Native kromatin Immunoprecipitation ved hjælp af Murine hjerne Tumor Neurospheres

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Epigenetiske mekanismer er ofte ændret i gliom. Kromatin immunoprecipitation kunne bruges til at studere konsekvenserne af genetiske ændringer i gliom, der skyldes ændringer i Histon ændringer, som regulerer kromatin struktur og gen transskription. Denne protokol beskriver indfødte kromatin immunoprecipitation på murine hjerne tumor neurospheres.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetiske ændringer kan være involveret i udvikling og progression af gliom. Ændringer i methylering og acetylation af projektledere og regulerende regioner i onkogener og tumor overspændingsbeskyttere kan føre til ændringer i genekspression og spiller en vigtig rolle i patogenesen af hjernetumorer. Native kromatin immunoprecipitation (ChIP) er en populær teknik, der tillader detektering af ændringer eller andre proteiner stramt bundet til DNA. I modsætning til krydsbundet ChIP i native ChIP, behandles celler ikke med formaldehyd kovalent linke protein til DNA. Dette er en fordel fordi undertiden crosslinking kan lave proteiner, der kun forbigående interagere med DNA og ikke har funktionelle betydning RIBOREGULATION. Derudover er antistoffer generelt rejst mod ikke optagne peptider. Derfor er antistof specificitet øget i native ChIP. Det er dog vigtigt at huske, at indfødte ChIP er kun gældende at studere histoner eller andre proteiner, der bindes stramt til DNA. Denne protokol beskriver indfødte kromatin immunoprecipitation på murine hjerne tumor neurospheres.

Introduction

Epigenetiske begivenheder er hyppige i gliomer og sandsynligvis spille en vigtig rolle i tumor patogenese. Faktisk, i pediatric high-grade gliom, mutationer i gener kodning Histon varianter H3.3 og H3.1 forekommer hyppigt1. Mutationerne påvirker Histon ændringer og har store epigenetiske konsekvenser2,3. I unge til voksne spektrum forekomme tilbagevendende mutationer i isocitrat dehydrogenase gen 1/2 (IDH1/2), en mutation, der hæmmer α-KG afhængig af Histon og DNA de-methylasaes, og genetiske ændringer i andre kromatin lovgivere såsom ATRX og DAXX 4. det er derfor af afgørende betydning at studere hvordan mutationer, der påvirker epigenetiske regulatorer alter kromatin struktur og regulerende Histon ændringer, som til gengæld har en dramatisk effekt på tumorcellerne transkriptom.

Kromatin immunoprecipitation (ChIP) er en kraftfulde værktøj, der anvendes til at evaluere virkningen af epigenetiske ændringer i genomet5,6,7. I native ChIP, kromatin er fordøjet med micrococcal nukleasen (MNase), immunoprecipitated ved hjælp af en antistof rejst mod protein af interesse, og derefter DNA er renset fra immunoprecipitated kromatin komplekse6. Celler er ikke faste under proceduren, så denne teknik er kun gældende for studiet af proteiner, der arbejder tæt sammen med DNA6. Fravær af cross-linking aids antistof specificitet, da antistoffer er normalt rejst mod ikke optagne peptider eller proteiner7. Hertil kommer, da der ikke er nogen tværbindingsmidler skridt, mindsker dette chancerne for fastsættelse af forbigående protein-DNA interaktioner, der er ikke specifikke og ikke lovgivningsmæssige7,8. ChIP kan bruges til at identificere berigelsen af Histon ændringer i en specifik genomisk region. Vi detalje her, en protokol for udfører native ChIP i neurospheres (NS) genereret fra genetisk manipuleret musemodeller af gliom.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle metoder beskrevet her er blevet godkendt af institutionelle Animal Care og brug udvalg (IACUC) på University of Michigan.

1. generation af hjernesvulst NS og dyrkning betingelser.

  1. Forberede neurale stamceller Medium (NSC) med Dulbeccos modificerede Eagle Medium/F12B27 supplement (1 x), N2 supplement (1 x) og en antimikrobiel reagens. Supplere NSC medium brug med humane rekombinante endotel vækstfaktor (EGF) og basic fibroblast vækstfaktor (FGF) i en endelig koncentration på 20 ng/mL hver dag.
  2. Fremkalde hjernetumor i mus med Tornerose transposon systemet plasmider kodning onkogener eller shRNA rettet mod tumor overspændingsbeskyttere sprøjtes ind i de laterale hjertekamrene af nyfødte til at generere spontan hjerne tumorer9. Vælg en mus med en stor tumor, hvilket bekræftes med bioluminescens billeddannelse.
    Bemærk: Mere detaljerede oplysninger om de sovende skønhed Transposon System og plasmid konstruktioner bruges kan findes i Calinescu et al. 9.
    1. For at billede musene, indsprøjtes 100 µL af 30 mg/mL luciferin løsning intraperitoneal ved hjælp af en 26 gauge kanyle.
    2. 5 min efter injektion af luciferin, bedøver dyret ved hjælp af en anæstesi-afdeling med ilt/isofluran flow indstillet til 2% isofluran.
    3. Når dyrene er bedøvede (normalt 2-3 min), placere dyrene i bioluminescens kammer med ilt isofluran indstillet til 2% isofluran. Hvis dyrene vil være under anæstesi i mere end 5 min, bruge en oftalmologiske salve til at forhindre tørhed mens under anæstesi.
    4. Billede af musene bruger en i vivo optisk tænkelig ordning med følgende parametre: automatisk eksponering, store binning og blænde f = 1. Parameteren til at overveje det en stor tumor er en bioluminescens > 106 fotoner/s/cm2/sr.
  3. Aflive mus med en overdosis af isofluran indånding bedøvelsesmiddel i et lukket kammer, tjek af tå knivspids at dyret er bedøvede, og Hug hovedet af musen.
  4. Uddrag hjernen og dissekere det som tidligere beskrevet i Calinescu et al. 9.
  5. Læg hjernen i et 10 cm petriskål. Hvis tumor induceret udtrykker en fluorescerende proteiner, brug en fluorescerende dissekere mikroskop indstillet til den passende fluorescerende kanal og 0,3 X forstørrelse, ellers identificere tumor massen af forskelle i væv farve og tekstur. Brug skalpel og pincet til at adskille tumor væv fra den normale hjerne.
  6. Hakkekød tumor i små stykker i petriskålen. Sted dissekeret tumor i 1,5 mL rør med 300 µL af NSC medium.
  7. Brug en engangs plast pellet pistil, der passer til væggene i en konisk microcentrifuge tube til forsigtigt homogeniseres tumor. Der tilsættes 1 mL af celle detachement medium og inkuberes prøve for 5 min ved 37 ° C.
    Bemærk: Brugen af en pistil kan dræbe nogle celler. Hvis læseren ønsker at maksimere cellernes levedygtighed, kan brugen af en pistil udelades.
  8. Passerer cellesuspension fra trin 1.7 gennem en 70 µm celle si og vask si med 25 mL af NSC medium.
  9. Centrifugeres suspension ved 300 x g i 5 min. ved stuetemperatur, den dekanteres og genopslæmmes pellet i 6 mL af NSC medium.
  10. Plade tumor cellesuspension fra trin 1.9 i en T-25 kultur kolbe og kultur det ved 37 ° C i en vævskultur kuvøse med en atmosfære af 95% luft og 5% CO2. Sædvanligvis efter 3 dage, vil der være en blanding af nogle døde celler, overholdt celler og nogle celler danner NS som flyde i mediet.
  11. Overføre cellesuspension ind i en 15 mL konisk rør, indsamler kun de celler, der synker til bunden ved hjælp af en mikropipette og re plade dem ind på en T-75 vævskultur kolbe.
  12. Vedligeholde cellerne ved relativt høj densitet (1-3 X 106 celler i en T-25). Passage af celler, når de er sammenflydende.
    Bemærk: Confluency er bestemt af størrelsen kugler. Sort Centre af store områder betyder, at der er døde celler i midten og angiver, at cellerne skal blive passaged straks.
  13. Tilføje vækstfaktorer (EGF og basic-FGF; 20 ng/mL hver) alle tre dage. Ændre medium, når cellerne ikke sammenflydende og mellemstore sving lys orange.
  14. Hvis du vil ændre mediet, indsamle gamle medium og centrifugeres ved 300 x g ved stuetemperatur i 5 min og genopslæmmes celle pellet i NSC medium suppleret med EGF og FGF i den koncentration, der er angivet i trin 1.1.
    Bemærk: Hvis kugler er på midten af-til høj confluency, men ikke klar til at blive passaged (kugle størrelse er lille med en diameter < 100 µm), så pelleten kan opdeles i to kolber.
  15. For at passage cellerne, centrifugeres celler ved 300 x g i 5 min. ved stuetemperatur, den dekanteres og inkuberes celler i celle detachement medium for 5 min ved 37 ° C.
    1. Der tilsættes 5 mL af afbalanceret saltopløsning til fortyndet detachement medium og centrifugeres det ved 300 x g i 5 min ved stuetemperatur.
    2. Den dekanteres, resuspenderes celle i 18 mL af NSC medium og opdele suspenderes ligeledes i tre T-25 kolber.
  16. For at fryse delprøver af celler, adskille celler som trin 1,15 og fryse celler i 1 mL alikvoter af 90% føtal bovint serum med 10% dimethylsulfoxid. Langsomt køle ned celler ved at placere cellerne i isbad i 10 min og derefter holde celler-20 ° C i 30 min, og-80 ° C nemlig 1 dag. Den næste dag, overføre cellerne til en flydende kvælstof storage container.

2. indfødt ChIP

  1. Kromatin forberedelse
    1. Efter at gøre status over afledte NS, kultur NS i en T-75 med 15 mL NSC medium ved 37 ° C i en vævskultur kuvøse med en atmosfære af 95% luft og 5% CO2 indtil NS bliver sammenflydende. En sammenflydende T-75 plade vil give 3-5 X 106 celler.
    2. Når cellerne bliver sammenflydende, centrifugeres NS på 300 x g i 5 min, den dekanteres og tilsættes 1 mL af celle dissociation medium. Inkuber celler ved 37 ° C i 5 min. tilføje 5 mL af medium og tælle de celler ved hjælp af en hemocytometer10.
      Bemærk: 1 x 106 celler er nødvendig pr. immunoprecipitation (IP) reaktion. Bemærk, at en pre immun serum eller IgG kontrol skal også være inkluderet11.
    3. Centrifugeres NS i én 1,5 mL microcentrifuge rør på 300 x g i 5 min, den dekanteres og genopslæmmes NS pellet med 1 mL af afbalanceret saltopløsning og overføre suspension til lav protein bindende 1,5 mL microcentrifuge rør.
    4. Centrifuge NS på 300 x g i 5 min, den dekanteres og genopslæmmes celle pellet i 95 µL af fordøjelsen buffer (50 mM Tris-HCl, pH 8,0, 1 mM CaCl2, 0,2% polyethylen glycol octylphenyl ether) pr. 1 x 106 celler suppleret med protease hæmmer cocktail på en høj koncentration (1: 100). Straks afpipetteres cellerne op og ned for at undgå sammenklumpning og undgå at skabe nogen bobler.
    5. Resuspend MNase i 50% glycerol at gøre 1 mg/mL opløsning (1,15 enheder/µL, opbevares ved-20 ° C), kaldes "1 x" materiel. Gøre en "0,1 x" lager ved at gøre en anden 1:9 fortynding med 50% glycerol (fx., 900 µL af "1 x" MNase og 100 µL af 50% glycerol), og opbevar den ved-20 ° C.
    6. Mix 5 µL af "0,1 x" MNase og 145 µL af fordøjelsen buffer. Holde enzym på is alle gange. Tilsættes 5 µL fortyndede MNase i fordøjelsen buffer pr. 1 x 106 celler. Svirp rør til at blande og placere røret i 37 ° C blok for nøjagtigt 12 min. proces prøver én ad gangen for at sikre en nøjagtig inkubationstiden i 12 min.
    7. Tilsæt 10 µL af 10 x MNase stoppe Buffer (110 mM Tris-HCl, pH 8,0, 55 mM EDTA) pr. 1 x 106 celler. Prøverne skal opbevares på is fra dette punkt og fremefter.
    8. Tilføje 110 µL "2 x RIPA buffer" (280 mM NaCl, 1,8% polyethylenglycol octylphenyl ether, 0,2% natriumsulfat dodecylbenzensulfonsyremethylester (SDS), 0,2% Na-deoxycholate, 5 mM ethylenglycol-bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic syre (EGTA), opbevares ved 4 ° C) suppleret med protease hæmmer cocktail i høj koncentration (1: 100) pr. 1 x 106 celler. Svirp røret til mix.
    9. Centrifugeres rør til 15 min i en mikrofuge ved 4 ° C og 1700 x g. overføre supernatanten til en ny regelmæssig 1,5 mL microcentrifuge rør (lav protein bindende microcentrifuge rør er ikke længere nødvendigt) og gemme dem på is. Kassér pelleten.
  2. Immunoprecipitation (IP)
    1. Bland Protein A og Protein G magnetiske perler i forholdet 1:1. For hver IP, forberede 25 µL af perler.
    2. Vaske perlerne ved tilsætning af 1 mL af RIPA buffer (10 mM Tris pH 8,0, 1 mM EDTA, 140 mM NaCl, 1% polyethylen glycol octylphenyl ether, 0,1% SDS, 0,1% Na-deoxycholate, opbevares ved 4 ° C) suppleres med proteaseinhibitorer ved lav koncentration (1:1000).
    3. Brug en magnet til at tillade perler at adskille fra vask løsning og dekanteres vask løsning (ca 1 min). Udføre trin, vaskes to gange.
    4. Genopslæmmes perler til den oprindelige diskenhed ved hjælp af RIPA buffer suppleret med proteasehæmmere (1:1000).
    5. Om nødvendigt, fortyndes reservere kromatin ved hjælp af RIPA buffer suppleret med proteasehæmmere (1:1000), således at hver IP har et volumen på 100-200 µL. 10% af den mængde, der er brugt pr. IP af kromatin for input.
      Bemærk: For eksempel anvendes 200 µL pr. IP, 20 µL fortyndede kromatin bør være forbeholdt inputtet. I alt fire IPs, skal samlede kromatin volumen fortyndes til 820 µL.
    6. Forberede input. Tilsæt 100 µL af TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) suppleret med proteinase K (0,5 mg/mL) til input og inkuberes input ved 55 ° C i 1 time.
      Bemærk: Trin 2.2.6-2.2.7 kan udføres sammen med trin 2.3.4 og 2.4.1.
    7. Rense input ved hjælp af en PCR rensning kit efter fabrikantens anvisninger og elueres i 50 µL af eluering buffer i kit.
    8. Måler koncentrationen af input ved hjælp af et microvolume Spektrofotometer og indspille resultaterne i en notesbog. Blank med eluering buffer fra kit.
      Bemærk: I mus neurospheres brugte vi ca 6 µg DNA for hver IP.
    9. Køre input på en 1% gel eller indlæse 1 µL på et DNA Bioanalyzer ved hjælp af standardindstillinger. Gemme resten til brug som input i downstream applikationer.
    10. Tilsæt 10 µL af vasket protein A & G magnetiske perler for hver IP og Inkuber IP i 1 time ved 4 ° C.
      Bemærk: For eksempel tilføje 30 µL af protein A & G magnetiske perler for tre IPs.
    11. Placer prøverne på en magnet og lad perler til at adskille. Opdele kromatin ved at overføre det tidligere beregnede beløb ind i en ny 1,5 mL rør.
    12. Føje antistoffet og wrap caps med plast paraffin film at undgå fordampning. Inkuber prøver natten over ved 4 ° C med rotation på 20 rpm.
      Bemærk: Koncentrationen bør bestemmes empirisk efter fabrikantens anbefalinger.
    13. Den næste dag, spin rør ved hjælp af en mini centrifuge ved stuetemperatur, 2000 x g, for 10 s. Derefter tilsættes 10 µL af perler til hver IP og der inkuberes IP for 3 h ved 4 ° C med rotation på 20 rpm.
  3. IP vasker og Protein fordøjelse
    1. Tilsæt 150 µL af RIPA buffer suppleret med proteaseinhibitorer ved lav koncentration (1:1000) til hver IP og inkuberes IP ved 4 ° C med rotation på 20 rpm i 5 min. sted prøve på et magnetisk stativ og tillade de magnetiske perler til at adskille. Fjerne supernatanten ved hjælp af en pipette. Gentag denne tep fem vasker.
    2. Tilsæt 150 µL af LiCl buffer (250 mM LiCl, 10 mM Tris pH 8,0, 1 mM EDTA, 0,5% NP-40, 0,5% Na-deoxycholate, opbevares ved 4 ° C) suppleres med proteaseinhibitorer ved lav koncentration (1:1000) til hver IP og inkuberes IP ved 4 ° C med rotation på 20 rpm i 5 min. sted prøven på en magnetisk stå og tillade magnetiske perler til at adskille. Fjerne supernatanten ved hjælp af en pipette.
    3. Tilsæt 150 µL af kold TE (ingen proteasehæmmere) og Inkuber prøve ved 4 ° C med rotation på 20 rpm i 5 min. sted prøve på et magnetisk stativ og tillade magnetiske perler til at adskille. Fjerne supernatanten ved hjælp af en pipette.
    4. Efter den sidste vask skridt, genopslæmmes prøven i 100 µL af TE buffer suppleret med proteinase K (0,5 mg/mL), og der inkuberes prøve ved 55 ° C i 1 time.
  4. DNA oprensning og ChIP kvantitative Real-Time PCR (qPCR)
    1. Rense immunoprecipitated DNA ved hjælp af en PCR rensning kit. Efter tilsætning af DNA binding buffer fra kit til hver prøve, placere røret på en magnet og vente, indtil magnetiske perler samlede, derefter overføre supernatanten til kolonnen oprydning. Følg producentens anvisninger og elueres i 50 µL af eluering buffer i kit.
    2. For at tjekke om IP er vellykket, udføre en qPCR. Ideelt set bør primere udformes for positive og negative kontroller regioner.
      Bemærk: For eksempel, for en IP udført med H3K4me3 og H3K27me3, følgende prøver skal køres på qPCR: H3K4me3, H3K27me3 og IgG ChIP DNA, input DNA, og en ingen template control (NTC) bruger primere for regionerne at blive beriget med H3K4me3 (positiv kontrol) og regioner at blive beriget med H3K4me3 (negativ kontrol); på samme måde for H3K27me3.
    3. Følg standardprotokoller til at udføre qPCR12. Kort, udføre en qPCR bruger SYBR green master mix, 0,5 µL af 10 µM arbejder koncentration af hver frem og bak primer og 2 µL af ChIP eller input DNA. Læs plader ved hjælp af en Real Time PCR system. Primer sekvenser er fastsat i tabel 2. Gapdh primer sekvenser fra Hwang mfl. blev brugt13.
    4. Analysere ChIP data i forhold til input, dvs procent input metode (% IP)14. Beregn procent input ved hjælp af følgende formler:
      Justeret input = gennemsnitlig ct (input)-log2(DF)
      hvor DF er fortyndingsfaktoren af starter input og
      DF = samlet rumfang af IP / volumen af input
      % IP = 100 × 2 ^ (justeret input - Ct (IP))
      hvor Ct er tærskel faktoren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En skematisk gengivelse af tumor NS genereret fra en hjernesvulst, hvor hjernen tumorceller er Katushka positiv er præsenteret i figur 1. Figur 2 er en skematisk fremstilling af den hele ChIP teknik. Figur 3 viser de repræsentative resultater af kromatin fra hjernesvulst NS fordøjes med MNase i 12 min., hvilket giver et flertal af mono, di- og tri-nucleosomes. Efter ChIP, en qPCR kan udføres på chippen og input DNA prøver. Figur 4 viser repræsentative ChIP qPCR data fra en qPCR for glyceraldehyd-3-fosfat dehydrogenase (Gapdh). Gapdh er en husholdning gen, der er beriget med H3K4me3, en ændring, der er forbundet med aktiv transskription. Resultaterne viser at Gapdh er beriget med H3k4me3 og er ikke beriget med H3K27me3, som er en ændring, der er forbundet med regioner i undertrykt kromatin.

Figure 1
Figur 1: skematisk af tumor NS genereret fra en Katushka positive hjernesvulst. En lysfelt og fluorescerende billedet af en hjerne, høstet fra en mus der nået slutpunkt. Tumor området er afgrænset af den stiplede linje og er positive for de fluorescerende reporter, Katushka. Tumor er så isoleret og tumor væv er indsamlet i en 1,5 mL tube. Cellerne er derefter adskilles og kulturperler i NSC medium og tumor NS form. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: en skematisk gengivelse af arbejdsprocessen for indfødte ChIP. Tumor NS er kulturperler og udvidet. Hver IP er udført med 1 X 106 celler. Kromatin er fragmenteret, ved hjælp af MNase fordøjelse for at opnå mono, di- og tri-nucleosomes. Kromatin inkuberes med et antistof, der er specifikke for en Histon ændring eller DNA-forbundet protein af interesse. Antistof-DNA kompleks er immunoprecipitated med magnetisk protein A/G perler. Endelig, protein er fordøjet og DNA er renset for at få kun DNA beriget med Histon ændring eller DNA-forbundet protein af interesse. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: kromatin opsplitning af MNase. Kromatin blev udarbejdet fra hjernesvulst NS ved tilsætning MNase og inkubation ved 37 ° C for præcis 12 min. repræsentative DNA resultater fra Bioanalyzer analyse af et input prøven viser, at størstedelen af DNA'ET er blevet opsplittet i mono-, di- og tri- nucleosomes. Lane 1 er stigen i basepar (BP). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: repræsentant ChIP qPCR data præsenteret som procent input. qPCR blev udført med IgG, H3K4me3 og H3K27me3 ChIP DNA ved hjælp af primere for glyceraldehyd-3-fosfat dehydrogenase (Gapdh). Repræsentative resultater viser, at Gapdh, en husholdning gen, kun er beriget med H3K4me3 ændring, forbundet med aktive transskription, og ikke H3K27me3 ændringen, forbundet med undertrykt kromatin. Denne kurve repræsenterer resultaterne af to biologiske forsøg køre med tre Repliker brønde hver. Fejllinjer udgør standard fejl af middelværdien (SEM). Venligst klik her for at se en større version af dette tal.

Gen Fremad primer Omvendt primer
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabel 1: Primere bruges til ChIP qPCR eksperimenter. Sekvenser for primere bruges til Gapdh er fastsat i denne tabel.

mener Ct (input) Standardafvigelse Justerede Input
24.265 0,071 20.943
Procent input
Stikprøve RAW betyder Ct Standardafvigelse Procent input = 100 * 2 ^ (justeret input-Ct(IP))
IgG 32.23 0.112 0,04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0,027
NTC ubestemt ubestemt ubestemt

Tabel 2: Sample beregning af procentvise inddata metode for ChIP qPCR analyse. Sample beregning af procent input til ChIP udføres med 10% starter input; DF = 10. Tallene i denne tabel illustrerer de rå værdier af én biologiske eksperiment med 3 replikat wells køre for hver prøve.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollen præsenteres her vil aktivere brugeren kan udføre indfødte ChIP på NS afledt af genetisk manipuleret hjernetumorer. I modsætning til cross-linking ChIP, er denne protokol begrænset til studiet af proteiner, der forbinder stramt med DNA6. Antallet af celler, der anvendes kan ændres efter behov og protokollen kan skaleres. Vi brugt 1 X 106 celler pr. IP, native ChIP kan dog også udføres med så lidt som 4 x 104 celler5. I denne protokol analyserede vi ChIP DNA via qPCR; denne protokol kan dog også kombineres med næste generation sequencing at studere protein-DNA interaktioner på genom bred plan. Vi har brugt denne ChIP-protokollen held til at analysere effekten af gliom onkogener på aflejring af Histon ændringer inden for bestemte områder af tumor celler genom.

Der er et par kritiske trin, når du udfører native ChIP. Først, skal fordøjelse betingelser for hver celletype bestemmes empirisk. Fleste af kromatin skal være mono-nucleosomes (150 bp) med nogle di - og tri-nucleosome bjergtoppe (figur 3). Vores protokol resulterer i mere end 70% mono-, di- og tri-nucleosome bjergtoppe, dog nogle ufordøjet DNA stadig. Hvis protokollen vil blive brugt til ChIP-FF., kræves yderligere skridt til at fjerne ufordøjet DNA. Derudover er det vigtigt at huske på at hver batch af MNase købt kan afvige i aktivitet og derfor kræver optimering af fordøjelse betingelser. Andet, kvaliteten af en ChIP afhænger meget specificiteten af antistof brugte11. En høj kvalitet ChIP antistof bør have høj reaktivitet mod de tilsigtede mål og lave cross reaktivitet med andre DNA-associerede proteiner eller off target Histon ændringer11. Vi anbefaler derfor, test antistof specificitet ved hjælp af et peptid bindende test. ENCODE retningslinjer tyder på, at en billeddetaljerne berigelse skal overholdes for ændring af interesse i forhold til andre ændringer11. Det er også afgørende at udføre nødvendige kontrol immunoprecipations, dvs., før immun eller IgG kontrol. Når disse overvejelser er opfyldt, er native ChIP data en stærk pålidelig metode til at studere epigenetiske mekanismer reguleres af protein-DNA interaktioner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgements

Dette arbejde blev støttet af nationale institutter for sundhed/National Institute af neurologiske & streg (NIH/NINDS) tilskud R37-NS094804, R01-NS074387, R21-NS091555 til M.G.C.; NIH/NINDS tilskud R01-NS076991 R01-NS082311 og R01-NS096756 til P.R.L.; NIH/NINDS R01-EB022563; Afdeling Neurokirurgi; Leah's Happy Hearts, og Tchad om fundament til M.G.C. og P.R.L. RNA biomedicin Grant F046166 at M.G.C. F.M.M. er støttet af en F31 NIH/NINDS-F31NS103500. R.I.Z.-V. understøttes af NIH / NIGMS give 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics