Native Chromatin Immunopräzipitation mit Murine Gehirn Tumor Neurosphären

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Epigenetische Mechanismen werden häufig in Gliom verändert. Chromatin Immunopräzipitation könnte verwendet werden, um die Auswirkungen der genetischen Veränderungen, die in Gliom zu studieren, die aus Änderungen in Histon Änderungen ergeben, die Chromatin Struktur und gen-Transkription regulieren. Dieses Protokoll beschreibt native Chromatin Immunopräzipitation auf murine Gehirn Tumor Neurosphären.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetische Veränderungen können in der Entstehung und Progression von Gliom beteiligt sein. Veränderungen in der Methylierung und Acetylierung von Promotoren und regulatorischen Regionen der Onkogene und Tumor-Suppressoren können führen zu Veränderungen in der Genexpression und spielen eine wichtige Rolle in der Pathogenese von Hirntumoren. Native Chromatin Immunopräzipitation (ChIP) ist eine populäre Technik, die erlaubt die Erkennung von Änderungen oder andere Proteine fest an DNA gebunden. Im Gegensatz zu vernetzten ChIP in native ChIP sind Zellen nicht mit Formaldehyd Protein kovalent an DNA Verbindung behandelt. Dies ist vorteilhaft, weil manchmal Vernetzung kann Proteine, die nur vorübergehend mit der DNA interagieren und haben keine funktionelle Bedeutung im Genregulation zu beheben. Darüber hinaus werden Antikörper gegen fixierten Peptide in der Regel ausgelöst. Daher wird Antikörperbesonderheit native ChIP erhöht. Allerdings ist es wichtig, im Auge zu behalten, die native ChIP nur anwendbar ist auf Histone oder anderen Proteinen, die eng an DNA binden zu studieren. Dieses Protokoll beschreibt die native Chromatin Immunopräzipitation auf murine Gehirn Tumor Neurosphären.

Introduction

Epigenetische Ereignisse sind häufig in Gliome und wahrscheinlich eine wichtige Rolle in der Pathogenese der Tumor. In der Tat in pädiatrischen hochwertige Gliom treten Mutationen in den Genen Codierung Histon-Varianten H3.3 und H3.1 häufig1. Die Mutationen beeinflussen Histon Änderungen und wichtige epigenetische folgen2,3. In der Jugendlichen zu Erwachsenen Spektrum auftreten, wiederkehrende Mutationen im Isocitrate Dehydrogenase Gen 1/2 (IDH1/2), eine Mutation, die α-KG abhängigen Histon und DNA-de-Methylasaes hemmt und genetische Veränderungen in den anderen Chromatin Aufsichtsbehörden wie ATRX und DAXX 4. Daher ist es von entscheidender Bedeutung, wie Mutationen, die epigenetische Regulatoren beeinflussen ändern Chromatinstruktur und regulatorischen Histon Modifikationen, die sich erheblich von den Tumorzellen Transkriptom wiederum haben zu studieren.

Chromatin Immunopräzipitation (ChIP) ist ein leistungsfähiges Werkzeug zur Bewertung der Auswirkungen der epigenetischen Veränderungen im Genom5,6,7. In native ChIP Chromatin ist mit micrococcal Nuklease (MNase), Immunoprecipitated mit einem Antikörper gegen das Protein des Interesses, verdaut und dann DNA wird aus dem Immunoprecipitated Chromatin komplexe6gereinigt. Zellen sind nicht während des Verfahrens festgelegt, so ist diese Technik nur für die Untersuchung von Proteinen, die eng mit DNA6interagieren. Das Fehlen der Vernetzung hilft Antikörperbesonderheit, da Antikörper in der Regel gegen fixierten Peptide oder Proteine7ausgelöst werden. Darüber hinaus, da gibt es keine Vernetzung Schritt, dies reduziert die Chancen der Festsetzung transiente Protein-DNA-Wechselwirkungen, die sind unspezifisch und nicht gesetzlichen7,8. ChIP kann verwendet werden, um die Anreicherung von Histon-Modifikationen in einer bestimmten genomic Region zu identifizieren. Hier zeigen wir ein Protokoll für Durchführung native ChIP in Neurosphären (NS) aus gentechnisch erzeugten Mausmodelle der Gliom entwickelt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle hier beschriebene Methoden wurden von den institutionellen Animal Care und Nutzung Committee (IACUC) von der University of Michigan genehmigt.

1. Generation von Hirntumor NS und Kultivierung Bedingungen.

  1. Neuronale Stammzellen Medium (NSC) mit Dulbeccos geändert Eagle Medium/F12B27 Ergänzung (1 X), N2-Ergänzung (1 X) und eine antimikrobielle Reagenz vorbereiten. NSC-Medium am Tag der Verwendung mit menschlichen rekombinante endothelialen Wachstumsfaktor (EGF) und Basic-Fibroblasten-Wachstumsfaktor (FGF) auf eine Endkonzentration von 20 ng/mL zu ergänzen.
  2. Induzieren Sie die Hirntumoren bei Maus über das Dornröschen Transposon-System in dem Plasmide Codierung Onkogene oder ShRNA targeting Tumor-Suppressoren eingespritzt werden in der seitlichen Ventrikel von Neugeborenen, um spontane Gehirn Tumoren9zu generieren. Wählen Sie eine Maus mit einem großen Tumor, der mit Biolumineszenz Bildgebung bestätigt wird.
    Hinweis: Weitere Informationen über die Schönheit Transposon Schlafsystem und Plasmid Konstrukte verwendet Calinescu Et Al. entnehmen 9.
    1. Um die Mäuse zu Bild, 100 µL von 30 mg/mL Luciferin Lösung intraperitoneal mit einem 26 Gauge-Nadel zu injizieren.
    2. 5 min nach Injektion von Luciferin, betäuben das Tier mit einer Anästhesie-Kammer mit Sauerstoff/Isofluran Strömung auf 2 % Isofluran festgelegt.
    3. Wann werden die Tiere betäubt (in der Regel ca. 2-3 min), legen Sie die Tiere in der Biolumineszenz-Kammer mit Sauerstoff Isofluran auf 2 % Isofluran festgelegt. Wenn die Tiere unter Narkose länger als 5 Minuten sein, verwenden Sie eine ophthalmologische Salbe, um Trockenheit während der Narkose zu verhindern.
    4. Die Mäuse, die über ein in-Vivo imaging-System mit den folgenden Parametern optische Bild: automatische Belichtung, große binning und Blende f = 1. Der Parameter halte es für einen großen Tumor ist eine Biolumineszenz > 106 Photonen/s/cm2/sr.
  3. Einschläfern der Maus mit einer Überdosis Isofluran Inhalation Narkose in einer geschlossenen Kammer, überprüfen von Zeh kneifen, dass das Tier betäubt ist, und die Maus zu enthaupten.
  4. Extrahieren Sie das Gehirn und sezieren Sie, wie zuvor beschrieben in Calinescu Et al. 9.
  5. Legen Sie das Gehirn in einer 10 cm Petrischale. Wenn der Tumor induziert ein fluoreszierendes Protein ausdrückt, Verwendung eine fluoreszierende sezieren Mikroskop auf die entsprechenden fluoreszierende Kanal und 0,3 X Vergrößerung eingestellt ansonsten Tumor Masse durch die Unterschiede im Gewebe Farbe und Textur zu identifizieren. Verwenden Sie Skalpell und Pinzette, um das Tumorgewebe vom normalen Gehirn zu trennen.
  6. Hacken Sie den Tumor, in kleine Stücke in der Petrischale. Ort der seziert Tumor in einem 1,5 mL Röhrchen mit 300 µL des Mediums NSC.
  7. Verwenden Sie eine Einweg Plastik Pellet-Stößel, die an den Wänden einen konischen Microcentrifuge Schlauch passt auf den Tumor schonend homogenisieren. Fügen Sie 1 mL der Zelle Ablösung Medium und inkubieren die Probe für 5 min bei 37 ° c
    Hinweis: Die Verwendung von einem Stößel kann einige Zellen abzutöten. Wenn der Leser die Zellviabilität zu maximieren will, kann die Verwendung von einem Stößel entfallen.
  8. Passieren Sie die Zellsuspension ab 1.7 Schritt durch ein 70 µm Zelle Sieb und waschen Sie das Sieb mit 25 mL NSC Medium.
  9. Zentrifugieren Sie die Federung bei 300 X g für 5 min bei Raumtemperatur, abgießen Sie überstand und wieder auszusetzen Sie das Pellet in 6 mL NSC Medium.
  10. Platte die Tumor-Zellsuspension vom Schritt 1,9 in einem t-25-Kultur-Kolben und bei 37 ° C in einer Gewebekultur Inkubator mit einer Atmosphäre von 95 % Luft und 5 % CO2Kultur. In der Regel nach 3 Tagen werden eine Mischung aus einigen toten Zellen, eingehalten Zellen und einige Zellen, aus denen NS, die mittelfristig zu schweben.
  11. Übertragen die Zellsuspension in ein 15 mL konische Röhrchen, sammeln nur die Zellen, die an der Unterseite mit einer Mikropipette sinken und sie wieder auf einem T-75 Gewebekultur Kolben Platte.
  12. Pflegen Sie die Zellen in relativ hoher Dichte (1-3 X 106 Zellen in einem t-25). Durchgang der Zellen, wenn sie konfluierende sind.
    Hinweis: Konfluenz richtet sich nach der Größe der Kugeln. Schwarzen Zentren der großen Kugeln bedeuten, die sind abgestorbene Zellen in der Mitte und zeigen, dass die Zellen sofort passagiert werden sollte.
  13. Fügen Sie die Wachstumsfaktoren (EGF und Basic-FGF; 20 ng/mL) alle drei Tage. Verändern Sie das Medium, wenn die Zellen nicht Zusammenfluss und die mittlere dreht helles Orange sind.
  14. Um das Medium zu ändern, das alte Medium zu sammeln und bei 300 X g bei Raumtemperatur für 5 min Zentrifugieren und wieder aussetzen der Zelle Pellet im NSC Medium ergänzt mit EGF und FGF bei der Konzentration im Schritt 1.1 angegeben.
    Hinweis: Wenn die Kugeln sind Mitte-zu hohe Konfluenz, aber nicht bereit, passagiert werden (Kugelgröße ist klein mit einem Durchmesser < 100 µm), dann das Pellet in zwei Fläschchen aufgeteilt werden kann.
  15. Um die Zellen passage, Zentrifugieren der Zellen bei 300 X g für 5 min bei Raumtemperatur, überstand abgießen und die Zellen in Zelle Ablösung Medium für 5 min bei 37 ° c inkubieren
    1. Verdünnte Ablösung Medium 5 mL einer ausgeglichenen Salzlösung hinzu und Zentrifugieren Sie es bei 300 X g für 5 min bei Raumtemperatur.
    2. Den Überstand abgießen, Aufschwemmen der Zelle Pellet in 18 mL NSC Medium und teilen die Aussetzung gleich in drei t-25 Flaschen.
  16. Um die Aliquote von Zellen zu fixieren, die Zellen wie in Schritt 1.15 distanzieren, und Einfrieren der Zellen in 1 mL Aliquote des fötalen Rinderserum 90 % mit 10 % Dimethyl Sulfoxid. Langsam abkühlen lassen die Zellen durch die Zellen für 10 min auf Eis legen, dann halten die Zellen-20 ° C für 30 min und-80 ° C für 1 Tag. Übertragen Sie am nächsten Tag die Zellen auf einem Flüssigstickstoff-Behälter.

(2) native ChIP

  1. Chromatin-Vorbereitung
    1. Nachdem Sie haben Lager abgeleitete NS, Kultur NS in ein T-75 in 15 mL NSC-Medium bei 37 ° C in einer Gewebekultur Inkubator mit einer Atmosphäre von 95 % Luft und 5 % CO2 bis NS konfluierende geworden. Eine konfluierende T-75 Platte wird 3-5 X 106 Zellen führen.
    2. Wenn die Zellen konfluierende werden, NS 300 X g für 5 min Zentrifugieren, überstand abgießen und 1 mL Zelle Dissoziation Medium. Brüten Sie die Zellen bei 37 ° C für 5 min. hinzufügen 5 mL Medium und zählen Sie die Zellen mit einem Hemocytometer10.
      Hinweis: 1 x 106 Zellen sind pro Immunopräzipitation (IP) Reaktion erforderlich. Beachten Sie, dass ein bereits immun Serum oder IgG-Steuerelement enthalten11auch sein muss.
    3. Zentrifugieren Sie NS in einem 1,5 mL Microcentrifuge Schlauch 300 X g für 5 min, abgießen Sie überstand und wieder auszusetzen Sie NS Pellet mit 1 mL einer ausgeglichenen Salzlösung und übertragen Sie die Aussetzung auf low-Protein Bindung 1,5 mL Mikrozentrifugenröhrchen.
    4. Zentrifuge NS 300 X g für 5 min, überstand abgießen und wieder aussetzen der Zelle Pellet in 95 µL Verdauung Puffer (50 mM Tris-HCl, pH 8.0, 1 mM CaCl2, 0,2 % Polyethylenglykol Octylphenyl Äther) pro 1 x 106 Zellen mit Protease ergänzt Inhibitor cocktail in einer hohen Konzentration (1: 100). Sofort pipettieren die Zellen oben und unten um zu verhindern, verklumpen und Luftblasen vermeiden.
    5. Aufschwemmen Sie MNase in 50 % Glycerin zu 1 mg/mL Lösung (1,15 Einheiten/µL, bei-20 ° C gelagert), die als "1 X" Lager bezeichnet wird. Machen eine "0,1 X" Lager auf diese Weise eine zweite Verdünnung von 1:9 mit 50 % Glycerin (zB., 900 µL "1 X" MNase und 100 µL 50 % Glycerin) und speichern Sie es bei-20 ° C.
    6. Mix 5 µL "0,1 X" MNase und 145 µL Verdauung Puffer. Halten Sie das Enzym auf Eis aller Zeiten. 5 µL verdünnter MNase in Verdauung Puffer pro 1 x 106 Zellen hinzufügen. Streichen Sie dem Rohr zu mischen und das Rohr in 37 ° C Block für genau 12 min. Prozess die Proben einer gleichzeitig, um eine genaue Inkubationszeit von 12 min zu gewährleisten.
    7. Fügen Sie 10 µL 10 x MNase Stop Buffer (110 mM Tris-HCl, pH 8.0, 55 mM EDTA) pro 1 x 106 Zellen. Proben sind auf dem Eis ab diesem Zeitpunkt aufzubewahren.
    8. Fügen Sie 110 µL "2 X RIPA Puffer" (280 mM NaCl, 1,8 % Polyethylenglykol Octylphenyl Äther, 0,2 % Natrium-Dodecyl-Sulfat (SDS), 0,2 % Na-Deoxycholate, 5 mM Ethylenglykol-Bis(β-aminoethyl ether)-N, N, N', N'-Tetraacetic Säure (EGTA); bei 4 ° C gelagert) ergänzt mit Protease-Hemmer cocktail in hoher Konzentration (1: 100) pro 1 x 106 Zellen. Streichen Sie das Rohr zu mischen.
    9. Die Rohre für 15 min in ein Microfuge bei 4 ° C zentrifugiert und 1700 X g. Überstand auf eine neue regelmäßige 1,5 mL Mikrozentrifugenröhrchen (low-Protein Bindung Mikrozentrifugenröhrchen entfallen) übertragen und speichern diese auf Eis. Entsorgen Sie das Pellet.
  2. Immunopräzipitation (IP)
    1. Mischen Sie Protein A und G Protein magnetische Beads im Verhältnis 1:1. Bereiten Sie für jede IP-25 µL der Perlen.
    2. Waschen Sie die Perlen durch Zugabe von 1 mL RIPA-Puffer (10 mM Tris pH 8.0, 1 mM EDTA, 140 mM NaCl, 1 % Polyethylenglykol Octylphenyl Äther, 0,1 % SDS, 0,1 % Na-Deoxycholate; bei 4 ° C gelagert) ergänzt mit Protease-Inhibitoren bei niedrigen Konzentration (1: 1000).
    3. Mithilfe ein Magneten Perlen zu trennen von der Waschlösung und Dekantieren der Waschlösung (ca. 1 min). Durchführen Sie der Waschschritt zweimal.
    4. Wieder aussetzen Sie, die Perlen auf das ursprüngliche Volume mit RIPA Puffer mit Protease-Inhibitoren (1: 1000) ergänzt.
    5. Wenn nötig, verdünnen behalten das Chromatin mit RIPA Puffer mit Protease-Inhibitoren (1: 1000) ergänzt, so dass jedes IP ein Volumen von 100-200 hat µL. 10 % des Volumens pro IP-Adresse des Chromatins für die Eingabe verwendet.
      Hinweis: zum Beispiel, wenn 200 µL pro IP verwendet werden, sollte 20 µL verdünnter Chromatin für die Eingabe reserviert werden. Für insgesamt vier IPs sollte insgesamt Chromatin Volumen um 820 µL verdünnt werden.
    6. Bereiten Sie die Eingabe. Hinzufügen von 100 µL TE-Puffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) ergänzt mit Proteinase K (0,5 mg/mL) mit dem Eingang und inkubieren Sie die Eingabe bei 55 ° C für 1 h.
      Hinweis: Die Schritte 2.2.6-2.2.7 kann zusammen mit Schritten 2.3.4 und 2.4.1 durchgeführt werden.
    7. Reinigen Sie die Eingabe mit einem PCR-Reinigung-Kit nach Herstellerangaben und eluieren in 50 µL der Elution Puffer im Kit.
    8. Messen Sie die Konzentration von den Eingang mit einem Microvolume Spektralphotometer und zeichnen Sie die Ergebnisse in einem Notebook. Blank mit Elution Puffer vom Kit.
      Hinweis: In Maus Neurosphären wir etwa 6 µg DNA für jede IP-Adresse verwendet.
    9. Laufen auf einem 1 % Gel ein- oder 1 µL auf ein DNA-Bioanalyzer mit Standardeinstellungen zu laden. Speichern Sie den Rest für den Einsatz als Eingabe in downstream-Anwendungen.
    10. Fügen Sie 10 µL der gewaschenen Protein A & G magnetische Beads für jede IP-Adresse und inkubieren IP für 1 h bei 4 ° c
      Hinweis: Z. B. 30 µL Protein A & G magnetische Beads nach drei IP-Adressen hinzufügen.
    11. Die Proben auf einen Magneten und Perlen zu trennen. Teilen Sie Chromatin durch Übertragung der zuvor festgelegten Betrags in eine neue 1,5 mL Tube.
    12. Fügen Sie des Antikörpers und wickeln Sie die Kappen mit Kunststoff Paraffin Film um Verdunstung zu vermeiden. Inkubieren Sie die Proben über Nacht bei 4 ° C mit Rotation bei 20 u/min.
      Hinweis: Konzentration sollte empirisch nach Empfehlungen des Herstellers bestimmt werden.
    13. Am nächsten Tag, drehen Sie die Rohre mit einer Mini-Zentrifuge bei Raumtemperatur, 2000 X g für 10 s. Dann jedes IP 10 µL Perlen hinzu und inkubieren Sie IP für 3 h bei 4 ° C mit Rotation bei 20 u/min.
  3. IP-Waschungen und Proteinverdauung
    1. 150 µL RIPA Puffer mit Protease-Inhibitoren bei niedrigen Konzentration (1: 1000) auf jede IP ergänzt und inkubieren Sie IP bei 4 ° C mit Rotation bei 20 u/min für 5 min. Ort der Probe auf einem Magnetstativ und lassen Sie die magnetische Beads zu trennen. Verwenden Sie ein pipettieren, um den Überstand zu entfernen. Wiederholen Sie diese Tep fünf Wäschen.
    2. Fügen Sie 150 µL LiCI Puffer (250 mM LiCI, 10 mM Tris pH 8.0, 1 mM EDTA, 0,5 % NP-40, 0,5 % Na-Deoxycholate; Shop bei 4 ° C) ergänzt mit Protease-Inhibitoren bei niedrigen Konzentration (1: 1000) auf jede IP und IP bei 4 ° C mit Rotation bei 20 u/min für 5 min. Ort der Probe inkubieren auf einem magnetischen stehen und magnetische Kügelchen trennen lassen. Verwenden Sie ein pipettieren, um überstand zu entfernen.
    3. 150 µL des kalten TE (keine Proteaseinhibitoren) und inkubieren Sie der Probe bei 4 ° C mit Rotation bei 20 u/min für 5 min. Ort der Probe auf einem Magnetstativ und magnetische Beads zu trennen. Verwenden Sie ein pipettieren, um den Überstand zu entfernen.
    4. Nach dem letzten Waschschritt erneut aussetzen der Probenmaterials in 100 µL TE-Puffer ergänzt mit Proteinase K (0,5 mg/mL) und inkubieren Sie die Probe bei 55 ° C für 1 h.
  4. DNA-Reinigung und ChIP Quantitative Real-Time PCR (qPCR)
    1. Reinigen Sie Immunoprecipitated DNA mit einem PCR-Reinigung-Kit. Platzieren Sie nach Zugabe von DNA-Bindung Puffer aus dem Kit zu jeder Probe das Rohr auf einen Magneten und warten Sie, bis Aggregat, magnetische Beads dann überstand zur Bereinigung Spalte übertragen. Folgen Sie den Anweisungen des Herstellers und eluieren in 50 µL der Elution Puffer im Kit.
    2. Um zu überprüfen, ob die IP-Adresse erfolgreich ist, führen Sie eine qPCR. Im Idealfall sollten Zündkapseln für positive und negative Kontrollregionen ausgelegt werden.
      Hinweis: zum Beispiel für eine IP-Adresse mit H3K4me3 und H3K27me3 durchgeführt, die folgenden Beispiele sollten ausgeführt werden auf qPCR: H3K4me3, H3K27me3 und IgG ChIP DNA, Eingang DNA und ein keine Vorlagensteuerelement (NTC) mit Primern für Regionen mit H3K4me3 angereichert werden (positive Kontrolle) und Regionen mit H3K4me3 angereichert werden (negative Kontrolle); ebenso für H3K27me3.
    3. Folgen Sie Standardprotokolle qPCR12ausführen. Kurz gesagt, führen Sie eine qPCR mit SYBR green master-Mix 0,5 µL 10 µM arbeiten Konzentration jedes vorwärts und rückwärts Grundierung und 2 µL des Chips oder Eingabe DNA. Lesen Sie die Platten mit einem Real-Time PCR System. Primer-Sequenzen sind in Tabelle 2angegeben. Die Gapdh Grundierung Sequenzen von Hwang Et Al. gebrauchte13waren.
    4. Analysieren von ChIP Daten bezogen auf den Eingang, d. h. Prozent Eingang Methode (% IP)14. Berechnen Sie die Prozent-Eingabe anhand der folgenden Formeln:
      Eingabe angepasst = mittlere ct (Eingang)-melden Sie sich2(DF)
      wo DF ist der Verdünnungsfaktor der Start Eingabe und
      DF = Gesamtvolumen von IP / Volumen des Eingangs
      % IP = 100 × 2 ^ (Eingang - Ct (IP) bereinigt)
      wo ist Ct der Schwellfaktor.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Eine schematische Darstellung des Tumors NS generiert aus einem Gehirntumor wo Gehirn Tumorzellen Katushka positiv sind, ist in Abbildung 1dargestellt. Abbildung 2 zeigt eine schematische Darstellung der gesamten ChIP Technik. Abbildung 3 zeigt die repräsentativen Ergebnisse von Chromatin von Gehirntumor NS verdaut mit MNase für 12 min, eine Mehrheit von Mono-, di- und Tri-Nukleosomen nachgeben. Nach ChIP, ein qPCR kann auf dem ChIP durchgeführt werden und geben Sie DNA Proben. Abbildung 4 zeigt repräsentative ChIP qPCR Daten aus einem qPCR für Glyceraldehyde-3-Phosphat-Dehydrogenase (Gapdh). Gapdh ist ein Zimmermädchen-gen, das ist angereichert mit H3K4me3, eine Änderung, die aktive Transkription zugeordnet ist. Die Ergebnisse zeigen, dass Gapdh ist mit H3k4me3 angereichert und sind nicht angereichert mit H3K27me3, die eine Änderung, die Regionen des verdrängten Chromatin zugeordnet ist.

Figure 1
Abbildung 1: Schematische Tumor erzeugt aus einem Katushka positive Gehirntumor NS. Ein Hellfeld und fluoreszierende Bild eines Gehirns, geerntet von einer Maus, die das Stadium der Endpunkt erreicht. Der Tumor ist durch die gestrichelte Linie abgegrenzt und ist positiv für den fluoreszierenden Reporter, Katushka. Der Tumor ist dann isoliert und das Tumorgewebe wird in einem 1,5 mL Röhrchen gesammelt. Die Zellen werden dann getrennt und kultiviert in NSC-Medium und Tumor-NS-Form. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Schematische Darstellung des Workflows für native ChIP. Tumor-NS sind kultiviert und erweitert. Jede IP wird mit 1 X 106 Zellen durchgeführt. Chromatin ist fragmentiert, indem MNase Verdauung, um Mono-, di- und Tri-Nukleosomen zu erhalten. Das Chromatin wird mit einem Antikörper, der spezifisch für ein Histon Änderungen oder DNA-assoziierten Protein des Interesses inkubiert. Der Antikörper-DNA-Komplex ist Immunoprecipitated mit magnetischen Protein A/G Perlen. Zu guter Letzt Eiweiß verdaut und DNA ist gereinigt, um nur DNA angereichert mit Histon-Modifikationen oder DNA-assoziierten Protein des Interesses zu erhalten. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Chromatin Fragmentierung von MNase. Chromatin wurde von Hirntumor NS durch den Zusatz MNase und Inkubation bei 37 ° C für genau 12 min. repräsentative DNA Ergebnisse aus Bioanalyzer Analyse von einem Eingabesample zeigen, dass die Mehrheit der DNA in Mono-, di- und Tri - fragmentiert wurde vorbereitet Nukleosomen. Bahn 1 ist die Leiter in Basenpaaren (BP). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Vertreter ChIP qPCR Datendarstellung als prozentuale Eingabe. qPCR erfolgte mit IgG, H3K4me3 und H3K27me3 ChIP DNA Zündkapseln für Glyceraldehyde-3-Phosphat-Dehydrogenase (Gapdh) verwenden. Repräsentative Ergebnisse zeigen, dass Gapdh, ein Zimmermädchen-gen nur mit der H3K4me3 Änderung, aktive Transkription zugeordnet und nicht die H3K27me3 Änderung, verbunden mit verdrängten Chromatin angereichert ist. Dieses Diagramm stellt die Ergebnisse von zwei biologische Experimente mit drei replizieren Brunnen laufen. Fehlerbalken darzustellen Standardfehler des Mittelwertes (SEM). Bitte klicken Sie hier für eine größere Version dieser Figur.

Gen Forward primer Rückwärts-primer
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabelle 1: Primer für ChIP qPCR Experimente verwendet. In dieser Tabelle werden die Sequenzen für Primer verwendet für Gapdh bereitgestellt.

meine Ct (Eingang) Standardabweichung Angepasste Input
24.265 0.071 20.943
Prozent-Eingang
Probe RAW bedeutet Ct Standardabweichung Prozentuale Eingabe = 100 * 2 ^ (input-Ct(IP)) angepasst
IgG 32.23 0.112 0,04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0,519 0,027
NTC unbestimmt unbestimmt unbestimmt

Tabelle 2: Beispielrechnung der Prozent Eingabemethode für ChIP-qPCR-Analyse. Beispielrechnung Prozent Eingang für ChIP mit 10 % ab Eingabe durchgeführt; DF = 10. Die Zahlen in dieser Tabelle veranschaulichen die Rohwerte eines biologischen Experiments mit 3 replizieren, die Brunnen für jede Probe laufen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Das Protokoll hier vorgestellten ermöglicht den Benutzer durchführen native ChIP auf NS gentechnisch Hirntumoren abgeleitet. Im Gegensatz zur Vernetzung ChIP, beschränkt sich dieses Protokoll für das Studium der Proteine, die DNA6fest zugeordnet. Die Anzahl der verwendeten Zellen kann nach Bedarf geändert werden und das Protokoll kann hochskaliert werden. Wir haben 1 X 106 Zellen pro IP, native ChIP kann jedoch auch mit weniger als 4 x 104 Zellen5durchgeführt werden. In diesem Protokoll analysierten wir ChIP-DNA über qPCR; Dieses Protokoll kann jedoch auch mit der nächsten Generation-Sequenzierung, DNA-Protein Interaktionen auf einer breiten Ebene Genom zu studieren kombiniert werden. Wir haben dieses ChIP-Protokoll erfolgreich eingesetzt, um die Wirkung von Gliom Onkogene auf die Ablagerung von Histon-Modifikationen in bestimmten Regionen des Genoms Tumor Zellen zu analysieren.

Es gibt ein paar wichtige Schritte beim nativen ChIP durchführen. Erstens müssen die Verdauung Bedingungen für jeden Zelltyp empirisch ermittelt werden. Die Mehrheit des Chromatins sollte Mono-Nukleosomen (150 bp) mit einigen di und Tri-Nukleosom-Gipfel (Abbildung 3). Unser Protokoll Ergebnisse in mehr als 70 % Mono-, di- oder Tri-Nukleosom Gipfeln, bleibt jedoch einige unverdaute DNA. Wenn das Protokoll für ChIP-Seq verwendet wird, werden weitere Schritte erforderlich, um unverdaute DNA zu entfernen. Darüber hinaus ist es wichtig zu beachten, dass jede Charge eines MNase gekauft kann unterscheiden sich in Aktivität und erfordern daher die Optimierung der Verdauung Bedingungen. Zweitens hängt die Qualität eines Chips die Spezifität der Antikörper verwendet11. Ein qualitativ hochwertiger ChIP Antikörper sollten hohe Reaktivität gegen das beabsichtigte Ziel und niedrigen Kreuz Reaktivität mit anderen DNA-assoziierte Proteine oder aus Ziel Histon Änderungen11haben. Aus diesem Grund empfehlen wir, Antikörperbesonderheit mit einem Peptid-Bindung-Test testen. ENCODE-Richtlinien legen nahe, dass eine zehnfache Bereicherung für die Änderung der Zinsen im Vergleich zu anderen Modifikationen11beobachtet werden sollte. Es ist auch entscheidend für die notwendige Kontrolle Immunoprecipations, d. h., Pre-Immune oder IgG-Kontrolle durchführen. Wenn diese Überlegungen zutreffen, ist native ChIP-Daten eine starke zuverlässige Methode um epigenetische Mechanismen reguliert durch Protein-DNA-Wechselwirkungen zu studieren.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgements

Diese Arbeit wurde durch nationale Institute der Gesundheit/National Institute of Neurological Disorders, R21-NS091555, M.G.C. & Schlaganfall (NIH/NINDS) Zuschüsse R37-NS094804, R01-NS074387 unterstützt; NIH/NINDS gewährt R01-NS076991 R01-NS082311 und R01-NS096756 P.R.L.; NIH/NINDS R01-EB022563; der Abteilung für Neurochirurgie; Leahs Happy Hearts und Tschad obwohl Stiftung, M.G.C. und P.R.L. RNA Biomedizin Grant F046166, M.G.C. F.M.M. wird unterstützt durch eine F31 NIH/NINDS-F31NS103500. R.I.Z.-V. wird unterstützt durch das NIH / NIGMS grant 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics