решение 1 мг/мл (1,15 единиц/мкл, хранятся при температуре-20 ° C), которое будет называться как «1 x» запас. Сделать «0.1 x» складе, делая второй разбавления 1:9 с 50% глицерина (например., 900 мкл «1 x» MNase и 100 мкл 50% глицерина) и хранить его при-20 ° C.
    6. Смешайте 5 мкл «0.1 x» MNase и 145 мкл буфера пищеварения. Держите фермента на льду все времена. 5 мкл разбавленного MNase, в буфере пищеварение за 1 х 106 клеток. Флик трубки смешивать и поместить трубку в блоке 37 ° C для ровно 12 мин процесс образцы один одновременно для обеспечения точной инкубации время 12 мин.
    7. 10 мкл 10 x MNase остановить буфера (110 мм трис-HCl, рН 8,0, ЭДТА 55 мм) за 1 х 106 клеток. Образцы должны храниться на льду с этого момента.
    8. Мкл 110 «2 x RIPA буфер» (280 мм NaCl, octylphenyl эфиром полиэтиленгликоля 1,8%, 0,2% лаурилсульфат натрия (SDS), 0,2% Na Дезоксихолат, 5 мм этиленгликоля bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic кислота (EGTA); хранить при 4 ° C) дополнена Ингибитор протеазы коктейль при высокой концентрации (1: 100) за 1 х 106 клеток. Флик трубки смешивать.
    9. Центрифуга для трубы 15 мин в отцентрифугировать на 4 ° C и 1700 x g. супернатант передать новые регулярные 1,5 мл microcentrifuge трубы (низкопротеиновое привязки microcentrifuge трубы больше не нужны) и хранить их на льду. Выбросите гранулы.
  2. Иммунопреципитация (IP)
    1. Смешайте белок и белок G магнитные бусы в соотношении 1:1. Для каждого IP-адреса готовить 25 мкл бисера.
    2. Вымойте бисер, добавив 1 мл Буфер RIPA (10 мм трис рН 8,0, 1 мм ЭДТА, 140 NaCl, 1% полиэтиленгликоль octylphenyl эфира, 0.1% SDS, 0.1% Na Дезоксихолат; хранить при 4 ° C) дополняют ингибиторы протеазы в низкой концентрации (1: 1000).
    3. Используйте магнит, чтобы позволить бусы отделяться от моющего раствора и декантировать моющий раствор (примерно 1 мин). Выполните шаг мыть дважды.
    4. Вновь приостановите бусы для исходного тома, используя буфер RIPA, дополняют ингибиторы протеазы (1: 1000).
    5. При необходимости, разбавляют хроматина, используя буфер RIPA, дополняют ингибиторы протеазы (1: 1000), так что каждый IP имеет объем 100-200 мкл. зарезервировать 10% от объема используется для ввода одного IP хроматина.
      Примечание: К примеру, если на IP используются 200 мкл, 20 мкл разбавленного хроматина должны быть зарезервированы для ввода. Для в общей сложности четыре IPs объем всего хроматина должны быть ослаблены 820 мкл.
    6. Подготовьте входные данные. Добавьте 100 мкл буфера TE (10 мм трис-HCl рН 8,0, ЭДТА 1 мм) дополнены протеиназы K (0.5 мг/мл) на вход и инкубировать входных данных при температуре 55 ° C за 1 ч.
      Примечание: Шаги 2.2.6-2.2.7 могут выполняться наряду с шаги 2.3.4 и 2.4.1.
    7. Очистить входные данные с помощью ПЦР очистки комплект инструкций изготовителя и элюировать в 50 мкл буфера комплекта.
    8. Измерить концентрацию ввода, с помощью microvolume спектрофотометром и записывать результаты в записной книжке. Пустой с Элюирующий буфер из комплекта.
      Примечание: В neurospheres мыши, мы использовали примерно 6 мкг ДНК для каждого IP-адреса.
    9. Запуск ввода на гель 1% или загрузить 1 мкл на Bioanalyzer ДНК, с использованием стандартных параметров. Храните остаток для использования в качестве входных данных в нисходящие приложения.
    10. Добавить 10 мкл промывают белка A & G магнитные бусы для каждого IP-адреса и IP инкубировать 1 час при 4 ° C.
      Примечание: К примеру, добавьте 30 мкл белка A & G магнитные бусы для трех IPs.
    11. Поместите образцы на магнит и позволить бусы для разделения. Разделите хроматина, ранее определяется сумма перевода в новый 1,5 мл трубку.
    12. Добавьте антитела и заверните колпачки пластиковые парафин пленкой во избежание испарения. Проинкубируйте образцы на ночь при 4 ° C с вращением на 20 об/мин.
      Примечание: Концентрация должна определяться эмпирически рекомендациям производителя.
    13. Следующий день, спин трубы с помощью мини-центрифуга при комнатной температуре, 2000 x g, 10 s. Затем 10 мкл бусы для каждого IP-адреса и IP Инкубируйте 3 ч при температуре 4 ° C с вращением на 20 об/мин.
  3. IP моет и переваривания белка
    1. 150 мкл Буфер RIPA, дополняют ингибиторы протеазы в низкой концентрации (1: 1000) для каждого IP-адреса и Инкубируйте IP на 4 ° C с вращением на 20 об/мин за 5 минут место образца на магнитную подставку и магнитные бусы для разделения. Чтобы удалить супернатант используйте пипетки. Повторите это пять моет ТЭП.
    2. Добавить 150 мкл буфера LiCl (250 мм LiCl, 10 мм трис рН 8,0, 1 мм ЭДТА, 0,5% NP-40, 0,5% Na Дезоксихолат; хранить при 4 ° C) дополняют ингибиторы протеазы в низкой концентрации (1: 1000) для каждого IP-адреса и Инкубируйте IP на 4 ° C с вращением на 20 об/мин за 5 минут место образца на магнитные стоять и позволяют магнитные бусы для разделения. Чтобы удалить супернатант используйте пипетки.
    3. 150 мкл холодной TE (не ингибиторы протеазы) и инкубации образца при температуре 4 ° C с вращением на 20 об/мин за 5 минут место образца на магнитную подставку и магнитные бусы для разделения. Чтобы удалить супернатант используйте пипетки.
    4. После окончательной стирки шага, вновь приостановить образца в 100 мкл буфера TE дополнена протеиназы K (0.5 мг/мл) и инкубации образца при температуре 55 ° C за 1 ч.
  4. Очистка ДНК и чип количественного PCR реального времени (ПЦР)
    1. Очищайте immunoprecipitated ДНК, используя комплект для очистки ПЦР. После добавления ДНК привязки буфера из комплекта для каждого образца Поместите трубку на магнит и ждать, пока магнитные бусы щебня, затем передать супернатант в столбце очистки. Следуйте инструкциям производителя и элюировать в 50 мкл буфера комплекта.
    2. Чтобы проверить, если IP является успешным, выполните ПЦР. В идеале грунтовки должны быть разработаны для регионов положительной и отрицательной контроля.
      Примечание: например, для IP выступал с H3K4me3 и H3K27me3, следующие примеры должны выполняться на ПЦР: H3K4me3, H3K27me3 и IgG чип ДНК, ввод ДНК, а не шаблон элемента (NTC) с праймерами для регионов обогащаться с H3K4me3 (положительный контроль) и регионах обогащаться с H3K4me3 (отрицательный контроль); Аналогичным образом для H3K27me3.
    3. Выполните стандартные протоколы для выполнения ПЦР12. Короче говоря выполняйте ПЦР, используя зеленый Мастер микс SYBR, 0.5 мкл 10 мкм рабочей концентрации каждого прямого и обратного грунтовка и 2 мкл рабочего раствора микросхемы или ввода ДНК. Прочитано пластины с помощью ПЦР в режиме реального времени системы. Грунтовка последовательности приведены в таблице 2. Gapdh грунтовка последовательности от Хван и др. были используемые13.
    4. Анализировать чип данных по отношению к входу, то есть процент ввода метода (% IP)14. Рассчитайте процент ввода, используя следующие формулы:
      Скорректированы ввода = среднее ct (вход)-вход2(DF)
      где DF является коэффициент разбавления начального ввода и
      DF = общий объем IP / объем ввода
      % IP = 100 × 2 ^ (с учетом ввода - Ct (IP))
      где КТ-коэффициент порогового значения.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Схематическое представление NS, созданные от опухоли головного мозга, где клетки опухоли мозга являются Катюшка позитивные опухоли представлена на рисунке 1. На рисунке 2 это схематическое представление всей техники чип. Рисунок 3 показывает представитель результаты хроматина от опухоли мозга НС переваривается с MNase для 12 мин, уступая большинство моно, ди- и tri нуклеосом. После чип, ПЦР может выполняться на чипе и ввода ДНК образцов. Рисунок 4 показывает репрезентативных данных ПЦР чип от ПЦР для Глицеральдегид-3-фосфат-дегидрогеназы (Gapdh). GAPDH-это уборка ген, который обогащен H3K4me3, модификация, которая связана с активной транскрипции. Результаты показывают, что Gapdh обогащено с H3k4me3 и не обогащаются с H3K27me3, который представляет собой модификацию, связанные с регионами репрессированных хроматина.

Figure 1
Рисунок 1: схема опухоли NS, полученные позитивные опухоль Катюшка. Яркие области и флуоресцентного изображения мозга, добываемых из мыши, которые находятся на стадии конечной точки. Опухоль область очерчена пунктирной линией и является положительным для флуоресцентных репортер, Катюшка. Опухоль становится изолированным и опухолевой ткани собирается в 1,5 мл. Клетки затем отделить и культивировали в НСК среднего и опухоли NS форме. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Схематическое представление рабочего процесса для родной чип. Опухоль NS культивировали и расширена. Каждый IP осуществляется с 1 X 106 клеток. Хроматин фрагментирована с помощью, пищеварение MNase для получения моно-, ди-и tri нуклеосом. Хроматин инкубировали с антител специфических для изменения гистона или ДНК связанный протеин интереса. Антитела ДНК комплекс является immunoprecipitated с магнитной протеина A/G бисером. Наконец белок переваривается и ДНК очищается для получения только ДНК, обогащенный изменения гистона или ДНК связанный протеин интереса. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: фрагментации хроматина, MNase. Хроматин был подготовлен от опухоли мозга НС путем добавления MNase и инкубации при 37 ° C точно 12 минут представитель ДНК результаты Bioanalyzer анализа входной выборки показывают, что большинство ДНК были раскололась на моно-, ди- и три- нуклеосом. Переулок 1 это лестница в пар оснований (ВР). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: представитель чип ПЦР данные представлены как процент ввода. ПЦР была выполнена с IgG, H3K4me3 и H3K27me3 чип ДНК с помощью грунтовки для Глицеральдегид-3-фосфат-дегидрогеназы (Gapdh). Представитель результаты показывают, что только Gapdh, ген уборки, обогащен H3K4me3 изменения, связанные с активной транскрипции и не H3K27me3 изменения, связанные с репрессированных хроматина. Этот график представляет результаты двух биологических экспериментов, проведенных с тремя реплицировать скважин. Планки погрешностей представляют Среднеквадратичная ошибка среднего значения (SEM). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Джин Форвард грунтовка Обратный грунтовка
GAPDH TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Таблица 1: Праймеры используются для чипа ПЦР экспериментов. В этой таблице предоставляются последовательности для грунтовки для Gapdh.

средняя Ct (вход) Стандартное отклонение Скорректированные ввода
24.265 0,071 20.943
Процент ввода
Пример Сырье означает Ct Стандартное отклонение Процент ввода = 100 * 2 ^ (с учетом input-Ct(IP))
IgG 32.23 0,112 0,04
H3K4me3 22.148 0,128 43,37
H3k27me3 32.79 0,519 0,027
NTC не определено не определено не определено

Таблица 2: пример расчета процентов входной метод для анализа ПЦР чип. Пример расчета процентов ввода для чипа, выступал с 10%, начиная с ввода; DF = 10. Цифры в этой таблице иллюстрируют необработанные значения один биологический эксперимент с 3 репликации выполнения скважин для каждого образца.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Протокола, представленные здесь позволят пользователю выполнять родной чип на NS, производный от опухоли мозга генной инженерии. В отличие от сшивки чип, этот протокол ограничен для изучения белков, которые тесно связывают с ДНК6. Количество ячеек, которые используются может быть изменена в случае необходимости и протокол можно вычислить по маштабу. Мы использовали 1 Х 106 клеток / IP, однако, родной чип может также осуществляться с как мало, как 10 x 44 клетки5. В этом протоколе мы проанализировали чип ДНК через ПЦР; Однако этот протокол может также сочетаться с следующего поколения последовательности для изучения взаимодействий протеин дна на широком уровне генома. Мы использовали этот протокол чип успешно проанализировать влияние глиомы онкогенов на осаждения изменения гистона в конкретных регионах генома клетки опухоли.

Есть несколько важных шагов при выполнении родной чип. Во-первых пищеварение условий для каждого типа клеток должен решаться эмпирически. Большинство хроматина должно быть моно нуклеосом (150 bp) с некоторыми di - и tri нуклеосома пиков (рис. 3). Наш протокол результатов в более чем 70% моно-, ди-или tri нуклеосома пиков, однако, некоторые непереваренных ДНК остается. Если протокол будет использоваться для чип seq, потребуются дополнительные шаги для удаления непереваренных ДНК. Кроме того важно иметь в виду, что каждая партия MNase приобрели может отличаться в деятельности и поэтому требуют оптимизации условий пищеварение. Во-вторых качество чипа сильно зависит от специфичность антитела, используемые11. Антитело чип высокого качества должны иметь высокую реакционную способность в отношении намеченной цели и низкой перекрестной реактивности с других белков, ДНК связанные или отключение изменения гистона цели11. По этой причине мы рекомендуем тестирование специфичность антитела, с помощью теста привязки пептид. Руководящие принципы кодирования предположить, что десятикратный обогащения должно соблюдаться для модификации интерес относительно других модификаций11. Важно также выполнить необходимый контроль immunoprecipations, т.е., предварительно иммунной или управления IgG. Когда эти соображения будут выполнены, родной чип данных является сильным надежный метод для изучения эпигенетические механизмы, регулируется взаимодействий протеин дна.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgements

Эта работа была поддержана национальных институтов из здравоохранения/Национальный институт от неврологических расстройств и инсульта (NIH/NINDS) гранты R37-NS094804, R01-NS074387, R21-NS091555 до M.G.C.; NIH/NINDS предоставляет R01-NS076991, R01-NS082311 и R01-NS096756 P.R.L.; NIH/NINDS R01-EB022563; Кафедра нейрохирургии; Лии Happy Hearts и Чад хотя Фонд M.G.C. и P.R.L. РНК биомедицины Грант F046166 в M.G.C. F.M.M. поддерживается путем F31 NIH/NINDS-F31NS103500. R.I.Z.-V. поддерживается NIH / NIGMS Грант 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics