כרומטין יליד Immunoprecipitation באמצעות המוח מאתר הגידול Neurospheres

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

מנגנוני epigenetic משתנים לעתים קרובות ב glioma. כרומטין immunoprecipitation יכול לשמש כדי לחקור את ההשלכות של שינויים גנטיים ב glioma הנובעות משינויים שינויים היסטון המסדירה שעתוק גנים ומבנה כרומטין. פרוטוקול זה מתאר כרומטין יליד immunoprecipitation על המוח מאתר הגידול neurospheres.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

שינויים epigenetic עשוי להיות מעורב של התפתחות והתקדמות של glioma. שינויים מתילציה וכן acetylation של היזמים ואזורים הרגולציה של oncogenes, מדכאי הגידול יכול להוביל שינויים בביטוי הגנים, יש תפקיד חשוב בפתוגנזה של גידולים במוח. כרומטין מקורי immunoprecipitation (ChIP) היא טכניקה פופולרית המאפשרת זיהוי שינויים או חלבונים אחרים הלחוצים ל- DNA. בניגוד לשבב צולבים, יליד שבב, התאים לא מטופלים עם פורמלין לקשר covalently חלבון ל- DNA. זה יתרון כי לפעמים crosslinking עלולה לתקן את החלבונים בלבד transiently אינטראקציה עם ה-DNA, אין משמעות תפקודית הכונה. בנוסף, בדרך כלל גדלים נוגדנים נגד פפטידים מבולבל. לכן, ירידה לפרטים נוגדן מתגברת בשבב מקורית. עם זאת, חשוב לזכור כי השבב יליד ישימה רק ללמוד שינויים היסטוניים או חלבונים אחרים בחוזקה לאגד את הדנ א. פרוטוקול זה מתאר את immunoprecipitation כרומטין מקורית על המוח מאתר הגידול neurospheres.

Introduction

אירועים epigenetic שכיחים ב gliomas, סביר לשחק תפקיד חשוב בפתוגנזה הגידול. אכן, ילדים glioma בדרגה גבוהה, מוטציות בגנים קידוד היסטון גרסאות H3.3 ו- H3.1 מתרחשים לעתים קרובות1. מוטציות משפיעות על שינויים היסטון ויש השלכות epigenetic הגדולות2,3. הנער המתבגר לקשת למבוגרים, חוזרים ונשנים מוטציות בגן isocitrate דהידרוגנאז 1/2 (IDH1/2), מוטציה אשר מעכב α-ק ג היסטון תלויים ו- DNA דה-methylasaes, שינויים גנטיים של הרגולטורים כרומטין אחרים כגון ATRX ו- DAXX מתרחשים 4. לכן, יש חשיבות קריטית כדי ללמוד איך מוטציות המשפיעות על הרגולטורים epigenetic לשנות הכרומטין ושינויים רגולטוריים היסטון, אשר, בתורו, יש השפעה דרמטית של transcriptome של תאי הגידול.

Immunoprecipitation כרומטין (ChIP) הוא כלי רב עוצמה המשמש כדי להעריך את ההשפעה של שינויים epigenetic הגנום6,5,, או7. בצ'יפ מקורי, כרומטין מתעכלת עם נוקלאז micrococcal (MNase), immunoprecipitated באמצעות נוגדן שהועלו כנגד החלבון של עניין, ולאחר מכן הדנ א הוא מטוהרים מורכבים כרומטין6immunoprecipitated. התאים אינם מתוקנים במהלך ההליך אז טכניקה זו ישימה רק לצורך המחקר של חלבונים המקיימים אינטראקציה באופן הדוק עם דנ א6. העדר cross-linking עזרי נוגדן ירידה לפרטים מאז נוגדנים גדלים בדרך כלל נגד פפטידים או חלבונים מבולבל7. בנוסף, מכיוון שאין שום צעד cross-linking, זה מפחית את הסיכוי של תיקון אינטראקציות חלבון-אן ארעי, כי הם לא ספציפית ותקינה לא7,8. שבב יכול לשמש כדי לזהות את העשרת של היסטון שינויים באזור גנומית מסוים. כאן, אנו מפרטים פרוטוקול עבור ביצוע צ'יפ מקורי ב- neurospheres (NS) המופקים גנטית מהונדסים העכבר מודלים של glioma.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל השיטות המתוארות כאן אושרו על ידי טיפול בעלי חיים מוסדיים ועל שימוש הוועדה (IACUC) של אוניברסיטת מישיגן.

1. דור של גידול במוח NS ו culturing תנאים.

  1. להכין בינוני תאי גזע עצביים (המל ל) עם תוספת ששינה נשר בינוני/F12B27 (1 x) של Dulbecco, תוספת N2 (1 x) ו של ריאגנט מיקרוביאלית. תוספת לבטחון לאומי בינוני ביום של שימוש עם האדם רקומביננטי צמיחה אנדותל (EGF), basic-פיברובלסט גורם גידול (FGF)-ריכוז סופי של 20 ng/mL בכל.
  2. זירוז הגידול במוח העכבר באמצעות מערכת transposon היפהפייה הנרדמת בהם פלסמידים קידוד oncogenes או shRNA מיקוד הגידול מדכאי מוזרק לתוך החדרים הצדדיים של neonates ליצירת גידולים במוח ספונטנית9. בחר עכבר עם גידול גדול, אשר אושר עם ביולומינסנציה הדמיה.
    הערה: מידע מפורט יותר אודות המבנה ישן היופי Transposon ומערכת פלסמיד בשימוש ניתן למצוא ב- Calinescu. et al. 9.
    1. לשיקוף העכברים, להזריק 100 µL של 30 מ"ג/מ"ל luciferin פתרון intraperitoneally באמצעות מחט מד 26.
    2. 5 דקות לאחר ההזרקה של luciferin, עזים ומתנגד החיה באמצעות חדר הרדמה עם זרימת חמצן/איזופלוריין מוגדר כ- 2% איזופלוריין.
    3. מתי החיות הם מרדימים (בדרך כלל 2-3 דקות), מקום החיות בבית הבליעה ביולומינסנציה עם חמצן איזופלוריין מוגדר כ- 2% איזופלוריין. אם בעלי החיים תחת הרדמה יותר מ 5 דקות, השתמש משחה אופטלמולוגיות למניעת יובש תוך תחת הרדמה.
    4. תמונה העכברים באמצעות יישום ויוו אופטי הדמיה המערכת עם הפרמטרים הבאים: חשיפה אוטומטית, binning גדול, צמצם f = 1. הפרמטר לשקול את זה גידול גדול הוא ביולומינסנציה > 106 פוטונים/s/ס מ2/sr.
  3. המתת חסד את העכבר עם מנת יתר של שאיפה איזופלוריין הרדמה בחדר סגור, בדוק על ידי צביטה הבוהן כי החיה. הוא מורדם, לערוף את העכבר.
  4. לחלץ את המוח, לנתח את זה. כפי שתואר לעיל ב-. Calinescu et al. 9.
  5. מקם את המוח 10 ס מ פטרי. אם הגידול המושרה מבטאת את החלבון הניאון, שימוש פלורסנט לנתח מיקרוסקופ להגדיר את הערוץ המתאים פלורסנט, 0.3 X הגדלה, לזהות אחרת מסת הגידול על ידי ההבדלים רקמה צבע ומרקם. להשתמש באזמל ומלקחיים כדי להפריד את רקמת הגידול מהמוח נורמלי.
  6. מינצ הגידול לחתיכות קטנות בצלחת פטרי. מקום הגידול ביתור צינור 1.5 מ עם 300 µL של המדיום לבטחון לאומי.
  7. השתמש כבעלי צניפה פלסטיק חד פעמיות מתאימה לקירות של שפופרת חרוט microcentrifuge כדי homogenize בעדינות את הגידול. להוסיף 1 מ"ל של מדיום ניתוק התא, דגירה המדגם למשך 5 דקות ב 37 º C.
    הערה: השימוש כבעלי עלולה להרוג כמה תאים. אם הקורא רוצה למקסם את הכדאיות תא, השימוש כבעלי יכול להיות מושמט.
  8. לעבור התליה תא מ שלב 1.7 דרך מסננת תא מיקרומטר 70 ולשטוף את מסננת עם 25 מ של המועצה לבטחון לאומי בינוני.
  9. Centrifuge את המתלים ב g x 300 במשך 5 דקות בטמפרטורת החדר, decant את תגובת שיקוע, מחדש להשעות את צניפה לתוך 6 מ של המועצה לבטחון לאומי בינוני.
  10. צלחת התליה תא הגידול מהשלב 1.9 לתוך בקבוקון תרבות T-25, תרבות זה ב- 37 מעלות צלזיוס חממה תרביות רקמה עם אווירה של 95% אוויר ו-5% CO2. בדרך כלל לאחר 3 ימים, יהיו תערובת של כמה תאים מתים, מודבקת תאים ותאים קצת ויוצרים NS אשר לצוף, המדיום.
  11. העברת התליה תא לתוך צינור חרוטי 15 מ"ל, לאסוף רק התאים ששוקעים בתחתית באמצעות micropipette, צלחת אותם מחדש לתוך בקבוקון תרביות רקמה T-75.
  12. לשמור על התאים-צפיפות גבוהה יחסית (1-3 X 106 תאים T-25). המעבר את התאים כאשר הם confluent.
    הערה: Confluency נקבע לפי גודל הספירות. שחור מרכזי של כדורים גדולים אומר כי שם הם תאים מתים במרכז ולא מציינים כי התאים צריכים להיות passaged מיד.
  13. הוסף את גורמי גדילה (EGF ו- basic-FGF; 20 ng/mL כל) כל שלושה ימים. לשנות את המדיום כאשר התאים אינם confluent וכתום בהיר את תורות בינוני.
  14. כדי לשנות את המדיום, לאסוף את המדיום הישן centrifuge זה ב g x 300 בטמפרטורת החדר במשך 5 דקות ו מחדש להשעות בגדר תא במדיום לבטחון לאומי בתוספת EGF ו- FGF-ריכוז שצוין בשלב 1.1.
    הערה: אם הכדורים נמצאים באמצע-confluency גבוהה, אך לא מוכנים להיות passaged (בגודל כדור הוא קטן עם מיקרומטר < 100 קוטר), אז בגדר ניתן לחלק את שתי המבחנות.
  15. כדי המעבר את התאים, centrifuge את התאים ב g x 300 במשך 5 דקות בטמפרטורת החדר, decant את תגובת שיקוע, דגירה התאים במדיום ניתוק התא עבור 5 דקות ב 37 º C.
    1. הוסף 5 מ של תמיסת מלח מאוזנת לבינונית ניתוק שתדללו ' centrifuge זה ב g x 300 במשך 5 דקות בטמפרטורת החדר.
    2. Decant את תגובת שיקוע, resuspend בגדר תא ב 18 מ של המועצה לבטחון לאומי בינוני, לחלק את המתלים באותה מידה שלוש מבחנות T-25.
  16. כדי להקפיא את aliquots של תאים, התאים כמו שלב 1.15 מביצועם, להקפיא את התאים aliquots 1 מ"ל של 90% נסיוב שור עוברית עם 10% דימתיל סולפוקסיד. לאט לאט לקרר את התאים על ידי הצבת את התאים על קרח למשך 10 דקות, ואז להשאיר את התאים-20 ° C למשך 30 דקות, ו- 80 ° C עבור יום אחד. למחרת, להעביר את התאים מיכל אחסון בחנקן נוזלי.

2. יליד שבב

  1. הכנה כרומטין
    1. לאחר ביצוע מלאי של NS נגזר, תרבות NS ב T-75 ב- 15 מ"ל של המועצה לבטחון לאומי בינוני-37 מעלות צלזיוס חממה תרביות רקמה עם אווירה של אוויר 95% ו- 5% CO2 עד NS הופכים confluent. לוח T-75 confluent אחד תניב 3-5 X 106 תאים.
    2. כאשר התאים הופכים confluent, צנטריפוגה NS-300 גרם x במשך 5 דקות, decant את תגובת שיקוע והוסף 1 מיליליטר דיסוציאציה תא בינוני. דגירה התאים ב 37 מעלות צלזיוס במשך 5 דק הוסף 5 מ של מדיום ולספור את התאים באמצעות hemocytometer10.
      הערה: עונה 1 פרק 106 תאים נדרשים לכל תגובה immunoprecipitation (IP). שים לב נסיוב החיסון מראש או שליטה IgG חייב גם להיות כלולים11.
    3. Centrifuge את NS בצינור microcentrifuge 1.5 mL אחד ב g 300 x במשך 5 דקות, decant את תגובת שיקוע מחדש להשעות NS גלולה עם 1 מ"ל של תמיסת מלח מאוזנת, להעביר את המתלים חלבון נמוכה איגוד 1.5 mL microcentrifuge צינורות.
    4. NS צנטריפוגה ב 300 x g במשך 5 דקות, decant את תגובת שיקוע ו מחדש להשעות בגדר תא ב- 95 µL עיכול מאגר (50 מ מ טריס-HCl, pH 8.0, 1 מ"מ CaCl2, 0.2% פוליאתילן גליקול octylphenyl) לכל עונה 1 פרק 106 תאים בתוספת פרוטאז מעכב קוקטייל-ריכוז גבוה (1: 100). מיד pipet התאים למעלה ולמטה כדי למנוע clumping, הימנע מיצירת בועות.
    5. Resuspend MNase גליצרול 50% כדי להפוך פתרון 1 מ"ג/מ"ל (1.15 יחידות/µL, המאוחסנים ב-20 ° C) יטופלו כמו "1 x" מניות. להפוך "0.1 x" מניות על-ידי ביצוע לדילול 1:9 השני עם 50% גליצרול (למשל., 900 µL של אקס 1 MNase ו- µL 100 של 50% גליצרול) ואחסן אותו ב-20 ° C.
    6. µL מיקס 5 של "0.1 x" MNase ו- 145 µL עיכול המאגר. שמור את האנזים על קרח כל הזמנים. להוסיף 5 µL של MNase מדולל במאגר העיכול לכל עונה 1 פרק 106 תאים. קפיצי הצינור כדי מערבבים ומניחים את הצינור בבלוק 37 ° C עבור בדיוק 12 מינימלית תהליך הדגימות אחד בכל פעם כדי להבטיח מועד מדויק דגירה של 12 דקות.
    7. להוסיף 10 µL של 10 x MNase לעצור את המאגר (110 מ"מ טריס-HCl, pH 8.0, 55 מ"מ EDTA) לכל עונה 1 פרק 106 תאים. דוגמאות חייב להישמר בקירור, מנקודה זו ואילך.
    8. להוסיף µL 110 "מאגר x RIPA 2" (280 ממ NaCl, octylphenyl כ- 1.8% פוליאתילן גליקול, 0.2% נתרן גופרתי dodecyl (מרחביות), 0.2% נה-deoxycholate, 5 מ מ אתילן גליקול-bis(β-aminoethyl ether)-N, N, N', N'-חומצה tetraacetic (EGTA); מאוחסן ב 4 ° C) בתוספת מעכב פרוטאז קוקטייל-ריכוז גבוה (מטריים) לכל עונה 1 פרק 106 תאים. קפיצי צינור כדי לערבב.
    9. Centrifuge צינורות למשך 15 דקות microfuge ב 4 ° C, g x. 1700 להעביר את תגובת שיקוע mL 1.5 קבוע חדש microcentrifuge צינורות (צינורות microcentrifuge מחייב חלבון נמוכה הם כבר לא נחוץ) ולאחסן אותם על קרח. להתעלם בגדר.
  2. Immunoprecipitation (IP)
    1. מערבבים חלבון A לבין חלבון G beads מגנטי על יחס 1:1. עבור כל IP, להכין µL 25 של חרוזים.
    2. לשטוף את החרוזים על-ידי הוספת 1 מ"ל של מאגר ריפה (10 מ מ טריס pH 8.0, 1 מ"מ EDTA, 140 מ"מ NaCl, 1% פוליאתילן octylphenyl גליקול, 0.1% מרחביות, 0.1% נה-deoxycholate; מאוחסן ב 4 ° C) בתוספת מעכבי פרוטאז-ריכוז נמוך (1:1000).
    3. השתמש מגנט כדי לאפשר חרוזים להפריד בין הפתרון כביסה decant הפתרון כביסה (כ- 1 דקות). בצע את שלב לשטוף פעמיים.
    4. מחדש להשעות את החרוזים לאמצעי האחסון המקורי באמצעות מאגר ריפה בתוספת מעכבי פרוטאז (1:1000).
    5. אם נחוץ, שתדללו כרומטין באמצעות מאגר ריפה בתוספת מעכבי פרוטאז (1:1000) כך כל IP יש נפח של 100-200 µL. שומרים 10% של אמצעי האחסון המשמש לכל ה-IP של כרומטין הקלט.
      הערה: לדוגמה, אם 200 µL משמשים לכל IP, µL 20 של כרומטין מדולל צריך להיות שמורות עבור הקלט. סה"כ ארבעה IPs, נפח כרומטין הכולל צריך להיות מדולל כדי 820 µL.
    6. הכינו את הקלט. להוסיף 100 µL טה מאגר (10 מ מ טריס-HCl pH 8.0, 1 מ מ EDTA) בתוספת proteinase K (0.5 mg/mL) לקלט, דגירה הקלט ב 55 ° C עבור 1 h.
      הערה: ניתן לבצע צעדים 2.2.6-2.2.7 יחד עם שלבים 2.3.4 ו 2.4.1.
    7. לטהר את הקלט באמצעות ערכת טיהור PCR ההוראות של היצרן, elute ב µL 50 • תנאי המאגר שסופק בערכה.
    8. למדוד את הריכוז של הקלט באמצעות ספקטרופוטומטרים microvolume ולהקליט את התוצאות במחברת. ריק עם מאגר • תנאי של קיט.
      הערה: ב- neurospheres העכבר, השתמשנו כ 6 µg של ה-DNA עבור כל ה-IP.
    9. לרוץ קלט על 1% ג'ל או לטעון µL 1 על Bioanalyzer ה-DNA באמצעות הגדרות רגילות. אחסן את השארית לשימוש כקלט ביישומים במורד הזרם.
    10. להוסיף 10 µL של שטף חלבון A & G beads מגנטי עבור כל ה-IP ואת תקופת דגירה IP של h 1-4 מעלות צלזיוס.
      הערה: לדוגמה, להוסיף 30 µL של חלבון A & G beads מגנטי עבור שלוש כתובות ה-Ip.
    11. מניחים את הדוגמאות על מגנט ולאפשר חרוזים להפריד. לחלק כרומטין על ידי העברת הסכום שנקבע בעבר לתוך צינור 1.5 mL החדש.
    12. מוסיפים הנוגדן, לעטוף את כמוסות עם פרפין פלסטיק הסרט כדי למנוע התאיידות. דגירה הדגימות בן לילה ב 4 ° C עם סיבוב על סל ד 20.
      הערה: ריכוז צריך להיקבע מדעית בעקבות המלצות היצרן.
    13. למחרת, ספין הצינורות באמצעות צנטריפוגה מיני בטמפרטורת החדר, 2000 x g, עבור 10 s. לאחר מכן להוסיף 10 µL של חרוזים כל IP, תקופת דגירה IP של h 3-4 ° C עם סיבוב על סל ד 20.
  3. IP שוטף ועיכול חלבון
    1. להוסיף 150 µL מאגר ריפה בתוספת מעכבי פרוטאז-ריכוז נמוך (1:1000) ל- IP כל דגירה IP ב 4 ° C עם סיבוב ב rpm 20 עבור 5 דק המקום המדגם על דוכן מגנטי ומאפשרים את החרוזים מגנטי להפריד. השתמש pipet כדי להסיר את תגובת שיקוע. חזור על זה שוטף חמש tep.
    2. להוסיף 150 µL LiCl מאגר (250 מ מ LiCl, 10 מ מ טריס pH 8.0, 1 מ"מ EDTA, 0.5% NP-40, 0.5% נה-deoxycholate; חנות ב 4 ° C) בתוספת מעכבי פרוטאז-ריכוז נמוך (1:1000) ל- IP כל, דגירה IP ב 4 ° C עם סיבוב ב rpm 20 עבור 5 דק המקום המדגם מגנטי לעמוד ' ואפשר beads מגנטי להפריד. השתמש pipet כדי להסיר את תגובת שיקוע.
    3. להוסיף 150 µL של טה קר (לא מעכבי פרוטאז) דגירה המדגם ב 4 ° C עם סיבוב ב rpm 20 עבור 5 דק המקום המדגם על דוכן מגנטי ומאפשרים beads מגנטי להפריד. השתמש pipet כדי להסיר את תגובת שיקוע.
    4. לאחר השלב הסופי כביסה, מחדש להשעות את הדגימה ב 100 µL טה מאגר בתוספת proteinase K (0.5 mg/mL), דגירה המדגם ב 55 ° C עבור 1 h.
  4. טיהור DNA ו- PCR בזמן אמת כמותיים שבב (qPCR)
    1. לטהר immunoprecipitated הדנ א באמצעות ערכת טיהור PCR. לאחר תוספת של מאגר דנ א איגוד הערכה כדי כל דגימה, הנח את השפופרת על מגנט והמתן עד beads מגנטי צבירה, ואז להעביר את תגובת שיקוע על העמודה ' ניקוי '. בצע הוראות היצרן, elute ב µL 50 • תנאי המאגר שסופק בערכה.
    2. כדי לבדוק אם ה-IP הוא מוצלח, לבצע את qPCR. באופן אידיאלי, תחל צריך להיות מיועד לאזורים בקרה חיובית ושלילית.
      הערה: לדוגמה, עבור IP הופיעה עם H3K4me3 ו- H3K27me3, הדוגמאות הבאות צריכה לפעול על qPCR: H3K4me3, H3K27me3 ואג ChIP הדנ א, קלט דנ א, ו אין תבנית פקד (NTC) באמצעות תחל עבור אזורים כדי להיות מועשר H3K4me3 (בקרת חיובי), אזורים כדי להיות מועשר H3K4me3 (שלילית שליטה); כמו כן, עבור H3K27me3.
    3. בצע פרוטוקולים סטנדרטיים לבצע qPCR12. בקצרה, לבצע qPCR באמצעות SYBR מיקס מאסטר ירוק, 0.5 µL של 10 מיקרומטר עבודה ריכוז כל פריימר ואחורה µL 2 של צ'יפ או קלט את הדנ א. קרא צלחות באמצעות מערכת ה-PCR בזמן אמת. פריימר רצפים ניתנים בטבלה מס ' 2. הרצפים פריימר Gapdh מהואנג ואח. היו בשימוש13.
    4. ניתוח נתונים שבב יחסי הקלט, קרי, אחוז קלט שיטה (% IP)14. לחשב את אחוז קלט באמצעות הנוסחאות הבאות:
      מותאם קלט = ct רשע (קלט)-כניסה2(DF)
      איפה DF הגורם דילול של הקלט המוצא,
      DF = הנפח הכולל של IP / נפח של קלט
      % IP = 100 × 2 ^ (מנוכה קלט - Ct (IP))
      איפה Ct היא הגורם הסף.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ייצוג סכמטי של הגידול NS שנוצר בגלל גידול במוח תאים סרטניים במוח איפה Katushka חיובי מוצג באיור1. איור 2 היא ייצוג סכמטי של הטכניקה שבב כולו. איור 3 מראה התוצאות נציג של כרומטין של גידול במוח NS מתעכל עם MNase למשך 12 דקות, מניב רוב מונו di-, tri-נוקליאוזומים. בעקבות שבב, qPCR ניתן לבצע את השבב, קלט DNA דגימות. איור 4 מציג נתונים qPCR שבב נציג qPCR עבור גליצראלדהיד-3-פוספט דהידרוגנאז (Gapdh). Gapdh הוא גן משק בית כי מועשר H3K4me3, שינוי המשויך שעתוק פעיל. התוצאות הראה כי Gapdh מועשר H3k4me3, לא מועשר עם H3K27me3 אשר הוא שינוי הקשורים מחוזות כרומטין מודחקים.

Figure 1
איור 1: סכימטי של גידול NS שנוצר בגלל גידול במוח חיובית Katushka. שדה בהיר ותמונה פלורסנט של מוח שנקטפו עכבר שהגיעו לשלב נקודת הקצה. אזור הגידול הוא המותווית על ידי הקו המקווקו, והוא חיובי עבור הכתבת פלורסנט, Katushka. הגידול הוא ואז מבודדים ולא רקמת הגידול נאסף צינור 1.5 מ ל. התאים ואז הפומבית, תרבותי בצורה NS בינונית, הגידול לבטחון לאומי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: ייצוג סכמטי של זרימת העבודה עבור השבב מקורי. NS גידול תרבותי, מורחבת. כל IP מתבצעת עם עונה 1 פרק 106 תאים. כרומטין פיצול קבצים באמצעות עיכול MNase להשיג מונו di-, tri-נוקליאוזומים. כרומטין מודגרת עם נוגדן ספציפי עבור שינוי היסטון או חלבון ה-DNA-הקשורים עניין. המתחם נוגדן-DNA הוא immunoprecipitated עם חרוזים A/G פרוטאין מגנטי. לבסוף חלבון מתעכל, DNA מטוהר להשיג רק DNA מועשר שינוי היסטון או חלבון ה-DNA-הקשורים עניין. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: פיצול כרומטין מאת MNase. כרומטין שהיתה מוכנה גידול במוח NS על ידי הוספת MNase, דגירה ב 37 מעלות צלזיוס בדיוק מינימלית 12 נציג תוצאות הדנ א מניתוח Bioanalyzer של דוגמה קלט להדגים כי הרוב המכריע של ה-DNA יש כבר מקוטעת לתוך מונו - di-, tri- נוקליאוזומים. ליין 1 הוא הסולם בזוגות בסיס (BP). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: נציג שבב qPCR נתונים שהוצגו כקלט אחוז. qPCR בוצעה עם IgG, H3K4me3 H3K27me3 ChIP הדנ א באמצעות תחל גליצראלדהיד-3-פוספט דהידרוגנאז (Gapdh). התוצאות נציג מדגימים כי Gapdh, הגן משק בית, רק מועשר של השינוי H3K4me3, הקשורים שעתוק פעיל, ואת לא H3K27me3 השינוי, הקשורים עם כרומטין מודחקים. הגרף הזה מייצג את התוצאות של שני ניסויים ביולוגיים לרוץ עם שלוש בארות שכפל כל. קווי שגיאה מייצגים שגיאת התקן של הממוצע (SEM). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

ג'ין פריימר לפנים פריימר הפוכה
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

טבלה 1: תחל משמש שבב qPCR ניסויים. רצפי תחל משמש Gapdh ניתנים בטבלה זו.

כלומר Ct (קלט) סטיית תקן קלט מנוכי עונתיות
24.265 0.071 20.943
אחוז קלט
מדגם Ct אומר raw סטיית תקן קלט אחוז = 100 * 2 ^ (מותאם input-Ct(IP))
אג 32.23 0.112 0.04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0.027
NTC לא נקבע לא נקבע לא נקבע

בטבלה 2: לדוגמה חישוב האחוזים קלט שיטה לניתוח qPCR שבב. דוגמת חישוב אחוז קלט עבור השבב הופיעה עם 10% החל קלט; DF = 10. המספרים בטבלה זו ממחישים את הערכים raw של הניסוי הביולוגי אחד עם שכפול 3 בארות להפעיל עבור כל דגימה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

פרוטוקול המובאת כאן יאפשר למשתמש לבצע צ'יפ מקורי-NS נגזר גידולים במוח מהונדסים גנטית. בניגוד cross-linking שבב, פרוטוקול זה מוגבל לצורך המחקר של חלבונים המשייכים בחוזקה דנ א6. ניתן לשנות את מספר התאים להשתמש לפי הצורך, וניתן לשנותם הפרוטוקול. השתמשנו עונה 1 פרק 106 תאי ה-IP, עם זאת, יליד שבב גם ניתן לבצע עם מעט ככל 4 x 104 תאים5. ב פרוטוקול זה, ניתחנו ChIP הדנ א באמצעות qPCR; עם זאת, פרוטוקול זה יכול גם להיות משולב עם רצף הדור הבא ללמוד אינטראקציות חלבון-DNA הגנום ברמת רחב. השתמשנו פרוטוקול שבב זה בהצלחה כדי לנתח את השפעת glioma oncogenes על התצהיר של היסטון שינויים בתוך אזורים ספציפיים של הגנום של תאים סרטניים.

ישנם כמה צעדים קריטיים בעת ביצוע צ'יפ מקורי. ראשית, התנאים לעיכול עבור כל סוג התא מדעית להיקבע. הרוב המכריע של כרומטין צריכה להיות מונו-נוקליאוזומים (150 bp) עם כמה שיאים di - ו tri-נוקלאוזום (איור 3). התוצאות פרוטוקול שלנו ביותר מ-70% מונו, di- או תלת-נוקלאוזום פסגות, עם זאת, אנ מעוכל נשאר. אם הפרוטוקול ישמש עבור שבב-seq, צעדים נוספים יידרשו להסיר את ה-DNA מעוכל. בנוסף, חשוב לזכור כי כל אצווה של MNase רכש ייתכן נבדלים פעילות, ולכן דורשים אופטימיזציה של התנאים עיכול. שנית, האיכות של שבב תלויה מאוד יחודיות של הנוגדן בשימוש11. נוגדן שבב באיכות גבוהה צריך תגובתיות גבוהה נגד המטרה המיועדת תגובתיות קרוס נמוך עם חלבונים אחרים הקשורים דנ א או לבטל את היעד היסטון שינויים11. מסיבה זו, אנו ממליצים על בדיקות נוגדנים ירידה לפרטים באמצעות פפטיד מחייב בדיקה. קדד הנחיות מראים כי העשרה ten-fold להתייחס עבור השינוי עניין ביחס אחר שינויים11. חשוב גם לבצע השליטה הנדרשת immunoprecipations, דהיינו, החיסון מראש או שליטה IgG. כאשר שיקולים אלו מתקיימים, יליד שבב נתונים היא שיטה אמינה חזקה ללמוד מנגנוני epigenetic מוסדר על ידי אינטראקציות חלבון-DNA.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgements

עבודה זו נתמכה על ידי נבחרת מוסדות של בריאות/לאומי המכון של הפרעות נוירולוגיות & קו (NIH/NINDS) מענקים R37-NS094804, R01-NS074387, R21-NS091555 כדי M.G.C.; NIH/NINDS מעניקה R01-NS076991 R01-NS082311, R01-NS096756 P.R.L.; NIH/NINDS R01-EB022563; במחלקה הנוירוכירורגית; של לאה לבבות שמח ואת קרן למרות צ'אד M.G.C. P.R.L. RNA וההתערבות גרנט F046166 כדי M.G.C. F.M.M. נתמך על ידי F31 NIH/NINDS-F31NS103500. R.I.Z.-V. הוא נתמך על ידי NIH / NIGMS הענק 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics