Immunoprecipitazione della cromatina nativo utilizzando neurosfere tumore del cervello murino

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Meccanismi epigenetici sono frequentemente alterati nei gliomi. Immunoprecipitazione della cromatina poteva essere utilizzati per studiare le conseguenze delle alterazioni genetiche in glioma risultanti dalle modifiche in modificazioni istoniche che regolano la trascrizione di gene e la struttura della cromatina. Questo protocollo descrive immunoprecipitazione della cromatina nativo su neurosfere tumore del cervello murino.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Modificazioni epigenetiche possono essere coinvolti nello sviluppo e nella progressione del glioma. Cambiamenti nella metilazione e acetilazione dei promotori e regioni regolatorie di oncogeni e soppressori tumorali possono condurre ai cambiamenti nell'espressione genica e svolgono un ruolo importante nella patogenesi dei tumori cerebrali. Immunoprecipitazione della cromatina nativo (ChIP) è una tecnica popolare che permette la rilevazione di modifiche o altre proteine strettamente legate al DNA. Contrariamente a reticolato ChIP, chip nativo, le cellule non sono trattate con formaldeide per collegare covalentemente proteina al DNA. Questo è vantaggioso perché a volte reticolazione può fissare le proteine che solo transitoriamente interagiscono con il DNA e non hanno significato funzionale nella regolazione genica. Inoltre, gli anticorpi vengono generalmente sollevati contro peptidi non fissati. Di conseguenza, specificità dell'anticorpo è aumentata di ChIP nativo. Tuttavia, è importante tenere a mente che è applicabile per studiare gli istoni o altre proteine che legano strettamente al DNA solo ChIP nativo. Questo protocollo descrive l'immunoprecipitazione della cromatina nativo su neurosfere tumore del cervello murino.

Introduction

Eventi epigenetici sono frequenti nei gliomi e probabilmente svolgono un ruolo importante nella patogenesi del tumore. Infatti, in pediatric glioma di alto grado, mutazioni in geni codificanti varianti istone H3.3 e H3.1 si verificano frequentemente1. Le mutazioni riguardano modifiche istoniche e presentano importanti conseguenze epigenetici2,3. Nell'adolescente adulto dello spettro, ricorrenti mutazioni nel gene della Isocitrato deidrogenasi 1/2 (IDH1/2), una mutazione che inibisce la α-KG dipendente degli istoni e DNA de-methylasaes e le alterazioni genetiche in altri regolatori della cromatina come ATRX e DAXX verificano 4. Pertanto, è di importanza critica per studiare come le mutazioni che colpiscono i regolatori epigenetici alterano la struttura della cromatina e modificazioni istoniche normativo, che, a loro volta, hanno un impatto drammatico del trascrittoma delle cellule del tumore.

Immunoprecipitazione della cromatina (ChIP) è un potente strumento usato per valutare l'impatto delle modificazioni epigenetiche nel genoma5,6,7. Nel ChIP nativo, cromatina è digerita con nucleasi di micrococcal (MNase), immunoprecipitati utilizzando un anticorpo contro la proteina di interesse, e quindi il DNA è purificato dal immunoprecipitati cromatina complesso6. Le cellule non sono fissi durante la procedura, quindi questa tecnica è applicabile solo per lo studio delle proteine che interagiscono strettamente con DNA6. L'assenza di cross-linking aiuta la specificità dell'anticorpo poiché gli anticorpi solitamente vengono sollevati contro peptidi o proteine unfixed7. Inoltre, poiché non vi è alcun passaggio di cross-linking, ciò riduce le possibilità di fissaggio interazioni proteina-DNA transitoria che sono aspecifici e non normativo7,8. Circuito integrato può essere utilizzato per identificare l'arricchimento delle modificazioni istoniche in una specifica regione genomica. Qui, abbiamo dettaglio un protocollo per l'esecuzione di ChIP nativo in neurosfere (NS) generato da geneticamente ingegnerizzati modelli murini di glioma.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti i metodi descritti qui sono stati approvati dal istituzionale Animal Care e uso Committee (IACUC) dell'Università del Michigan.

1. generazione di tumore cerebrale NS e condizioni di coltura.

  1. Preparare mezzo di cellule staminali neurali (NSC) con supplemento per volta Eagle Medium/F12B27 (1x) di Dulbecco, supplemento N2 (1x) e un reagente di antimicrobici. Supplemento media NSC il giorno di utilizzo con fattore di crescita endoteliale ricombinante umano (EGF) e basic-fibroblast growth factor (FGF) ad una concentrazione finale di 20 ng/mL.
  2. Indurre il tumore di cervello in mouse utilizzando il sistema di trasposone Sleeping Beauty in cui codifica oncogeni o soppressori tumorali di targeting shRNA plasmidi viene iniettati nei ventricoli laterali dei neonati per generare i tumori di cervello spontanea9. Selezionare un mouse con un grande tumore, che è confermato con formazione immagine di bioluminescenza.
    Nota: Informazioni più dettagliate sui costrutti dello Sleeping Beauty trasposone System e plasmide usato reperibile in Calinescu et al. 9.
    1. Per realizzare l'immagine i topi, iniettare 100 µ l di soluzione di luciferina 30mg/mL intraperitonealmente utilizzando un ago di 26 calibro.
    2. 5 min dopo l'iniezione di luciferina, anestetizzare l'animale utilizzando una camera di anestesia con flusso di ossigeno/isoflurano impostata su 2% isoflurane.
    3. Quando gli animali sono anestetizzati (solitamente 2-3 min), sistemare gli animali nella camera di bioluminescenza con isoflurano ossigeno impostata su 2% isoflurane. Se gli animali saranno sotto anestesia per più di 5 min, è possibile utilizzare un unguento oftalmico per prevenire la secchezza mentre nell'ambito dell'anestesia.
    4. I topi utilizzando un in vivo sistema con i seguenti parametri di imaging ottico di immagine: esposizione automatica, grande binning e diaframma f = 1. Il parametro a considerarlo un grande tumore è un bioluminescenza > 106 fotoni/s/cm2/sr.
  3. Eutanasia il mouse con un overdose di inalazione isoflurane anestetico in una camera chiusa, di pizzico di punta che l'animale è anestetizzato e decapitare il mouse.
  4. Estrarre il cervello e sezionarla come descritto in precedenza in Calinescu et al. 9.
  5. Mettere il cervello in un 10cm di Petri. Se il tumore indotto esprime una proteina fluorescente, uso un fluorescenti microscopio per dissezione impostato il canale fluorescente appropriato e ingrandimento 0,3 X, altrimenti identificare massa tumorale delle differenze in tessuto colore e texture. Utilizzare bisturi e pinze per separare il tessuto del tumore dal cervello normale.
  6. Tritare il tumore a pezzetti nel piatto Petri. Posto il tumore sezionato in una provetta da 1,5 mL con 300 µ l del mezzo NSC.
  7. Utilizzare un pestello di pallina di plastica usa e getta che si adatta alle pareti di un tubo del microcentrifuge conico per omogeneizzare delicatamente il tumore. Aggiungere 1 mL di medium di distacco cellulare e incubare il campione per 5 min a 37 ° C.
    Nota: L'uso di un pestello può uccidere alcune cellule. Se il lettore vuole massimizzare l'attuabilità delle cellule, può essere omesso l'uso di un pestello.
  8. Passare la sospensione cellulare passaggio 1.7 attraverso un colino di cella 70 µm e lavare il filtro con 25 mL di terreno di NSC.
  9. Centrifugare la sospensione a 300 x g per 5 min a temperatura ambiente, decantare il supernatante e risospendere il pellet in 6 mL di terreno di NSC.
  10. Piastra di sospensione delle cellule del tumore dal passaggio 1,9 in un matraccio di cultura T-25 e cultura e a 37 ° C in un incubatore di coltura del tessuto con un'atmosfera di 95% aria e 5% CO2. Di solito dopo 3 giorni, ci sarà una miscela di alcune cellule morti, rispettati e alcune cellule che formano NS che galleggiano nel mezzo.
  11. Trasferire la sospensione cellulare in una provetta conica da 15 mL, raccogliere solo le celle che si depositano sul fondo utilizzando una micropipetta e ri-impiattatelo su un pallone di coltura del tessuto T-75.
  12. Mantenere le cellule relativamente ad alta densità (1-3 X 106 cellule in un T-25). Passaggio delle cellule quando sono confluenti.
    Nota: Confluency è determinata dalla dimensione sfere. Nero centri di grandi sfere significa che ci sono cellule morte nel centro e indicano che le cellule devono essere attraversate immediatamente.
  13. Aggiungere i fattori di crescita (EGF e basic-FGF; 20 ng/mL) ogni tre giorni. Modificare il mezzo quando le celle non sono confluenti e i giri medi luce arancione.
  14. Per modificare il mezzo, raccogliere il vecchio mezzo ed e centrifugare a 300 x g e a temperatura ambiente per 5 min e risospendere il pellet cellulare in NSC supplementato con EGF e FGF alla concentrazione specificata nel passaggio 1.1.
    Nota: Se le sfere sono a metà-alto confluency, ma non è pronto per essere attraversate (sfera dimensione è piccola, con un diametro < 100 µm), poi il pellet può essere suddiviso in due boccette.
  15. Per le cellule del passaggio, centrifugare le cellule a 300 x g per 5 min a temperatura ambiente, decantare il supernatante e incubare le cellule in medium distacco cellulare per 5 min a 37 ° C.
    1. Aggiungere 5 mL di soluzione salina bilanciata per mezzo di distacco diluito ed e centrifugare a 300 x g per 5 min a temperatura ambiente.
    2. Decantare il supernatante, risospendere il pellet cellulare in 18 mL di terreno di NSC e divide la sospensione ugualmente in tre boccette di T-25.
  16. Per bloccare le aliquote delle cellule, dissociare le cellule come descritto al punto 1.15 e congelare le cellule in aliquote di 1 mL di siero bovino fetale di 90% con 10% di dimetilsolfossido. Raffreddare lentamente le cellule di immissione le cellule sul ghiaccio per 10 min, quindi mantenendo le cellule da-20 ° C per 30 min e -80 ° C per 1 giorni. Il giorno successivo, trasferire le cellule a un contenitore di stoccaggio di azoto liquido.

2. nativo ChIP

  1. Preparazione della cromatina
    1. Dopo aver fatto scorta di NS derivata, cultura NS in un T-75 in 15 mL di terreno di NSC a 37 ° C in un incubatore di coltura del tessuto con un'atmosfera di aria 95% e 5% CO2 fino a NS diventano confluenti. Una piastra di T-75 confluente resa di 3-5 X 106 celle.
    2. Quando le cellule diventano confluenti, centrifugare NS a 300 x g per 5 min, decantare il supernatante e aggiungere 1 mL di medium di dissociazione del cellulare. Incubare le cellule a 37 ° C per 5 min. aggiungere 5 mL di terreno e contare le celle utilizzando un emocitometro10.
      Nota: 1 x 106 cellule sono necessarie per reazione di immunoprecipitazione (IP). Si noti che un siero pre-immune o IgG controllo deve inoltre essere incluso11.
    3. Centrifugare il NS in una microcentrifuga da 1,5 mL a 300 x g per 5 min, decantare il supernatante e risospendere il pellet di NS con 1 mL di soluzione salina bilanciata e trasferire la sospensione per provette per microcentrifuga da 1,5 mL associazione povera in proteine.
    4. NS di centrifugare a 300 x g per 5 min, decantare il supernatante e risospendere il pellet cellulare in 95 µ l di tampone di digestione (50 mM Tris-HCl, pH 8.0, 1 mM CaCl2, 0,2% polietilene glicole octylphenyl etere) per 1 x 106 cellule completate con proteasi inibitore cocktail ad un'alta concentrazione (1: 100). Immediatamente dispensare le celle su e giù per evitare l'agglutinamento ed evitare di creare tutte le bolle.
    5. Risospendere MNase in 50% glicerolo per rendere la soluzione di 1 mg/mL (1.15 unità / µ l, conservato a-20 ° C) che deve essere indicato come stock "1x". Fare un "0,1 x" stock effettuando una seconda diluizione di 1:9 con glicerolo al 50% (ad es., 900 µ l di "1x" MNase e 100 µ l di glicerolo al 50%) e conservare a-20 ° C.
    6. Mix 5 µ l di "0.1 x" MNase e 145 µ l di tampone di digestione. Mantenere l'enzima sul ghiaccio tutti i tempi. Aggiungere 5 µ l di MNase diluito in tampone di digestione per 1 x 106 cellule. Scorri il tubo di mescolare e collocare la provetta nel blocco di 37 ° C per esattamente 12 min processo i campioni uno alla volta per garantire un tempo di incubazione accurata di 12 min.
    7. Aggiungere 10 µ l di 10 x MNase smettere di Buffer (110 mM Tris-HCl, pH 8.0, 55 mM EDTA) per 1 x 106 cellule. I campioni devono essere tenuti al ghiaccio da questo punto in poi.
    8. Aggiungere 110 µ l "2 x RIPA buffer" (280 mM NaCl, 1,8% polietilene glicole octylphenyl etere, 0,2% sodio dodecil solfato (SDS), 0,2% Na-desossicolato, 5mm glicole etilenico-bis(β-aminoethyl ether)-N, N, N', N'-acido etilendiamminotetraacetico (EGTA); conservato a 4 ° C) completati con inibitore della proteasi cocktail ad alta concentrazione (1: 100) per 1 x 106 cellule. Scorri il tubo per mescolare.
    9. Centrifugare le provette per 15 min in un microfuge a 4 ° C e 1700 x g. trasferire il surnatante di un nuovo microcentrifuga regolari 1,5 mL (microcentrifuga povera in proteine associazione non è più necessari) e memorizzarli sul ghiaccio. Scartare il pellet.
  2. Immunoprecipitazione (IP)
    1. Mix di proteina A e proteina G sfere magnetiche in un rapporto 1:1. Per ogni IP, preparare 25 µ l di perline.
    2. Lavare le perle aggiungendo 1 mL di tampone RIPA (10 mM Tris pH 8.0, 1 mM EDTA, 140 mM NaCl, 1% polietilene glicole octylphenyl etere, SDS 0,1%, 0,1% Na-desossicolato; conservato a 4 ° C) completati con gli inibitori di proteasi a bassa concentrazione (1: 1000).
    3. Utilizzare un magnete per consentire perline separare dalla soluzione di lavaggio e decantare la soluzione di lavaggio (circa 1 min). Eseguire la fase di lavaggio due volte.
    4. Risospendere le perle al volume originale utilizzando RIPA buffer completati con inibitori della proteasi (1: 1000).
    5. Se necessario, diluite la cromatina utilizzando RIPA buffer completati con inibitori della proteasi (1: 1000) in modo che ogni IP ha un volume di 100-200 µ l. riserva 10% del volume utilizzato per IP della cromatina per l'input.
      Nota: ad esempio, se 200 µ l sono usati per IP, 20 µ l di cromatina diluita dovrebbe essere riservata per l'input. Per un totale di quattro IPs, il volume totale della cromatina deve essere diluito a 820 µ l.
    6. Preparare l'input. Aggiungere 100 µ l di buffer di TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) completati con proteinasi K (0,5 mg/mL) all'ingresso e incubare l'input a 55 ° C per 1 h.
      Nota: 2.2.6-2.2.7 procedura può essere eseguita insieme a punti 2.3.4 e 2.4.1.
    7. Purificare l'input utilizzando un kit di purificazione di PCR seguendo le istruzioni del produttore ed eluire in 50 µ l di tampone di eluizione fornite nel kit.
    8. Misurare la concentrazione dell'ingresso tramite uno spettrofotometro di microvolume e registrare i risultati in un notebook. Vuoto con tampone di eluizione da kit.
      Nota: In mouse neurosfere, abbiamo usato circa 6 µ g di DNA per ogni IP.
    9. Eseguire input su un gel di 1% o caricare 1 µ l su un DNA Bioanalyzer utilizzando le impostazioni standard. Conservare il resto per l'utilizzo come input nelle applicazioni a valle.
    10. Aggiungere 10 µ l di proteina lavata A & G perle magnetiche per ogni IP e IP di incubare per 1 h a 4 ° C.
      Nota: ad esempio, aggiungere 30 µ l di proteina A & G magnetici perline per tre IPs.
    11. Posizionare i campioni su un magnete e consentire perline separare. Dividere della cromatina trasferendo l'importo precedentemente determinato in una nuova provetta da 1,5 mL.
    12. Aggiungere l'anticorpo e avvolgere i tappi con pellicola di plastica paraffina per evitare l'evaporazione. Incubare i campioni durante la notte a 4 ° C con rotazione a 20 giri/min.
      Nota: La concentrazione deve essere determinata empiricamente seguendo i consigli del produttore.
    13. Il giorno successivo, girare i tubi usando una mini centrifuga a temperatura ambiente, 2000 x g per 10 s. Aggiungere 10 µ l di perline per ogni IP, quindi incubare IP per 3 h a 4 ° C con rotazione a 20 giri/min.
  3. Lavaggi IP e digestione delle proteine
    1. Aggiungere 150 µ l di tampone RIPA completati con gli inibitori di proteasi a bassa concentrazione (1: 1000) per ogni IP e IP di incubare a 4 ° C con rotazione a 20 rpm per 5 min posto il campione su un supporto magnetico e consentire i branelli magnetici separare. Utilizzare una pipetta per rimuovere il surnatante. Ripetere questa tep cinque lavaggi.
    2. Aggiungere 150 µ l di tampone di LiCl (250 mM LiCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0,5% NP-40, 0,5% Na-desossicolato; conservare a 4 ° C) completati con gli inibitori di proteasi a bassa concentrazione (1: 1000) per ogni IP e incubare IP a 4 ° C con rotazione a 20 rpm per 5 min posto il campione su un supporto magnetico sostare e permettere a biglie magnetiche separare. Utilizzare una pipetta per rimuovere il surnatante.
    3. Aggiungere 150 µ l di TE freddo (senza inibitori di proteasi) e incubare il campione a 4 ° C con rotazione a 20 rpm per 5 min posto il campione su un supporto magnetico e biglie magnetiche separare. Utilizzare una pipetta per rimuovere il surnatante.
    4. Dopo il lavaggio finale, risospendere il campione in 100 µ l di buffer di TE completati con proteinasi K (0,5 mg/mL) e incubare il campione a 55 ° C per 1 h.
  4. Purificazione del DNA e PCR Real-Time quantitativa (qPCR) di ChIP
    1. Purificare il DNA immunoprecipitati utilizzando un kit di purificazione di PCR. Dopo aggiunta di DNA binding buffer dal kit per ciascun campione, posizionare il tubo su un magnete e attendere che biglie magnetiche aggregazione, quindi trasferire il surnatante per la colonna di pulitura. Seguire le istruzioni del produttore ed eluire in 50 µ l di tampone di eluizione fornite nel kit.
    2. Per verificare se l'IP è riuscito, eseguire un qPCR. Idealmente, dovrebbero essere progettati gli iniettori per le regioni di controllo positivo e negativo.
      Nota: ad esempio, per un indirizzo IP eseguite con H3K4me3 e H3K27me3, i seguenti campioni devono essere eseguiti su qPCR: input H3K4me3, H3K27me3 e IgG ChIP DNA, DNA e un controllo privo di templato (NTC) utilizzando primers per regioni di essere arricchiti con H3K4me3 (controllo positivo) e regioni di essere arricchiti con H3K4me3 (controllo negativo); allo stesso modo, per H3K27me3.
    3. Seguire i protocolli standard per eseguire qPCR12. Brevemente, eseguire un qPCR mediante SYBR green mix master, 0,5 µ l di concentrazione di lavoro 10 µM di ogni primer forward e reverse e 2 µ l di DNA input o ChIP. Leggere piastre utilizzando un sistema di Real Time PCR. Sequenze dell'iniettore sono forniti nella tabella 2. Le sequenze dell'iniettore di Gapdh da Hwang et al. erano usate13.
    4. Analizzare i dati del ChIP rispetto all'input, cioè, per cento ingresso metodo (% IP)14. Calcolare la percentuale di input mediante le seguenti formule:
      Regolata l'input = media ct (ingresso)-log2(DF)
      dove DF è il fattore di diluizione dell'input iniziale e
      DF = volume totale di IP / volume dell'input
      % IP = 100 × 2 ^ (regolato ingresso - Ct (IP))
      dove Ct è il fattore di soglia.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Una rappresentazione schematica del tumore NS generata da un tumore al cervello dove le cellule del tumore di cervello sono Katushka positivo è presentata nella Figura 1. Figura 2 è una rappresentazione schematica della tecnica ChIP intera. Figura 3 Mostra i risultati rappresentativi della cromatina da tumore cerebrale NS digerito con MNase per 12 min, ottenendo una maggioranza di mono, di- e tri-nucleosomi. A seguito di ChIP, una qPCR può essere eseguita sul ChIP e ingresso del DNA campioni. La figura 4 Mostra dati rappresentativi di qPCR ChIP da un qPCR per la gliceraldeide-3-fosfato deidrogenasi (Gapdh). GAPDH è un gene housekeeping che è arricchito con H3K4me3, una modifica che è associata con trascrizione attivo. I risultati mostrano che Gapdh è arricchito con H3k4me3 e non sono arricchiti con H3K27me3 che è una modifica associata a regioni di cromatina repressa.

Figure 1
Figura 1: schematico del tumore NS generata da un tumore al cervello positivo Katushka. Un campo luminoso e fluorescente immagine di un cervello raccolto da un mouse che ha raggiunto la fase di punto finale. L'area del tumore è delineato dalla linea tratteggiata ed è positivo per il reporter fluorescente, Katushka. Il tumore è quindi isolato e il tessuto del tumore è raccolti in una provetta da 1,5 mL. Le cellule sono poi dissociate e coltivate in forma di NS di medie e tumore di NSC. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: rappresentazione schematica del flusso di lavoro per ChIP nativo. NS di tumore sono coltivate e ampliato. Ogni IP viene eseguita con 1 X 106 celle. Cromatina è frammentata utilizzando tramite digestione del MNase per ottenere mono, di- e tri-nucleosomi. La cromatina è incubata con un anticorpo specifico per una modifica dell'istone o DNA-collegata della proteina di interesse. Il complesso anticorpo-DNA è immunoprecipitata con perline di magnetico della proteina A/G. Infine, viene digerita proteine e DNA è purificato per ottenere solo DNA arricchito con modifica dell'istone o DNA-collegata della proteina di interesse. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: frammentazione della cromatina di MNase. Cromatina è stata preparata da tumore cerebrale NS tramite l'aggiunta di MNase e di incubazione a 37 ° C per esattamente 12 min. rappresentante del DNA risultati da Bioanalyzer analisi di un campione di ingresso dimostrano che la maggior parte del DNA è stata frammentata in mono-, di- e tri- nucleosomi. 1 Lane è la scala in coppie di basi (BP). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: rappresentante ChIP qPCR dati presentati come percentuale input. qPCR è stato effettuato con IgG, H3K4me3 e H3K27me3 ChIP DNA utilizzando primers per la gliceraldeide-3-fosfato deidrogenasi (Gapdh). Risultati rappresentativi dimostrano che Gapdh, un gene housekeeping, solo è arricchita con la modifica H3K4me3, connesso con trascrizione attivo e non la modifica di H3K27me3, connesso con cromatina repressa. Questo grafico rappresenta i risultati dei due esperimenti biologici eseguiti con tre pozzi replicare ogni. Barre di errore rappresentano errore standard della media (SEM). Clicca qui per visualizzare una versione più grande di questa figura.

Gene Forward primer Reverse primer
GAPDH TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabella 1: Primers utilizzati per esperimenti di qPCR di ChIP. Le sequenze per primer usati per Gapdh sono fornite in questa tabella.

dire Ct (ingresso) Deviazione standard Ingresso regolato
24.265 0,071 20.943
Ingresso per cento
Campione Crudo significa Ct Deviazione standard Ingresso percentuale = 100 * 2 ^ (regolato input-Ct(IP))
IgG 32.23 0,112 0,04
H3K4me3 22.148 0,128 43,37
H3k27me3 32.79 0,519 0,027
NTC indeterminato indeterminato indeterminato

Tabella 2: esempio di calcolo della percentuale di input metodo per analisi qPCR ChIP. Esempio di calcolo di per cento di input per ChIP eseguita con il 10% a partire ingresso; DF = 10. I numeri in questa tabella illustrano i valori non elaborati di un esperimento biologico con replicare 3 pozzi eseguire per ogni campione.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il protocollo presentato qui consentirà all'utente di eseguire ChIP nativo su NS derivate da tumori cerebrali geneticamente. A differenza di cross-linking ChIP, questo protocollo è limitato per lo studio delle proteine che associano strettamente con DNA6. Il numero di celle utilizzate possa essere modificato come necessario e il protocollo può essere scalato. Abbiamo usato 1 X 106 cellule per IP, tuttavia, ChIP nativo può essere effettuata anche con appena 4 x 104 cellule5. In questo protocollo, abbiamo analizzato il DNA ChIP via qPCR; Tuttavia, questo protocollo coordinabile anche con sequenziamento di prossima generazione per studiare le interazioni proteina-DNA a livello di larghezza di genoma. Abbiamo utilizzato con successo questo protocollo ChIP per analizzare l'effetto degli oncogeni glioma sulla deposizione di modificazioni istoniche all'interno di specifiche regioni del genoma di cellule del tumore.

Ci sono pochi passaggi critici durante l'esecuzione di ChIP nativo. In primo luogo, le condizioni di digestione per ogni tipo di cellula devono essere determinate empiricamente. La maggior parte della cromatina dovrebbe essere mono-nucleosomi (150 bp) con alcuni picchi di - e tri-nucleosome (Figura 3). I nostri risultati di protocollo in più di 70% mono-, di- o picchi tri-nucleosoma, tuttavia, rimane alcuni DNA non digerito. Se il protocollo verrà utilizzato per ChIP-seq, ulteriori passaggi saranno necessario rimuovere il DNA non digerito. Inoltre, è importante tenere a mente che ogni lotto di MNase acquistato può differire in attività e richiedono quindi ottimizzazione delle condizioni di digestione. In secondo luogo, la qualità di un ChIP dipende fortemente la specificità dell' anticorpo utilizzato11. Un anticorpo di ChIP di alta qualità dovrebbe avere alta reattività contro il bersaglio designato e bassa reattività crociata con altre proteine DNA-collegata o off obiettivo modifiche dell'istone,11. Per questo motivo, si consiglia di test la specificità dell'anticorpo usando una prova di legame del peptide. Linee guida di codifica suggeriscono che un arricchimento dieci volte dovrebbe essere osservato per la modifica di interesse rispetto al altre modifiche11. È anche fondamentale per eseguire controllo necessarie immunoprecipations, vale a dire, pre-immunitario o IgG controllo. Quando sono soddisfatte queste considerazioni, dati nativi di ChIP sono un forte metodo affidabile per lo studio dei meccanismi epigenetici regolamentati da interazioni proteina-DNA.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgements

Questo lavoro è stato supportato da istituti di salute nazionale Istituto nazionale dei disordini neurologici e colpo (NINDS/NIH) sovvenzioni R37-NS094804, R01-NS074387, R21-NS091555 a m.g.c.; NIH/NINDS concede R01-NS076991, R01-NS082311 e R01-NS096756 al Domaine; NIH/NINDS R01-EB022563; il reparto di neurochirurgia; Di Leah Happy Hearts e Chad Fondazione ma a m.g.c. e Domaine RNA biomedicina Grant F046166 a m.g.c. f.m.m. è supportato da un F31 NIH/NINDS-F31NS103500. R.I.Z.-V. è supportata dal NIH / NIGMS grant 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics