Imunoprecipitação da cromatina nativa usando Neurospheres de Tumor de cérebro murino

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Mecanismos epigenéticos são frequentemente alterados no glioma. Imunoprecipitação da cromatina pode ser usada para estudar as consequências de alterações genéticas no glioma que resultam de mudanças nas modificações do histone que regulam a transcrição de gene e a estrutura da cromatina. Este protocolo descreve imunoprecipitação da cromatina nativa na neurospheres de tumor murino de cérebro.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Modificações epigenéticas podem estar envolvidas no desenvolvimento e progressão de glioma. Mudanças na metilação e acetilação de promotores e regiões reguladoras de oncogenes e supressores de tumor podem levar a mudanças na expressão gênica e desempenham um importante papel na patogênese de tumores cerebrais. Imunoprecipitação da cromatina nativa (ChIP) é uma técnica popular que permite a detecção de modificações ou outras proteínas rigidamente vinculadas ao DNA. Em contraste com o reticulado ChIP, no ChIP nativo, as células não são tratadas com formaldeído para ligar covalentemente proteínas para DNA. Isto é vantajoso, porque às vezes reticulação pode fixar as proteínas que apenas transitoriamente interagem com o DNA e não têm significado funcional na regulação gênica. Além disso, os anticorpos geralmente são disparados contra péptidos não fixados. Portanto, a especificidade do anticorpo é aumentada em ChIP nativo. No entanto, é importante manter em mente que o ChIP nativo só é aplicável para estudar as histonas ou outras proteínas que se ligam firmemente ao DNA. Este protocolo descreve a imunoprecipitação da cromatina nativa na neurospheres de tumor murino de cérebro.

Introduction

Eventos epigenéticos são frequentes em gliomas e provavelmente desempenham um papel importante na patogênese do tumor. Com efeito, em pediátrica glioma de alto grau, mutações em genes que codificam as variantes de histona H3.3 e H3.1 ocorrem com frequência1. As mutações afetam modificações do histone e tem importantes consequências epigenéticas2,3. No adolescente ao espectro de adulto, mutações recorrentes isocitrato desidrogenase gene 1/2 (IDH1/2), uma mutação que inibe a histona dependente de α-KG e DNA de-methylasaes e alterações genéticas em outros reguladores de cromatina como ATRX e DAXX ocorrem 4. portanto, é de fundamental importância para o estudo de como as mutações que afetam epigenéticos reguladores alteram estrutura da cromatina e modificações do histone regulamentar, que, por sua vez, têm um impacto dramático do transcriptoma as células do tumor.

Imunoprecipitação da cromatina (ChIP) é uma poderosa ferramenta usada para avaliar o impacto das modificações epigenéticas no genoma5,6,7. No ChIP nativo, cromatina é digerida com nuclease micrococcal (MNase), immunoprecipitated usando um anticorpo da proteína de interesse, e então DNA é purificado a partir do complexo de cromatina immunoprecipitated6. As células não são fixas durante o procedimento, para que esta técnica só é aplicável para o estudo de proteínas que interagem fortemente com DNA6. A ausência de cross-linking auxilia a especificidade do anticorpo desde que anticorpos são produzidos geralmente contra unfixed peptídeos ou proteínas7. Além disso, desde que não há nenhuma etapa do cross-linking, isso reduz as chances de interações proteína-ADN transientes que são inespecíficos e não regulamentar7,8de fixação. ChIP pode ser usado para identificar o enriquecimento das modificações do histone em uma região específica do genoma. Aqui, detalhamos um protocolo para executar ChIP nativo em neurospheres (NS) gerados a partir de geneticamente projetado modelos de rato de glioma.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os métodos descritos aqui foram aprovados pelo Comitê de uso (IACUC) da Universidade de Michigan e institucional Cuidado Animal.

1. geração de tumor cerebral NS e as condições de cultivo.

  1. Prepare o meio de células-tronco neurais (NSC) com de Dulbecco suplemento modificado águia médio/F12B27 (1x), suplemento de N2 (1x) e um reagente antimicrobiano. Suplemento médio NSC no dia de uso com humano recombinante fator de crescimento endotelial (EGF) e fator de crescimento fibroblástico-basic (FGF) em uma concentração final de 20 ng/mL cada.
  2. Induzi o tumor cerebral no mouse usando o sistema de transposon de bela adormecida em que plasmídeos codificação oncogenes ou shRNA alvo supressores de tumor são injetados dos ventrículos laterais de recém-nascidos para gerar tumores de cérebro espontânea9. Selecione um rato com um tumor grande, o que é confirmado com imagens de bioluminescência.
    Nota: Informações mais detalhadas sobre os sistema de Transposon beleza dormindo e plasmídeo construções usadas podem ser encontradas em Calinescu et al 9.
    1. Para os ratos de imagem, injete 100 µ l de 30 mg/mL solução de luciferina intraperitonealmente usando uma agulha de 26 calibre.
    2. 5 min após injeção de luciferina, anestesiar o animal utilizando uma câmara de anestesia com fluxo de oxigênio/isoflurano definido como 2% de isoflurano.
    3. Quando os animais são anestesiados (geralmente 2-3 min), colocar os animais na câmara de bioluminescência com isoflurano oxigênio definido como 2% de isoflurano. Se os animais ficarão sob anestesia por mais de 5 min, use uma pomada oftálmica para evitar ressecamento enquanto sob anestesia.
    4. Os ratos usando um na vivo óptico sistema com os seguintes parâmetros de imagem da imagem: exposição automática, grande binning e abertura f = 1. O parâmetro para considerá-lo um grande tumor é uma bioluminescência > 106 fótons/s/cm2/sr.
  3. Eutanásia o mouse com uma overdose de inalação de isoflurano anestésica em uma câmara fechada, verifique por pitada de dedo do pé que o animal é anestesiado e decapitar o mouse.
  4. Extrair o cérebro e dissecá-lo conforme descrito anteriormente em Calinescu et al 9.
  5. Coloque o cérebro em uma placa de Petri de 10 cm. Se o tumor induzido expressa uma proteína fluorescente, uso uma fluorescente microscópio de dissecção definido para o respectivo canal fluorescente e ampliação de X 0,3, caso contrário identificar massa tumoral pelas diferenças na cor do tecido e textura. Use o bisturi e pinça para separar o tecido do tumor de cérebro normal.
  6. Picar o tumor em pedaços pequenos na prato de Petri. Coloque o tumor dissecado em um tubo de 1,5 mL com 300 µ l de meio de NSC.
  7. Use um pilão de aglomerados de plástico descartável que se adapta às paredes de um tubo cónico microcentrifuga para homogeneizar suavemente o tumor. Adicionar 1 mL de meio de desprendimento celular e incubar a amostra por 5 min a 37 ° C.
    Nota: O uso de um pilão pode matar algumas células. Se o leitor quer maximizar a viabilidade celular, o uso de um pilão pode ser omitido.
  8. Passe a suspensão de células da etapa 1.7 através de um filtro de célula 70 µm e lavar o filtro com 25 mL de meio de NSC.
  9. Centrifugar a suspensão de 300 x g durante 5 min à temperatura ambiente, decante o sobrenadante e ressuspender o sedimento em 6 mL de meio de NSC.
  10. A suspensão de células de tumor da etapa 1.9 num frasco de cultura T-25 da placa e cultura a 37 ° C numa incubadora de cultura de tecidos, com uma atmosfera de 95% de ar e 5% CO2. Geralmente após 3 dias, haverá uma mistura de algumas células mortas, as células aderidas e algumas células formando NS que flutuam no meio.
  11. Transferir a suspensão de células para um tubo cônico de 15 mL, coletar somente as células que afundam até o fundo, utilizando uma micropipeta e re-placa-los em um frasco de cultura de tecidos T-75.
  12. Manter as células em densidade relativamente alta (1-3 X 106 células em um T-25). Passagem das células quando elas são confluentes.
    Nota: Confluência é determinada pelo tamanho esferas. Black centros de esferas grande significa que lá são células mortas no centro e indicam que as células devem ser passadas imediatamente.
  13. Adicionar os fatores de crescimento (EGF e basic-FGF; 20 ng/mL cada) em três dias. Mude o meio, quando as células não são confluente e a médio transforma luz laranja.
  14. Para mudar o meio, recolher o meio velho e centrifugue a 300 x g, à temperatura ambiente por 5 min e ressuspender o pellet de células em meio de NSC suplementado com EGF e FGF na concentração especificada na etapa 1.1.
    Nota: Se as esferas são em meados-a confluência de alta, mas não está pronto para ser passadas (esfera tamanho é pequeno, com um diâmetro < 100 µm), em seguida, o sedimento pode ser dividido em dois balões.
  15. Para passagem das células, as células a 300 x g por 5 min à temperatura de centrifugação, decante o sobrenadante e incubar as células em meio de desprendimento celular por 5 min a 37 ° C.
    1. Adicionar 5 mL de solução salina equilibrada para meio de desprendimento diluído e centrifugue a 300 x g durante 5 min à temperatura ambiente.
    2. Decante o sobrenadante e ressuspender as células em 18 mL do meio de NSC dividir a suspensão igualmente em três frascos de T-25.
  16. Para congelar as alíquotas de células, dissociar as células como na etapa 1.15 e congelar as células em alíquotas de 1 mL de soro bovino fetal de 90% com 10% de dimetil sulfóxido. Esfriar lentamente as células colocando as células no gelo por 10 minutos e, em seguida, mantendo as células-20 ° C por 30 min e -80 ° C durante 1 dia. No dia seguinte, transfira as células para um recipiente de armazenamento de nitrogênio líquido.

2. nativo ChIP

  1. Preparação de cromatina
    1. Depois de fazer estoque de NS derivada, cultura NS em um T-75 em 15 mL de meio de NSC a 37 ° C numa incubadora de cultura de tecidos, com uma atmosfera de ar de 95% e 5% CO2 até NS se tornar confluentes. Um prato de T-75 confluente renderá 3-5 X 106 células.
    2. Quando as células se tornam confluentes, centrifugar NS a 300 x g durante 5 min, decantar o sobrenadante e adicionar 1 mL de meio de dissociação celular. Incubar as células a 37 ° C por 5 min. Adicione 5 mL de meio e contar as células usando um hemocytometer10.
      Nota: 1 x 106 células são necessários por reação de imunoprecipitação (IP). Observe que um soro pre- imune ou controle de IgG também deve ser incluído11.
    3. Centrifugue o NS em um tubo de microcentrifugadora de 1,5 mL a 300 x g por 5 min, decantar o sobrenadante e ressuspender o pellet NS com 1 mL de solução salina equilibrada e transferir a suspensão para tubos de microcentrifuga de 1,5 mL de ligação de baixa proteína.
    4. NS de centrifugação a 300 x g por 5 min, decantar o sobrenadante e ressuspender o sedimento celular em 95 µ l de tampão de digestão (50 mM Tris-HCl, pH 8,0, 1 mM CaCl2, 0,2% polietileno glicol octilfenil éter) por 1 x 106 células suplementadas com protease inibidor de cocktail em uma concentração elevada (1: 100). Imediatamente Pipetar as células acima e para baixo, para evitar a aglutinação e evitar a criação de quaisquer bolhas.
    5. Resuspenda MNase em 50% de glicerol para fazer 1 mg/mL solução (1,15 unidades / µ l, armazenado a-20 ° C) que será referida como estoque "1x". Fazer um "0.1 x" estoque fazendo uma diluição de 1:9 segunda com 50% de glicerol (EG., 900 µ l de "1x" MNase e 100 µ l de glicerol a 50%) e armazená-lo a-20 ° C.
    6. Mistura de 5 µ l de "0,1 x" MNase e 145 µ l de tampão de digestão. Manter a enzima no gelo todas as vezes. Adicione 5 µ l de MNase diluída em tampão de digestão por 1 x 106 células. Filme do tubo para misturar e coloque o tubo no bloco de 37 ° C por exatamente 12 min. processo as amostras de um de cada vez para garantir um tempo de incubação precisos 12 min.
    7. Adicionar 10 µ l de 10 x MNase parar de Buffer (110 mM Tris-HCl, pH 8.0, 55 mM EDTA) por 1 x 106 células. As amostras devem ser mantidas no gelo a partir deste momento.
    8. Adicionar 110 µ l "buffer de x RIPA 2" (280 mM NaCl, 1,8% polietileno glicol octilfenil éter 0,2% sulfato dodecyl de sódio (SDS), 0,2% Deoxycholate at-do, 5mm glicol de etileno-bis(β-aminoethyl ether)-N, N, N', N'-ácido etilenodiaminotetracético (EGTA); armazenadas a 4 ° C) suplementado com inibidor de protease cocktail em concentração elevada (1: 100) por 1 x 106 células. Agite o tubo para misturar.
    9. Centrifugar os tubos por 15 min em uma microcentrífuga a 4 ° C e 1700 x g transferir o sobrenadante para um novo tubos de microcentrifuga regular 1,5 mL (tubos de microcentrifuga de ligação de baixa proteína não são mais necessários) e armazená-los no gelo. Descarte a pelota.
  2. Imunoprecipitação (IP)
    1. Mix de proteína A e proteína G grânulos magnéticos em uma proporção de 1:1. Para cada IP, prepare 25 µ l de grânulos.
    2. Lave os grânulos, adicionando 1 mL de tampão RIPA (10 mM Tris pH 8,0, 1 mM EDTA, 140 mM de NaCl, 1% de polietileno glicol octilfenil éter, 0,1% SDS, 0,1% at-Deoxycholate do; armazenadas a 4 ° C) suplementado com inibidores de protease em baixa concentração (1: 1000).
    3. Use um ímã para permitir que contas separar a solução de lavagem e decantar a solução de lavagem (aproximadamente 1 min). Execute a etapa de lavagem, duas vezes.
    4. Re-suspenda as contas para o volume original usando o amortecedor de RIPA suplementado com inibidores de protease (1: 1000).
    5. Se necessário, diluir a cromatina usando amortecedor de RIPA suplementado com inibidores de protease (1: 1000) para que cada IP tem um volume de 100 a 200 µ l. reserva 10% do volume utilizado por IP da cromatina para a entrada.
      Nota: por exemplo, se 200 µ l são usados por IP, 20 µ l de cromatina diluída deve ser reservada para a entrada. Para um total de quatro IPs, volume de cromatina total deve ser diluído a 820 µ l.
    6. Prepare a entrada. Adicionar 100 µ l de tampão TE (10 mM Tris-HCl pH 8,0, 1 mM EDTA) suplementado com proteinase K (0,5 mg/mL) para a entrada e incubar a entrada a 55 ° C, durante 1 h.
      Nota: 2.2.6-2.2.7 etapas podem ser executadas junto com etapas 2.3.4 e 2.4.1.
    7. Purificar a entrada usando um kit de purificação de PCR seguindo as instruções do fabricante e eluir em 50 µ l de tampão de eluição fornecido no kit.
    8. Medir a concentração de entrada usando um spectrophotometer microvolume e registre os resultados em um notebook. Em branco com o tampão de eluição do kit.
      Nota: Em neurospheres de rato, usamos cerca de 6 µ g de DNA para cada IP.
    9. Executar entrada em um gel de 1% ou 1 µ l em um Bioanalyzer de DNA usando as configurações padrão de carga. Guarde o restante para uso como entrada em aplicações a jusante.
    10. Adicionar 10 µ l de proteína lavada A & grânulos magnéticos G para cada IP e IP, incubar durante 1 h a 4 ° C.
      Nota: por exemplo, adicione 30 µ l de proteína A & grânulos magnéticos G para três IPs.
    11. Colocar as amostras em um ímã e permitir grânulos separar. Divida a cromatina transferindo o montante previamente determinado em um novo tubo de 1,5 mL.
    12. Adicione o anticorpo e embrulhar as tampas com filme plástico parafina para evitar a evaporação. Incube as amostras durante a noite a 4 ° C com rotação a 20 rpm.
      Nota: Concentração deve ser determinada empiricamente, seguindo as recomendações do fabricante.
    13. No dia seguinte, gire os tubos usando uma mini centrífuga à temperatura ambiente, 2000 x g, por 10 s. Em seguida adicionar 10 µ l de grânulos para cada IP e incubar IP durante 3 h a 4 ° C com rotação a 20 rpm.
  3. Lavagens IP e digestão de proteínas
    1. Adicionar 150 µ l de tampão RIPA suplementado com inibidores de protease em baixa concentração (1: 1000) para cada IP e IP, incubar a 4 ° C, com rotação a 20 rpm durante 5 min. lugar a amostra num suporte magnético e permitem que os grânulos magnéticos separar. Use uma pipeta para retirar o sobrenadante. Repita este lavagens cinco tep.
    2. Adicionar 150 µ l de tampão de LiCl (250 mM LiCl, pH de Tris 10 mM, 8.0, 1 mM EDTA, 0,5% NP-40, 0,5% at-Deoxycholate do; loja a 4 ° C) suplementado com inibidores de protease em baixa concentração (1: 1000) para cada IP e IP, incubar a 4 ° C, com rotação a 20 rpm durante 5 min. lugar a amostra em um magnético fique e permitir grânulos magnéticos separar. Use uma pipeta para retirar o sobrenadante.
    3. Adicionar 150 µ l de TE frio (sem inibidores de protease) e incubar a amostra a 4 ° C com rotação a 20 rpm durante 5 min. lugar a amostra num suporte magnético e permitir grânulos magnéticos separar. Use uma pipeta para retirar o sobrenadante.
    4. Após a etapa de lavagem final, re-suspender a amostra em 100 µ l de tampão TE suplementado com proteinase K (0,5 mg/mL) e incubar a amostra a 55 ° C, durante 1 h.
  4. Purificação de DNA e PCR em tempo real quantitativo de ChIP (qPCR)
    1. Purifica DNA immunoprecipitated usando um kit de purificação de PCR. Após a adição de tampão de ligação de DNA do kit para cada amostra, colocar o tubo em um ímã e espere até magnéticas contas agregadas, depois transfira o sobrenadante para a coluna de limpeza. Siga as instruções do fabricante e eluir em 50 µ l de tampão de eluição fornecido no kit.
    2. Para verificar se o IP for bem-sucedida, execute um qPCR. Idealmente, as primeiras demão devem ser projetadas para as regiões de controle positivo e negativo.
      Nota: por exemplo, para um IP realizada com H3K4me3 e H3K27me3, os exemplos a seguir devem ser executados em qPCR: H3K4me3, H3K27me3 e IgG ChIP DNA, DNA e uma sem controle do modelo (NTC) utilizando primers para regiões de ser enriquecido com H3K4me3 de entrada (controle positivo) e regiões de ser enriquecido com H3K4me3 (controle negativo); da mesma forma, para H3K27me3.
    3. Segui protocolos padrão para executar qPCR12. Brevemente, execute um qPCR usando SYBR verde mistura mestre, 0,5 µ l de concentração de trabalho 10 µM de cada primer frente e verso e 2 µ l de ChIP ou entrada de DNA. Ler placas usando um sistema de PCR em tempo Real. Sequências da primeira demão são fornecidas na tabela 2. As sequências de cartilha de Gapdh de Hwang et al. foram utilizados13.
    4. Analisar os dados do ChIP em relação a entrada, ou seja, por cento entrada método (% PI)14. Calcule a porcentagem de entrada usando as seguintes fórmulas:
      Ajustado de entrada = ct média (entrada)-log2(DF)
      onde DF é o factor de diluição da entrada inicial e
      DF = volume total de IP / volume de entrada
      IP % = 100 × 2 ^ (ajustado a entrada - Ct (IP))
      onde Ct é o fator de limiar.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Uma representação esquemática de tumor NS gerados a partir de um tumor cerebral, onde as células do tumor de cérebro são Katushka positiva é apresentada na Figura 1. A Figura 2 é uma representação esquemática da técnica ChIP inteira. A Figura 3 mostra os resultados representativos da cromatina de tumor cerebral NS digerido com MNase para 12 min, rendendo uma maioria de mono, di- e tri-os nucleossomas. ChIP, na sequência de um qPCR pode ser executada no ChIP e DNA de entrada amostras. A Figura 4 mostra dados representativos de qPCR ChIP de um qPCR para gliceraldeído-3-fosfato desidrogenase (Gapdh). GAPDH é um gene de limpeza que é enriquecido com H3K4me3, uma modificação que está associada a transcrição ativa. Os resultados mostram que a Gapdh é enriquecido com H3k4me3 e não são enriquecidos com H3K27me3 que é uma modificação associada com regiões de cromatina reprimida.

Figure 1
Figura 1: esquemático do tumor NS gerados a partir de um tumor no cérebro positivo Katushka. Um campo claro e imagem fluorescente de um cérebro de um rato colhida que atingiu o estágio de ponto final. A área de tumor é delimitada por uma linha pontilhada e é positiva para o repórter fluorescente, Katushka. O tumor é então isolado e o tecido do tumor é coletado em um tubo de 1,5 mL. As células são então dissociadas e cultivadas em forma de NS de médio e tumor de NSC. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: uma representação esquemática do fluxo de trabalho para ChIP nativo. NS de tumor são cultivadas e expandidos. Cada IP é executada com 1 X 106 células. Cromatina é fragmentada usando por digestão MNase obter mono, di- e tri-os nucleossomas. A cromatina é incubada com um anticorpo específico para uma modificação de histona ou DNA associados a proteína do interesse. O complexo anticorpo-DNA é immunoprecipitated com grânulos de A/G de proteína magnético. Finalmente, a proteína é digerida e DNA purified para obter apenas o DNA enriquecido com modificação de histona ou DNA associados a proteína do interesse. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: fragmentação da cromatina por MNase. Cromatina foi preparada a partir de tumor cerebral NS pela adição MNase e incubação a 37 ° C por exatamente 12 min. representante resultados de DNA do Bioanalyzer análise de uma amostra de entrada demonstram que a maioria do DNA foi fragmentada em mono-, di- e tri- nucleossomas. 1 Lane é a escada em pares de bases (BP). Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: dados de qPCR representante ChIP apresentados como porcentagem entrada. qPCR foi realizada com IgG, H3K4me3 e H3K27me3 ChIP de DNA utilizando primers para gliceraldeído-3-fosfato desidrogenase (Gapdh). Resultados representativos demonstram que Gapdh, um gene de dona de casa, apenas é enriquecido com a modificação de H3K4me3, associado a transcrição ativa e não a modificação de H3K27me3, associado com cromatina reprimida. Este gráfico representa os resultados de dois experimentos biológicos com três poços replicar. Barras de erro representam o erro padrão da média (SEM). Clique aqui para ver uma versão maior desta figura.

Gene Cartilha para a frente Primeira demão reversa
GAPDH TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabela 1: Primers utilizados para experimentos de qPCR ChIP. As sequências de primers utilizados para Gapdh são fornecidas nesta tabela.

Quer dizer TC (entrada) Desvio-padrão Entrada ajustada
24.265 0.071 20.943
Percentual de entrada
Amostra Bruta média Ct Desvio-padrão Entrada por cento = 100 * 2 ^ (ajustado input-Ct(IP))
IgG 32.23 0.112 0,04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0,027
NTC indeterminado indeterminado indeterminado

Tabela 2: exemplo de cálculo por cento de entrada método para análise de qPCR ChIP. Exemplo de cálculo de por cento de entrada para ChIP realizada com 10% a partir de entrada; DF = 10. Os números na tabela ilustram os valores brutos de um experimento biológico com 3 replicar poços executados para cada amostra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

O protocolo aqui apresentado permitirá que o usuário realizar ChIP nativo no NS derivada de tumores cerebrais geneticamente modificados. Em contraste com o cross-linking do ChIP, este protocolo é limitado para o estudo de proteínas que associam firmemente com DNA6. O número de células utilizado pode ser modificado conforme necessário e o protocolo pode ser ampliado. Nós usamos 1 X 106 células por IP, no entanto, o ChIP nativo também pode ser efectuado com tão pouco quanto 4 x 104 células5. Neste protocolo, analisamos o ChIP de DNA através de qPCR; no entanto, esse protocolo também pode ser combinado com sequenciamento de geração seguinte para estudar interações proteína-ADN em um nível de ampla do genoma. Nós usamos este protocolo de ChIP com êxito para analisar o efeito dos oncogenes glioma a deposição de modificações do histone dentro de regiões específicas do genoma de células de tumor.

Existem alguns passos críticos ao executar ChIP nativo. Em primeiro lugar, as condições de digestão de cada tipo de célula devem ser determinadas empiricamente. A maioria da cromatina deve ser mono-nucleosomes (150 bp) com alguns picos de di - e tri-nucleossoma (Figura 3). Nossos resultados de protocolo em mais de 70% de mono-, di- ou picos tri-nucleossoma, no entanto, o DNA não digerida permanece. Se o protocolo será usado para ChIP-seq, etapas adicionais deverão retirar DNA não digerido. Além disso, é importante manter em mente que cada lote de MNase adquirido pode diferir em atividade e assim exigem otimização das condições de digestão. Em segundo lugar, a qualidade de um ChIP depende altamente da especificidade do anticorpo usado11. Um anticorpo de ChIP de alta qualidade deve ter alta reatividade contra o alvo pretendido e baixa reatividade cruzada com outras proteínas DNA-associado ou fora alvo de modificações do histone11. Por este motivo, recomendamos que teste a especificidade do anticorpo usando um teste de ligação peptídica. ENCODE diretrizes sugerem que um enriquecimento dez vezes deve ser observado para a modificação de interesse em relação a outras modificações11. Também é fundamental para realizar o controle necessário immunoprecipations, i.e., pré-imune ou controle de IgG. Quando estas considerações forem atendidas, dados de ChIP nativo são um método confiável forte para estudar mecanismos epigenéticos regulamentados por interações proteína-ADN.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgements

Este trabalho foi financiado pelo National institutos de saúde nacional Instituto de doenças neurológicas & Stroke (NINDS/NIH) subvenções R37-NS094804, R01-NS074387, R21-NS091555 para M.G.C.; NINDS/NIH concede R01-NS076991 e NS082311-R01 R01-NS096756 a P.R.L.; NIH/NINDS R01-EB022563; o departamento de neurocirurgia; Leah está feliz corações e Chad embora Foundation para M.G.C. e P.R.L. RNA biomedicina Grant F046166 para M.G.C. F.M.M. é suportado por um F31 NIH/NINDS-F31NS103500. R.I.Z.-V. é suportado pelo NIH / NIGMS concessão 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics