Inmunoprecipitación de cromatina nativa usando neuroesferas del Tumor de cerebro murino

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Con frecuencia se alteran mecanismos epigenéticos en glioma. Inmunoprecipitación de cromatina podría utilizarse para estudiar las consecuencias de las alteraciones genéticas en gliomas que resultan de cambios en las modificaciones de las histonas que regulan la transcripción de la cromatina estructura y gene. Este protocolo describe inmunoprecipitación de cromatina nativa de neuroesferas de tumor de cerebro murino.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las modificaciones epigenéticas pueden participar en el desarrollo y progresión de la glioma. Cambios en la metilación y acetilación de promotores y regiones reguladoras de oncogenes y supresores del tumor pueden conducir a cambios en la expresión génica y juega un papel importante en la patogenesia de los tumores cerebrales. Inmunoprecipitación de cromatina nativa (ChIP) es una técnica popular que permite la detección de modificaciones u otras proteínas estrechamente ligadas a ADN. En contraste con reticulado ChIP, chip nativo, las células no son tratadas con formaldehído a enlace covalente proteínas al ADN. Esto es ventajoso porque a veces reticulación puede fijar las proteínas que interactúan con el ADN sólo transitoriamente y no tienen significación funcional en la regulación génica. Además, los anticuerpos son criados generalmente contra péptidos no fijadas. Por lo tanto, especificidad de anticuerpo aumenta en viruta nativa. Sin embargo, es importante tener en cuenta que ChIP nativo sólo es aplicable para el estudio de las histonas u otras proteínas que se unen firmemente a la DNA. Este protocolo describe la inmunoprecipitación de la cromatina nativa de neuroesferas de tumor de cerebro murino.

Introduction

Eventos epigenéticos en los gliomas son frecuentes y probablemente juegan un papel importante en la patogénesis del tumor. De hecho, en el glioma pediátrico de alto grado, las mutaciones en genes que codifican variantes de la histona H3.3 y H3.1 ocurren con frecuencia1. Las mutaciones afectan a modificaciones de las histonas y tienen importantes consecuencias epigenéticas2,3. En el adolescente a adulto espectro, mutaciones recurrentes en el gene de la deshidrogenasa de isocitrato (IDH1/2), 1/2 una mutación que inhibe la histona dependiente de α-KG y de-methylasaes de ADN y alteraciones genéticas en otros reguladores de la cromatina como ATRX y DAXX se producen 4. por tanto, es de vital importancia para el estudio de cómo las mutaciones que afectan los reguladores epigenéticos alteran la estructura de la cromatina y regulación histona modificaciones, que, a su vez, tienen un impacto dramático del transcriptoma de las células del tumor.

Inmunoprecipitación de cromatina (ChIP) es una poderosa herramienta utilizada para evaluar el impacto de las modificaciones epigenéticas en el genoma5,6,7. En viruta nativa, cromatina se digiere con nucleasa micrococcal (MNase), immunoprecipitated utiliza un anticuerpo contra la proteína de interés, y luego es purificado DNA del complejo de la cromatina immunoprecipitated6. Las células no son fijos durante el procedimiento por lo que esta técnica sólo es aplicable para el estudio de proteínas que interaccionan fuertemente con el ADN6. La ausencia de cross-linking ayuda especificidad de anticuerpo puesto que generalmente se levantan anticuerpos contra péptidos o proteínas no fijadas7. Además, puesto que no hay ningún paso Cross-linking, esto reduce las posibilidades de fijación interacciones proteína transitoria-ADN que son no específicos y no normativo7,8. ChIP se puede utilizar para identificar el enriquecimiento de modificaciones de las histonas en una región genómica específica. Aquí detallamos un protocolo para realizar ChIP nativo de neuroesferas (NS) generados a partir de genéticamente diseñados modelos de ratón de glioma.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los métodos aquí descritos han sido aprobados por el cuidado institucional del Animal y el Comité uso (IACUC) de la Universidad de Michigan.

1. generación de tumor cerebral NS y las condiciones de cultivo.

  1. Preparar medio de células madre neurales (NSC) de Dulbecco modificado Eagle medio/F12B27 suplemento (1 x) suplemento de N2 (1 x) y un reactivo antimicrobiano. Suplemento medio de NSC en el día de uso con factor de crecimiento endotelial recombinante humano (EGF) y factor de crecimiento fibroblástico básico (FGF) a una concentración final de 20 ng/mL de cada una.
  2. Inducir el tumor de cerebro de ratón utilizando el sistema de transposon de la bella durmiente en el que se inyección plásmidos codifican oncogenes o shRNA dirigido a supresores de tumor en los ventrículos laterales de los recién nacidos para generar tumores de cerebro espontánea9. Seleccione un ratón con un tumor grande, que se confirma con la proyección de imagen de bioluminiscencia.
    Nota: Información más detallada sobre las construcciones sistema de Transposon belleza durmiente y plásmido utilizado puede encontrarse en Calinescu et al. 9.
    1. Para los ratones de la imagen, inyectar 100 μl de solución de luciferin de 30 mg/mL por vía intraperitoneal utilizando una aguja de 26 calibre.
    2. 5 minutos después de la inyección de luciferin, anestesiar al animal con una cámara de anestesia de flujo de oxígeno/isoflurano a 2% de isoflurano.
    3. Cuando los animales son anestesiados (generalmente 2-3 min), colocar los animales en la cámara de bioluminiscencia con isoflurano de oxígeno a 2% de isoflurano. Si los animales estará bajo anestesia durante más de 5 minutos, usar un ungüento oftálmico para prevenir sequedad mientras que bajo anestesia.
    4. Los ratones utilizando un en vivo sistema con los siguientes parámetros de imagen óptico de la imagen: exposición automática, gran binning y apertura f = 1. El parámetro a considerar un tumor grande es una bioluminiscencia > 106 fotones/s/cm2/sr.
  3. Eutanasia el ratón con una sobredosis de isoflurane anestésico inhalante en una cámara cerrada, verifique por pellizco del dedo del pie que el animal está anestesiado y decapitar el ratón.
  4. Extraer el cerebro y analizar como se describe anteriormente en Calinescu et al. 9.
  5. Colocar el cerebro en un plato de Petri de 10 cm. Si el tumor inducido expresa una proteína fluorescente, un fluorescente, microscopio de disección configurar el canal fluorescente y aumentos de 0.3, de lo contrario identificar masa tumoral por las diferencias en tejido color y textura. Usar bisturí y pinzas para separar el tejido del tumor en el cerebro normal.
  6. Pique el tumor en pequeños pedazos en la caja Petri. Lugar del tumor disecado en un tubo de 1,5 mL con 300 μL de medio de NSC.
  7. Utilizar un mortero de pellets de plástico desechable que se adapta a las paredes de un tubo de microcentrífuga cónica para homogenizar suavemente el tumor. Añadir 1 mL de medio de separación celular e incubar la muestra durante 5 min a 37 ° C.
    Nota: El uso de un mortero puede matar algunas células. Si el lector quiere maximizar la viabilidad de las células, el uso de un mortero puede omitirse.
  8. Pasar la suspensión celular de paso 1.7 a través de un tamiz de célula μm 70 y lavar el filtro con 25 mL de medio de NSC.
  9. Centrifugar la suspensión a 300 x g durante 5 min a temperatura ambiente, decantar el sobrenadante y resuspender el precipitado en 6 mL de medio de NSC.
  10. Disponer la suspensión de células de tumor de paso 1.9 en un matraz de cultivo T-25 y cultivo a 37 ° C en una incubadora de cultivo de tejidos con una atmósfera de 95% aire y 5% CO2. Generalmente después de 3 días, habrá una mezcla de algunas células muertas, células adheridas y algunas células formando NS que flotan en el medio.
  11. Transferir la suspensión de células en un tubo cónico de 15 mL, recoger sólo las células que se hunden hasta el fondo utilizando una micropipeta y re-de placa en un matraz de cultivo de tejidos T-75.
  12. Mantener las células en relativamente de alta densidad (1-3 X 106 células en un T-25). Paso de las células cuando son confluentes.
    Nota: Confluencia es determinado por el tamaño de las esferas. Negro centros de esferas grandes significa que son células muertas en el centro e indican que las células deben ser pasadas inmediatamente.
  13. Añadir los factores de crecimiento (EGF y FGF de basic; 20 ng/mL cada una) cada tres días. Cambiar el medio cuando las células no son confluentes y la naranja de luz media vueltas.
  14. Para cambiar el medio, recoger el viejo medio y centrifugar a 300 x g a temperatura ambiente durante 5 minutos y resuspender el pellet celular en medio de la NSC suplementado con EGF y FGF a la concentración indicada en el paso 1.1.
    Nota: Si las esferas son en mediados de-alta confluencia, pero no está listo para ser pasados (tamaño de la esfera es pequeño con un diámetro < 100 μm), luego el sedimento se puede dividir en dos matraces.
  15. Para las células de paso, centrifugar las células a 300 x g durante 5 min a temperatura ambiente, decantar el sobrenadante e incubar las células en medio de la separación celular por 5 min a 37 ° C.
    1. Añadir 5 mL de solución de sal equilibrada al medio de diluir la separación y centrifugar a 300 x g durante 5 min a temperatura ambiente.
    2. Decantar el sobrenadante y resuspender el precipitado de células en 18 mL de medio de NSC, la suspensión se dividen igualmente en tres frascos de T-25.
  16. Para congelar las alícuotas de células, disociar las células como en el paso 1.15 y congelar las células en alícuotas de 1 mL de suero bovino fetal del 90% con 10% de dimetilsulfóxido. Enfríe lentamente las células colocando las células en hielo durante 10 min, y luego mantener las células de-20 ° C por 30 min y -80 ° C por 1 día. Al día siguiente, transferir las células a un contenedor de almacenamiento de nitrógeno líquido.

2. nativo ChIP

  1. Preparación de la cromatina
    1. Después de hacer el balance de derivados NS, NS en un T-75 en 15 mL de medio de NSC a 37 ° C en una incubadora de cultivo de tejidos con una atmósfera de 95% aire y 5% CO2 la cultura hasta NS convertirse en confluente. Una placa de T-75 confluente producirá 3-5 X 106 células.
    2. Cuando las células se vuelven confluentes, Centrifugue NS a 300 x g durante 5 min, decantar el sobrenadante y agregar 1 mL de medio de disociación celular. Incubar las células a 37 ° C por 5 minutos agregar 5 mL de medio y contar las células utilizando un hemocitómetro10.
      Nota: se necesitan 1 x 106 células por reacción de inmunoprecipitación (IP). Tenga en cuenta que un suero inmune previo o un control de IgG debe ser también incluye11.
    3. Centrifugue el NS en un tubo de microcentrífuga de 1,5 mL a 300 x g durante 5 min, decantar el sobrenadante y resuspender el pellet NS con 1 mL de solución de sal equilibrada y transferir la suspensión a tubos de microcentrífuga de baja proteína vinculante 1,5 mL.
    4. NS de centrifugar a 300 x g durante 5 min, decantar el sobrenadante y resuspender el pellet celular en 95 μl de tampón de digestión (50 mM Tris-HCl, pH 8.0, 1 mM CaCl2, 0.2% polietilenglicol éter de Octylpheny) por 1 x 106 células con proteasa inhibidor de cóctel en una alta concentración (1: 100). Inmediatamente pipetear las células arriba y abajo para evitar el agrupar y creando las burbujas.
    5. Suspender MNase en glicerol al 50% 1 mg/mL solución (1.15 unidades/μl, almacenado a-20 ° C) que se referirá como "1 x". Hacer un "0.1 x" stock haciendo una segunda dilución 1:9 con 50% de glicerol (e.g., 900 μl de "1 x" MNase y 100 μl de glicerol al 50%) y almacenar a-20 ° C.
    6. Mezcla 5 μl de "0.1 x" MNase y 145 μl de tampón de digestión. Mantenga la enzima en el hielo de todos los tiempos. Añadir 5 μl de MNase diluido en buffer de digestión por 1 x 106 células. Flick el tubo para mezclar y colocar el tubo en el bloque de 37 ° C exactamente 12 minutos proceso las muestras de uno a la vez para asegurar un tiempo exacto de la incubación de 12 minutos.
    7. Añadir 10 μl de 10 x Buffer de parada de MNase (110 mM Tris-HCl, pH 8.0, EDTA de 55 mM) por 1 x 106 células. Las muestras deben mantenerse sobre hielo desde este punto hacia adelante.
    8. Agregar 110 μl "2 x RIPA buffer" (280 mM NaCl, 1,8% polietilenglicol éter de Octylpheny, 0.2% sodio dodecil sulfato (SDS), 0,2% desoxicolato de Na, 5 mM el glicol de etileno-bis(β-aminoethyl ether)-N, N, N', N'-ácido tetraacético (EGTA); almacenados a 4 ° C) complementado con inhibidor de la proteasa cóctel en alta concentración (1: 100) por 1 x 106 células. Flick el tubo para mezclar.
    9. Centrifugar los tubos durante 15 minutos en una microcentrífuga a 4 ° C y 1700 x g. transferir el sobrenadante a un nuevos tubos de microcentrífuga de 1,5 mL regular (no son necesarios tubos de microcentrífuga de baja proteína vinculante) y guardarlos en hielo. Deseche los pellets.
  2. Inmunoprecipitación (IP)
    1. Mezclar proteína y granos magnéticos G de proteínas en una proporción 1:1. Para cada IP, preparar 25 μl de granos.
    2. Lavar los granos mediante la adición de 1 mL de tampón RIPA (10 mM Tris pH 8.0, 1 mM EDTA, 140 mM NaCl, 1% polietilenglicol éter de Octylpheny, 0.1% SDS, de 0.1% desoxicolato de Na; almacenados a 4 ° C) suplementado con los inhibidores de proteasa en baja concentración (1: 1000).
    3. Use un imán para permitir que los granos a separar de la solución de lavado y decantar la solución de lavado (aproximadamente 1 min). Realizar la etapa de lavado dos veces.
    4. Vuelva a suspender las cuentas en el volumen original usando almacenador intermediario RIPA suplementado con los inhibidores de proteasa (1: 1000).
    5. Si es necesario, diluir la cromatina usando almacenador intermediario RIPA suplementado con los inhibidores de proteasa (1: 1000) por lo que cada IP tiene un volumen de 100-200 μl. reserva 10% del volumen utilizado por IP de la cromatina en la entrada.
      Nota: por ejemplo, si se utilizan 200 μL por IP, 20 μl de la cromatina diluida debe ser reservado para la entrada. Para un total de cuatro IPs, volumen total de la cromatina debe diluirse a 820 μl.
    6. Preparar la entrada. Añada 100 μl de tampón de TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) complementado con proteinasa K (0.5 mg/mL) a la entrada e incubar la entrada a 55 ° C durante 1 hora.
      Nota: 2.2.6-2.2.7 de pasos se puede realizar con pasos 2.3.4 y 2.4.1.
    7. Purificar la entrada utilizando un kit de purificación PCR siguiendo las instrucciones del fabricante y eluir en 50 μl de tampón de elución provisto en el kit.
    8. Medir la concentración de la entrada utilizando un espectrofotómetro microvolume y anote los resultados en un cuaderno. En blanco con tampón de elución del kit.
      Nota: En ratón neuroesferas, utilizamos aproximadamente 6 μg de ADN para cada IP.
    9. Funcionar la entrada en un gel de 1% a carga 1 μL en un Bioanalizador de ADN utilizando la configuración estándar. Guarde el resto para su uso como insumo en aplicaciones posteriores.
    10. Añadir 10 μl de proteína lavada & granos magnéticos G para cada IP y IP incubar 1 h a 4 ° C.
      Nota: por ejemplo, Añadir 30 μl de proteína A y G de perlas magnéticas para tres IPs.
    11. Coloque las muestras en un imán y permite separar los granos. Dividir la cromatina mediante la transferencia de la cantidad previamente determinada en un nuevo tubo de 1,5 mL.
    12. Añadir el anticuerpo y envuelva las tapas con film de plástico de la parafina para evitar la evaporación. Incubar las muestras durante la noche a 4 ° C con rotación a 20 rpm.
      Nota: Concentración debe determinarse empíricamente, siguiendo las recomendaciones del fabricante.
    13. Al día siguiente, girar los tubos utilizando una mini centrífuga a temperatura ambiente, 2000 x g, durante 10 s. Luego añadir 10 μl de granos a cada IP e incubar IP durante 3 h a 4 ° C con rotación a 20 rpm.
  3. Lavados IP y digestión de proteínas
    1. Agregar 150 μL de tampón RIPA suplementado con los inhibidores de proteasa en baja concentración (1: 1000) a cada IP y IP de incubar a 4 ° C con rotación a 20 rpm por 5 min lugar la muestra en un soporte magnético y permitir que las bolas magnéticas separar. Utilice una pipeta para remover el sobrenadante. Repita este lavado cinco de tep.
    2. Agregar 150 μL de tampón de LiCl (250 mM LiCl, 10 mM Tris, pH 8.0, 1 mM EDTA, 0,5% NP-40, 0.5% desoxicolato de Na, conservar a 4 ° C) suplementado con los inhibidores de proteasa en baja concentración (1: 1000) a cada IP y IP de incubar a 4 ° C con rotación a 20 rpm por 5 min lugar la muestra en un magnético soporte y permitir que los granos magnéticos separar. Utilice una pipeta para remover el sobrenadante.
    3. Añadir 150 μL de TE frío (no inhibidores de la proteasa) e incubar la muestra a 4 ° C con rotación a 20 rpm por 5 min lugar la muestra en un soporte magnético y dejar granos magnéticos separar. Utilice una pipeta para remover el sobrenadante.
    4. Después del paso del lavado final, vuelva a suspender la muestra en 100 μl de buffer TE complementado con proteinasa K (0.5 mg/mL) e incubar la muestra a 55 ° C durante 1 hora.
  4. Purificación de DNA y PCR cuantitativa (qPCR) a ChIP en tiempo real
    1. Purificar immunoprecipitated ADN utilizando un kit de potabilización de la polimerización en cadena. Después de la adición de tampón de Unión DNA kit de cada muestra, coloque el tubo en un imán y espere hasta que los granos magnéticos agregados, entonces transfiera el sobrenadante a la columna de limpieza. Siga las instrucciones del fabricante y eluir en 50 μl de tampón de elución provisto en el kit.
    2. Para comprobar si la IP es exitosa, realizar una qPCR. Idealmente, imprimaciones deben estar diseñados para las regiones de control positivo y negativo.
      Nota: por ejemplo, para una IP realizada con H3K4me3 y H3K27me3, las muestras siguientes se deben ejecutar en qPCR: entrada H3K4me3, H3K27me3 y IgG ChIP de ADN, DNA y una sin plantilla control (NTC) usando las cartillas para las regiones a ser enriquecido con H3K4me3 (control positivo) y regiones a ser enriquecido con H3K4me3 (control negativo); Asimismo, para H3K27me3.
    3. Seguir protocolos estándar para qPCR12. Brevemente, realizar una qPCR usando SYBR verde mix master, 0,5 μl de la concentración de trabajo de 10 μm de cada primer avance y retroceso y 2 μl del ChIP o del ADN de entrada. Leer las placas mediante un sistema de PCR en tiempo Real. Secuencias de la cartilla se proporcionan en la tabla 2. Las secuencias de la cartilla de Gapdh de Hwang et al. fueron usados13.
    4. Analizar datos de la viruta relativa a la entrada, es decir, % entrada método (% IP)14. Calcular el porcentaje de entrada usando las siguientes fórmulas:
      Ajustar la entrada = media ct (entrada)-sesión2(DF)
      donde DF es el factor de dilución de la entrada inicial y
      DF = volumen total de la propiedad intelectual / volumen de entrada
      % IP = 100 × 2 ^ (ajustar entrada - Ct (IP))
      donde Ct es el factor del umbral.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Una representación esquemática del tumor NS generados a partir de un tumor cerebral donde las células del tumor cerebral son Katushka positivo se presenta en la figura 1. Figura 2 es una representación esquemática de la técnica de ChIP toda. Figura 3 muestra los resultados representativos de la cromatina de tumor cerebral NS digerido con MNase de 12 min, dando una mayoría de mono, di y tri-nucleosomas. Después de ChIP, una qPCR puede realizarse en el ChIP y entrada DNA muestras. La figura 4 muestra datos representativos de qPCR de viruta de una qPCR de gliceraldehído-3-fosfato deshidrogenasa (Gapdh). GAPDH es un gen de limpieza que se enriquece con H3K4me3, una modificación que se asocia con transcripción activa. Los resultados muestran que Gapdh se enriquece con H3k4me3 y no están enriquecidas con H3K27me3 que es una modificación del asociada a regiones de la cromatina reprimida.

Figure 1
Figura 1: esquema de tumor NS generados a partir de un tumor de cerebro positivo Katushka. Un campo brillante y fluorescente imagen de un cerebro de un ratón llegado el punto final. El área del tumor está delineado por la línea punteada y es positivo para el reportero fluorescente, Katushka. El tumor es aislado y el tejido del tumor se recoge en un tubo de 1,5 mL. Las células son entonces disociadas y cultivadas en forma de NSC medio y tumor NS. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: una representación esquemática del flujo de trabajo nativo chip. Tumor NS son cultivadas y ampliados. Cada IP se realiza con 1 X 106 células. La cromatina está fragmentada mediante digestión MNase mono, di-y tri-nucleosomas. La cromatina se incuba con un anticuerpo específico para una modificación de las histonas o proteína ADN de interés. El complejo anticuerpo-DNA es immunoprecipitated con granos A/G de proteína magnética. Finalmente, la proteína es digerida y DNA se purifica para obtener sólo ADN enriquecido con modificación de las histonas o proteínas asociadas de ADN de interés. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: fragmentación de la cromatina por MNase. La cromatina fue preparada de tumor cerebral NS por la adición de MNase y de incubación a 37 ° C para exactamente 12 min. ADN representativos los resultados de equipo Bioanalyzer análisis de una muestra de entrada demuestran que la mayoría de la DNA se ha fragmentado en mono-, di- y tri- nucleosomas. Carril 1 es la escala de pares de bases (PB). Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: datos de qPCR representante ChIP presentados como entrada porcentaje. qPCR fue realizada con IgG, H3K4me3 y H3K27me3 ChIP de ADN usando las cartillas de gliceraldehído-3-fosfato deshidrogenasa (Gapdh). Resultados representativos demuestran que Gapdh, un gen de la limpieza, sólo se enriquece con la modificación H3K4me3, asociados a transcripción activa y no la modificación de H3K27me3, asociadas con la cromatina reprimida. Este gráfico representa los resultados de dos experimentos biológicos con tres pozos replicadas. Barras de error representan el error estándar de la media (SEM). Haga clic aquí para ver una versión más grande de esta figura.

Gene Primer avance Primer revés
GAPDH TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabla 1: Cebadores utilizan para experimentos de qPCR de ChIP. En esta tabla se proporcionan las secuencias de los primers utilizados para Gapdh.

media Ct (entrada) Desviación estándar Entrada ajustada
24.265 0.071 20.943
Entrada por ciento
Muestra Ct significa crudo Desviación estándar Entrada por ciento = 100 * 2 ^ (ajustado input-Ct(IP))
De igG 32.23 0.112 0.04
H3K4me3 22.148 0.128 43.37
H3k27me3 32,79 0.519 0.027
NTC indeterminado indeterminado indeterminado

Tabla 2: cálculo de la muestra de lo por ciento método para análisis de qPCR de ChIP de entrada. Cálculo de muestra de los por ciento de la entrada para ChIP con 10% a partir la entrada; DF = 10. Los números en esta tabla muestran los valores crudos de un experimento biológico con repetición 3 pozos ejecutan para cada muestra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El protocolo que presentamos le permitirá al usuario realizar ChIP nativo en NS derivado de tumores cerebrales mediante ingeniería genética. En contraste con cross-linking el ChIP, este protocolo es limitado para el estudio de las proteínas que se asocian estrechamente con ADN6. El número de células utilizadas puede modificarse según sea necesario y el protocolo puede ampliarse. Se utilizaron 1 X 106 células por IP, sin embargo, ChIP nativo también se puede realizar con tan poco como 4 x 104 células5. En este protocolo, se analizaron ADN de ChIP mediante qPCR; sin embargo, este protocolo también puede combinarse con la siguiente secuencia de generación para el estudio de las interacciones DNA proteína a nivel de genoma amplio. Hemos utilizado este protocolo ChIP con éxito para analizar el efecto de oncogenes de glioma en la deposición de modificaciones de las histonas en regiones específicas del genoma de las células del tumor.

Hay algunos pasos críticos al realizar ChIP nativo. En primer lugar, las condiciones de digestión para cada tipo de célula deben determinarse empíricamente. La mayoría de la cromatina debe ser mono-nucleosomas (150 bp) con algunos picos de di - y tri-nucleosoma (figura 3). Nuestros resultados de protocolo en más de 70% mono-, di- o tri-nucleosoma picos, sin embargo, algunos no digerida ADN permanece. Si se utiliza el protocolo para ChIP-seq, se requerirá pasos adicionales para eliminar el ADN no digerida. Además, es importante tener en cuenta que cada lote de MNase comprado puede difieren en actividad y por lo tanto requieren optimización de las condiciones de digestión. En segundo lugar, la calidad de un ChIP depende altamente de la especificidad del anticuerpo usado11. Un anticuerpo de la viruta de alta calidad debe tener alta reactividad contra el objetivo y baja reactividad cruzada con otras proteínas ADN asociados o destino histona modificaciones11. Por esta razón, se recomiendan pruebas de especificidad del anticuerpo mediante una prueba de unión de péptido. CODIFICAR las guías sugieren que un enriquecimiento multiplicado debe observarse para la modificación del interés relativo a otras modificaciones11. También es importante realizar immunoprecipations de control necesarias, es decir, inmune previo o control de IgG. Cuando se cumplen estas consideraciones, datos de ChIP nativo están un método fiable fuerte para estudiar mecanismos epigenéticos regulados por interacciones DNA proteína.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

Este trabajo fue financiado por los institutos de salud nacional Instituto Nacional de desórdenes neurológicos y derrame cerebral (NINDS/NIH) subvenciones R37-NS094804, NS074387 R01, R21-NS091555 a M.G.C.; NIH/NINDS becas R01-NS076991, NS082311 R01 y R01-NS096756 de P.R.L.; NIH/NINDS R01-EB022563; el Departamento de Neurocirugía; Lea, corazones felices y Chad aunque Fundación a M.G.C. y P.R.L. RNA biomedicina Grant F046166 a M.G.C. F.M.M. es apoyado por un F31 NIH/NINDS-F31NS103500. R.I.Z.-V. es apoyado por los NIH / NIGMS conceder 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics