Флоэма Sap выборки из Brassica napus для 3D-страница белков и рибонуклеопротеида комплексов

Biology
 

Summary

Здесь мы представляем протокол анализировать состав протеина большой родной: протеин и белка: комплексов нуклеиновых кислот из рапса (B. napus) флоэма экссудата с использованием 3D геля полиакриламида электрофореза (страница) подхода, сочетающего синий родной (BN) с двумя денатурируя страниц следуют масс-спектрометрических идентификации.

Cite this Article

Copy Citation | Download Citations

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Выборка флоэма высших растений часто является трудоемким и существенно зависит от видов растений. Однако протеом исследований при денатурации условий может быть достигнуто в различных видов растений. Родной: протеин и белка: комплексов нуклеиновая кислота от флоэмы образцов пока вряд ли были проанализированы, хотя они могли бы играть важную роль в обслуживании этого специализированные отделения или в дальней сигнализации. Большой молекулярной сборки могут быть изолированы с помощью синий родной гель-электрофорез (БН-страница). Их белковых компонентов могут быть разделены последующих натрия Додециловый сульфат страницы (SDS-PAGE). Однако протеины с подобными молекулярными весами проникли совместно мигрируют, что может помешать белка идентификации по масс-спектрометрии. Сочетая BN-страница с двумя различными денатурируя гель электрофорез шаги, а именно трис-Трицин мочевина и SDS-PAGE, включает дополнительные разделение белков согласно их гидрофильность/гидрофобность и таким образом повышает разрешение и успех идентификации белков. Она даже позволяет различать белки, которые отличаются только в их Посттрансляционная модификации. Кроме того синий родной Северный blotting может применяться для идентификации компонентов РНК в макромолекулярных комплексов. Мы покажем, что наш протокол подходит разгадать белка и РНК компоненты родной: протеин и рибонуклеопротеида (RNP) комплексов, происходящих в образцах флоэмы. Объединяя синий родной страница с двумя различными денатурируя страницы шагов может помочь для разделения различных видов крупных белковых комплексов, а также позволяет показатель увеличения идентификации их компонентов по масс-спектрометрии. Кроме того протокол является достаточно прочным, чтобы одновременно обнаруживать потенциально связанных нуклеиновых кислот в пределах одного белковых комплексов.

Introduction

Междугородные каналы флоэмы необходимы для выделения органических питательных веществ в высших растений, но также участвует в регуляции многих различных процессов, важных для роста и развития, Возбудитель обороне и адаптация к неблагоприятным условия окружающей среды. Помимо небольшой эффекторов как ионы, фитогормонов или метаболитов, сами макромолекулы как белков и РНК недавно появились как потенциальные сигналы.

Исследования показали, что Загрузка флоэмы белков является размер зависимых и контролируется поры plasmodesmal единиц соединения клеток спутник (CC) исключение ограничение на размер (SEL) и сита элементы (SE), которые, как правило, в диапазоне от 10 до > 67 кДа1 , 2 , 3. Однако, несмотря на эти ограничения размера больше белков и белковых комплексов были найдены в системе флоэмы, сложной идею исключения размер4, и даже неспецифических потеря белков от CC для SE был предлагается5 .

Multiprotein, а также большой рибонуклеопротеида комплексы играть решающую роль в биосинтезе и сохранения структурной целостности ячейки6. Есть свидетельства, что флоэма мобильный рибонуклеопротеида и белок белковых комплексов существует4,7, но на сегодняшний день известно мало о их функции. В элементы флоэмы сито: протеин и RNP комплексы были вовлечены с дальних перевозок и / или сигнализации8,9. Чтобы разгадать функции translocated комплексов, изучая их состава в различных экологических или подчеркнуть условия не требуется. Для достижения этой цели, родной комплексы должны быть изолированы и их компоненты должны быть разделены с достаточным разрешением.

Чтобы изолировать комплексы высоким молекулярным весом от флоэмы, это сначала необходимо получить образцы sap в достаточного качества и количества. Метод, который может использоваться для выборки флоэмы, зависит от видов растений интерес. Существуют три основные методы для получения флоэма sap 10: насекомых stylectomy11, ЭДТА способствовали экссудацию12и спонтанное экссудацию13.

Флоэма образцы от Arabidopsis thaliana (A. thaliana), основные модели завода в лабораториях во всем мире, только может быть получено при содействии ЭДТА экссудацию или тля stylectomy14,15. Оба метода приведет к сильно разбавленных флоэма sap или очень низкой выборки сумм. Экссудацию, ЭДТА способствует также подвержен загрязнению и не может представлять реальный флоэма состав16. Спонтанное флоэма экссудацию ограничивается растительных видов, как тыква, Люпин или юкки, где отрезать части растений приводит к спонтанного флоэма sap, которые могут быть легко собраны в13,,1718, 19. Мы недавно создали рапса (Brassica napus) как система подходящую модель для анализа флоэмы, так как это близкий родственник A. thaliana и несколько микролитров флоэма sap может быть получена от небольших разрезов, которые было показано быть высокой чистоты4,8,20. Кроме того последовательность генома B. napus был выпущен в 201421.

За исключением stylectomy тля все методы коллекции флоэмы, описанные включают повреждения окружающих тканей в месте отбора проб, и состав флоэма sap может измениться в ответ на травмы. Поэтому крайне важно для проверки качества образцов флоэмы, независимо от того, применяется метод выборки. Существуют различные методы для контроля качества собранных флоэма SAP, например путем определения RNase деятельность22,23, RT-PCR с праймерами против Рибулозобисфосфаткарбоксилаза8,24, или анализ сахара Композиция8.

Могут применяться различные методы, чтобы изолировать и отдельные белковых комплексов, включая размер гель-проникающей хроматографии, ultracentrifugation плотность сахарозы или пример фильтрации через мембраны с собственный молекулярный вес cut компромиссов. Однако эти подходы не позволяют высокого разрешения. Техника называется синий родной (страница BN-), впервые описана в Schägger и др. 25, Улучшенный с точки зрения резолюции. Он был успешно используется для определения молекулярным весом большого родной белковых комплексов из различных органеллы или сотовой лизатов и их относительного обилия26,27.

Для дальнейшего уточнения сложного состава белковых комплексов, необходимо отделить отдельные компоненты под денатурации условий, ведущих к полной разборки компонентов комплекса. Это может быть достигнуто путем второе измерение SDS-PAGE 28,29 , или для достижения более высокое разрешение, второй аспект изоэлектрического фокусирования (МЭФ) следуют third dimension SDS-PAGE30 и последующей идентификации с помощью масс-спектрометрии белков.

В этом протоколе мы описываем выборки чистого флоэма sap от B. napus растений и анализа белковых комплексов от таких образцов флоэмы, с помощью 3D электрофоретической подхода, сочетающего BN-страница с трис-Трицин мочевина страницы и SDS-PAGE. Раздельный белковых компонентов комплекса впоследствии идентифицируются с помощью масс-спектрометрии. Кроме того мы представляем, синий родной Северный blotting метод, позволяющий обнаружение РНК в больших RNP комплексы4, расширяя применимость подхода.

Protocol

1. отбор проб и подготовка флоэма sap от B. napus растений 4,8,20

  1. Для sap флоэмы, отбор проб, использование хорошо поливать 8-недельных B. napus растения только первоначальный цветения этого шоу для предотвращения загрязнений пыльцы.
  2. Используйте подкожных игл (Ø 0,8 мм) и пунктата соцветие стволовых несколько раз. Повторите в нескольких других соцветий стебли и на другие растения, чтобы получить достаточно флоэма sap (Рисунок 2a).
    Примечание: Для комплексного анализа, рекомендуется начать с по крайней мере 600 мкл флоэма sap. 4-5 растений даст между 200 и 700 мкл флоэма sap.
  3. Протрите первой капли от потерпевшего сайтов с фильтровальной бумаги. Эти капли главным образом содержат сильно загрязненного материала из окружающих пораженных тканей и должны быть отменены.
  4. Собирать следующие капли, закупорить и хранить собранные экссудата в пробирке реакция предварительно охлажденные конические 1,5 мл при-20 ° C с использованием незамерзающий системы охлаждения.
  5. Продолжайте сбор до тех пор, пока не дальнейшее падение формирование наблюдаемых, но не более чем 1 час. Эта процедура может повторяться после двух дней без значительной потери собранных флоэма sap.
    Примечание: Собранные флоэма sap могут быть использованы сразу или температуре-80 ° C для будущего анализа. Для хранения-80 ° C шок замораживание реакции трубки в жидком азоте.
  6. Концентрат флоэма образца примерно 1/6го первоначального объема с использованием центробежных концентраторов с молекулярной массой (MWCO), отрезаны от 10000 Дальтон (Da). Центрифуга концентрированного образца при 4 ° C и 20000 x g для по крайней мере 15 минут, чтобы удалить частицы пыли.
    Примечание: Флоэма sap концентрации не привести к значительной потере белков.
  7. Для последующего сложного анализа перейдите к шагу 3.1.

2. флоэма sap чистоту управления с помощью обратной транскриптазы ПЦР (RT-PCR) 4,8,20

  1. Изолировать всего РНК от флоэмы sap с помощью стандартного метода извлечения РНК для жидкого материала (например Тризол или фенол хлороформ извлечения следуют изопропанол осадков от водной фазе и этанола, мытье шаги согласно Протокол изготовителя).
    Предупреждение: Фенол хлороформ является токсичным. Работа под капотом с соответствующей индивидуальной защиты. Извлеченный РНК может храниться в этанол-80 ° c на срок до шести месяцев.
  2. Удалять загрязнение ДНК пищеварение с DNase I (1 u/мкг) для 45 минут при 37 ° C и инактивирует фермент, добавив ЭДТА в конечной концентрации 5 мм и инкубации образца при 75 ° C за 10 мин.
  3. Чтобы получить чистый РНК, очищают и концентрата образца другим шагом очистки (например с помощью РНК очистки наборы, согласно инструкции производителя).
  4. Выполнение обратной транскриптазы ПЦР (RT-PCR) для синтеза cDNA с комплектом синтеза cDNA, используя 150 нг чистого РНК как описано изготовителем в протокол.
    Примечание: CDNA может храниться при температуре-20 ° C до дальнейшего использования.
  5. Используйте 5 мкл cDNA как шаблон для стандартной реакции PCR как указано заводом-изготовителем, чтобы усилить отсек конкретных протоколов и проверить электрофорезом геля агарозы. Подтвердите чистоту флоэма образцы, например используя Праймеры для Рибулозобисфосфаткарбоксилаза небольшое подразделение, thioredoxin h и пыльца пальто белка (рис. 1b, Таблица 1).

3. синий родной страница 4,25,,2631

  1. Используйте либо самостоятельно налил родной градиента гели как описано других27 или коммерческих бис-трис градиента гели.
  2. Загрузить 20-30 мкг концентрированных белков образца за хорошо на гель в по крайней мере triplicates.
  3. Побегите гель на 4 ° C и 150 V с использованием темно синий катод буфера B и Анодный буфер (Таблица 2) до тех пор, пока образец прошли 1/3rd геля (ОК. 20-30 мин, рис. 3a).
    Примечание: Для Северный blotting, Лейн один гель является достаточным, а для анализа состава белков на странице 3D и масс-спектрометрии, которую рекомендуется сочетать той же группы от до десяти полос гель сконцентрировать менее обильные протеины.
  4. Приостановить запуск и буфер обмена темно синий катод B с светло синий катодом буфера B/10 (Таблица 2) и продолжить запуск. Закончите гель, запуске голубым фасадом элюировать из геля (ОК. 120-180 мин, рис. 3a).
    Примечание: Готовые синий родной гель может храниться при температуре 4 ° C для по крайней мере одной недели. Длительного хранения может привести к диффузной полос и следует избегать. Темно синий буфера B может быть повторно использован.

4. Дополнительно: Обнаружение РНК, используя синий родной Северный blotting 4

  1. Вырезать из отдельных полос или используйте полосу весь гель от родной синий гель и передачи их на мембрану нейлон, полусухие промокательной 3,5 мА/см2 60 мин и Марк гель верхняя и нижняя границы с карандашом на мембране (рис. 4a).
  2. После промокательной, Промойте мембрану DEPC-лечение водой и высушить между двумя фильтр документов.
  3. Выполнять УФ сшивки блотирования мембраны с 120000 µJ/см2 (85 s если использование сшивателя в Таблице материалов).
  4. Предварительно гибридизируйте мембраны с 6 мл буфера гибридизации (коммерческие или самодельные) 60 мин на 68 ° C в гибридизации печи (рис. 4a).
  5. Добавить еще 1 мл гибридизации буфера, содержащий 4 мкл 3'-биотинилированным зондов (100 Нм).
  6. Проинкубируйте мембрану с зонда на ночь, во время охлаждения духовки от 68 ° C до 37 ° C.
  7. Промойте мембрану буфер, содержащий 2 x SSC и 0,1% SDS, за 5 мин при комнатной температуре для удаления зонды, связанным содержанием.
    Предупреждение: ИКБ может вызвать раздражение. Надевайте перчатки и пальто лаборатории при работе с SDS и SDS, содержащие решения.
  8. Выполните обнаружение 3'-биотинилированным зонды на мембраны например с стрептавидина-ПХ конъюгата и luminol как хрен субстрат пероксидазы (ПХ), что приводит к чувствительной хемилюминесцентный реакции (рис. 4a).

5. Второй аспект: трис-Трицин мочевина страница 4,28

  1. Акцизный одной полосы от родной синий гель. Объединить группы из образцов, работать в параллельных полос для достижения дальнейшей концентрации комплекса белков (рис. 5).
    Примечание: Подакцизным полос могут храниться в одном реакция трубы до дальнейшего использования при 4 ° C.
  2. Залить 12% гель трис-Трицин мочевина (толщиной 1 мм, 6,8 x 8,6 см (ширина х длина)). Подготовка 10 мл раствора A гель для отделяя гель (Таблица 2), залить между двух листов стекла и оверлея изопропанолом. После завершения полимеризации удалите изопропанол и передачи 4 мл раствора B (Таблица 2) гель для штабелируя гель на гель и вставить 10 хорошо расчесать.
    Предупреждение: Unpolymerized акриламида может быть нейротоксического и TEMED вредно при вдыхании. Всегда носить СИЗ и работать под капотом.
  3. Перевести подакцизным гель полос в 1,5 мл реакции и добавьте 1 mL, 2 x буфер образца SDS для уравновешивания гель частей (рис. 5, Таблица 2).
    1. Проинкубируйте образцы для 10 мин при комнатной температуре, до кипения в блоке Отопление (95 ° C) или в микроволновой и Проинкубируйте образцы снова при комнатной температуре еще 15 мин.
    2. Стек несколько штук уравновешенной гель, представляющий то же комплекс в карман один единый гель.
    3. Провести электрофорез с помощью анод и катод работает буферов на 150 V за 45-60 мин и акцизных весь гель Лейн.
  4. Инкубировать Вырежьте полосу для 20 мин в кислой буфера (100 мм трис, 100 мм уксусной кислоты) и сбалансировать в 125 мм трис-HCl, pH 6.8 еще 20 минут (рис. 5).

6. Третье измерение: SDS-PAGE 4,32

  1. Залить 15% SDS, отделяя гель по Лэмли32 (толщина: 1,5 мм, 6,8 x 8,6 см (ширина х длина)) (Таблица 2) и добавить тонкий слой 4%, укладка гель выше.
    Предупреждение: SDS, акриламида и TEMED токсичных и вредных. Работа под капотом и носить средства индивидуальной защиты.
  2. Перенести полосу уравновешенной гель на гель SDS и покрытия гель агарозы 0,5% (w/w) в 1 x SDS работает буфер дополнена след бромфеноловый синий (рис. 5).
  3. Отварите работает буфер с агарозы в микроволновой печи до погрузки на гель SDS.
  4. Для запуска белка маркера для оценки молекулярным весом отдельных компонентов, вставить кусок фильтровальной бумаги на одном конце геля, до тех пор, пока агарозы затвердевших или использовать специальный гребень, обычно используется для IPG гели.
  5. Побегите гель на 150 V 60 мин и пятно гель с коллоидной Кумасси, серебряные пятна или любой другой пятнать метод подходит для последующего масс-спектрометрических анализа.
  6. Анализировать пятна видны протеина, с помощью масс-спектрометрических подходы как матрица помогает лазерная десорбция/ионизации время полета (MALDI-TOF) или LC-MS/MS масс-спектрометрии.
    Примечание: Мы рекомендуем использовать коллоидных Кумасси, окрашивание как уже описано33. В наших руках даже столь многочисленны белки могут быть достаточно витражи и позволяет масс-спектрометрических анализ с разумной данных качества.

Representative Results

Здесь мы представляем протокол, который позволяет анализ: протеин а также комплексы белка: РНК в пробах флоэмы, рапс. Рабочий процесс проиллюстрирован на рисунке 1. Одним из основных преимуществ B. napus над другими организмами модели является возможность сравнительно легко флоэма проб из небольших проколов в стволе соцветия. Это позволяет получить чистый флоэма образцы в сравнительно больших количествах. При отборе проб флоэмы, это всегда желательно, чтобы проверить наличие загрязнений, например, ПЦР-8. Представитель результат, полученный из образца чисто флоэма изображен на рисунке 2. Флоэма non загрязненных образцов должен показать видна полоса для thioredoxin h, тогда как нет сигнала для Рибулозобисфосфаткарбоксилаза и протеин пальто пыльцы должен появиться. Рибулозобисфосфаткарбоксилаза малых субъединица может служить в качестве элемента управления в пробах листьев, соцветия стеблей или пыльцы. Thioredoxin h должны быть обнаруживаемыми во всех пробах, поскольку его мРНК был найден в флоэмы разных видов, в то время как Стенограмма протеин пальто пыльцы только должен быть видимым в образцах бутон цветка. Загрязнений может произойти, когда флоэма выборки выполняется в полностью цветковых растений (пыльца пальто белка) или когда первые капельки от флоэмы выборки проколов не удаляются должным образом (Рибулозобисфосфаткарбоксилаза).

До BN-страницы является обязательным сконцентрировать флоэма sap. С помощью 20-30 мкг белка на хорошо, по крайней мере четыре основных белков комплекс полосы становятся видимыми после BN-страница B. napus флоэма SAP, слишком низкой или слишком высокой концентрации не позволяют четкое разделение комплексов (рис. 3). Рекомендуется загрузить несколько полос гель, представляющий то же комплекс в один единый карман во втором измерении геля, чтобы еще больше сконцентрировать протеины от каждого единого комплекса для последующей обработки и последующего масс-спектрометрических идентификации.

Для идентификации отдельных компонентов флоэма макромолекулярных комплексов, мы первоначальный BN-страница в сочетании с измерением второй трис-Трицин мочевина и третий аспект SDS-PAGE для достижения разделения одного белков. Здесь разделение с высоким разрешением можно наблюдать из-за поведения миграции различных белков в мочевину и гелях SDS-PAGE. Как правило белки, принадлежащие единый комплекс будет видна как диагональной линии через гель. Белки выше этой линии имеют увеличение гидрофобность, тогда как белки ниже линии представляют более гидрофильные те28 (Рисунок 5, Рисунок 6).

Для определения характеристик RNP комплексов мы использовали часть геля BN-PAGE для выполнения Северный blotting млрд. После промокательной всей полосы на мембраны нейлона и сшивки УФ-излучением, РНК могут быть визуализированы с помощью РНК конкретных зондов, как показано на рисунке 4. Здесь показано, что конкретные tRNA присутствует только в одной конкретной комплекса. Белковых компонентов этого комплекса tRNA привязки можно дополнительно изучить используя описанный выше подход 3D гель. Масс-спектрометрических анализы показали, что этот комплекс содержит главным образом tRNA-ligases что подтверждает действие привязки tRNA, найдены Северный blotting млрд.

Figure 1
Рисунок 1: рабочий поток анализа рибонуклеопротеида комплексов в флоэмы sap рапс. После отбора проб и подготовка образцов флоэмы BN-страницы выполняется для разделения родной комплексов. Такие гели BN-страницы позволяют параллельного анализа нуклеиновых кислот, BN Северный blotting и выявление белковых компонентов комплексов по масс-спектрометрии. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: контроль выборки и чистоты флоэма sap B. napus. После прокола стебля соцветия 8-10 недельных масличные растения рапса стерильной иглой подкожных, экссудата собирается с пипеткой и переданы ледяной реакции трубки () для подтверждения чистоты образцов флоэмы, выполненных RT-PCR усиливая стенограммы thioredoxin h, Рибулозобисфосфаткарбоксилаза небольшое подразделение, и пыльца пальто белка в ткани конкретных образцов (b) RT-PCR без обратной транскриптазы была выполнена как управления (-). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: BN-страницы. Схематическое представление синий родной страницы с образцами концентрированной флоэма B. napus. a после загрузки градиента белка гель с 15-20 мкл концентрированного флоэма sap, BN-страницы производится с 1 x темно синий катод буфера B 150 V на 20-30 мин в холодной комнате. Затем буфер обмена против 1 x светло синий катод буфера B/10 и страница завершения 150 V для 120-180 мин до темно-синего цвета, работает передняя бежит из геля. BN-страница гели Показать четыре различных групп, представляющих четыре различных комплексов высоким молекулярным весом. (b) (c) слишком мало или слишком много белков (d) флоэма загрузки уменьшает видимость отдельных комплексов. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: Северный blotting млрд. Схематическое представление Северный blotting метод млрд. (Лейн BN-страницы передается на мембрану нейлон полусухое промокательной. После УФ сшивки и предварительно гибридизации мембрана является инкубировали с РНК конкретного зонды (здесь конкретного tRNA метионина зонд), которые биотинилированным на 3'-конце в печь гибридизации за ночь. Бесплатные пробники удаляются путем промывания шаги и обнаружение РНК осуществляется конъюгата стрептавидина ПХ и luminol. Используя этот подход, мы наблюдали, что комплекс IV от БН-страница содержит метионина тРНК. (b гель Кумасси витражи и tRNA пятно напоминают две полосы различных гель, выполняются параллельно, чтобы избежать миграции различия. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: 3D-СТРАНИЧНЫЙ. Схематическое представление 3D-СТРАНИЧНЫЙ подход. Несколько полос от одного комплекса иссечена от геля BN-PAGE, инкубировали при загрузке буфера и переведены в одну скважину второго измерения трис-Трицин мочевина страницы. После электрофореза весь гель полосы вырезать, промывают в кислотных кислоты буфера, достижение равновесного уровня и на 15% геля SDS-PAGE. После третьего измерения страницы разделенных белки являются Кумасси витражи и проанализированы по масс-спектрометрии. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: представитель результаты после 3D-СТРАНИЧНЫЙ. В рамках первого измерения BN-странице появилось несколько комплексов. Их белковых компонентов могут быть далее разделены двух последующих денатурируя страниц, что приводит к диагональному шаблону пятно. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Зонд Последовательность
Thioredoxin h
вперед: CTCAAGGCAGCCAAAGAATC
обратный: ATGGCCTGAACATCGAACTC
Рибулозобисфосфаткарбоксилаза малых цепи
вперед: TTCACCGGCTTGAAGTCATC
обратный: CCGGGTACTCCTTCTTGCAT
Пыльца пальто белка BRU77666
вперед: TCAGAACTGGAGCTTCAACG
обратный: TTCCTTAATGGCCTCAGTGG

Таблица 1: праймеры, используется для контроля чистоты образца флоэма. Для подтверждения чистоты образца флоэма Праймеры для Рибулозобисфосфаткарбоксилаза малых цепи, thioredoxin h и пыльца пальто белка может использоваться для амплификация cDNA.

Буферы и решения Содержание Комментарий
темно синий катод буфера B 15 мм бис-трис рН 7,0
50 мм Трицин
0,02% (w/v) G250 Кумасси синий
рецепт адаптирован из фиала et al. 17
pH следует скорректировать до 7.0
Буфер может производиться как запас 10 x
светло синий катод буфер B/10 15 мм бис-трис рН 7,0
50 мм Трицин
0,002% (w/v) G250 Кумасси синий
Буфер может быть подготовлен распыления катода буфера B с катода буфера без Кумасси
Анодный буфер
50 мм бис-трис рН 7,0
Буфер может быть подготовлен как 10 x Стоковый раствор
2 x буфер образца SDS
125 мм трис-HCl рН 6,8
4% SDS
20% глицерина
0,2 М DTT
0,02% (w/v) бромфеноловый синий
Передача буфера 1 x TBE буфера
89 мм трис рН 7,6
Кислота борная 89 мм
2 мм ЭДТА
Можно сделать и хранятся как запасы 5 x или 10 x буфер КЭ. Это важно для использования свободных РНКазы деионизированной водой.
2 x SSC буфера
300 мм NaCl
30 мм Na3цитрат рН 7,0
3 x гель буфера
3 М трис
HCl 1 M
0,3% SDS

pH 8.45
рецепт адаптирован из Schägger 19
A решения гелем трис-Трицин
Для 10 мл:
30% акриламида bisacrylamide (29: 1) 3.34 мл
6 M мочевины
3 x гель буфера 3.34 мл
70% глицерина 1.4 мл
Добавьте ddH2O 10 мл
10% APS 40 МКЛ
TEMED 4 МКЛ
Вес 6 M мочевины и добавить 3 x гель буфер, раствор акриламида bisacrylamide и gycerol 70%. Нагреть до 60 ° C на водяной бане, чтобы солюбилизировать последнего мочевины. Добавить ddH2O 10 мл, 10% APS и TEMED для полимеризации.
Трис-Трицин гель решение B
Для 6 мл:
30% акриламида bisacrylamide (29: 1) 0,8 мл
6 M мочевины
3 x гель буфера 1,5 мл
Добавьте ddH2O 6 мл
10% APS 45 МКЛ
TEMED 4.5 МКЛ
Вес 6 M мочевины и добавить 3 x буфер и акриламид bisacrylamide решения гелем. Нагреть до 60 ° C на водяной бане, чтобы солюбилизировать последнего мочевины. Добавить ddH2O 10 мл, 10% APS и TEMED для полимеризации.
1 x идущий буфер Tris-Трицин (анод)
100 мм трис
22,5 мм HCl

рН 8,9
рецепт адаптирован из Schägger 19
1 x идущий буфер Tris-Трицин (катод)
100 мм трис
100 мм Трицин
1% SDS


pH 8.25
рецепт адаптирован из Schägger 19
Кислотные буфер
100 мм трис
100 мм уксусной кислоты
4% SDS штабелируя гель
Для 2 мл:
ddH2O 1.4 мл
30% акриламида bisacrylamide (37.5:1) 0,33 мл
1 мл рН 6,8 0,25 М трис
10% SDS 20 МКЛ
10% APS 20 МКЛ
TEMED 2 МКЛ
15% SDS, отделяя гель
Для 10 мл:
ddH2O 2.3 мл
30% акриламида bisacrylamide (37.5:1) 5 мл
1.5 М трис рН 8,8 2,5 мл
10% SDS 100 МКЛ
10% APS 100 МКЛ
TEMED 4 МКЛ
1 x идущий буфер SDS
25 мм трис
Глицин 192 мм
0,1% SDS
Кумасси, окрашивание раствора
5% (w/v) сульфата алюминия-(14-18) гидрат
10% (v/v) этанола (96%)
Ортофосфорная кислота 2% (v/v) (85%)
0,02% (w/v) Кумасси синим G-250
 
ULTRAhyb сверхчувствительная гибридизации буфера Эмбион, жизнь технологий

Таблица 2: решения и рецепты буфера. Список всех буферов и решений, необходимых для анализа 3D-страницы.

Место нет. Набл МВт [кДа] Идентификация Организма Присоединение без. МВт [кДа] Оценка талисман
CIV_1 130 Предполагаемый болезни сопротивления белка At4g19050 B. napus CDX78917 131.1 110
CIV_2 130 Предполагаемый болезни сопротивления белка At4g19050 B. napus CDX78917 131.1 89
CIV_3 100 Тепловой шок 70 кДа белками 14-как B. napus XP_013748865 89,9 113
CIV_4 90 Эукариотические удлинение фактор 2
Деление клеток контроля гомолога белка 48 A
B. napus
B. napus
CDX90241
CDY41316.1
89,5
89,5
111
197
CIV_5 85 Теплового шока белков 90-2-как B. Рапа XP_009132342 79,8 172
CIV_6 80 Треонин--tRNA лигаза
Глицин--tRNA лигаза
B. oleracea
B. napus
XP_013599115
CDY43195
81,5
80,8
110
88
CIV_7 70 Теплового шока белок 70 кДа
Лизина--tRNA лигаза как
B. oleracea
B. napus
XP_013685267
XP_013747530
67,8
69.9
230
150
CIV_8 65 Myrosinase
Аспартат--tRNA лигаза 2
Аспарагин--tRNA лигаза 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase 2-как B. Рапа XP_009135865 53.1 139
CIV_11 55 Удлинение фактор 1-альфа-1-как B. oleracea XP_013586115 51,9 161
CIV_12 50 Цистин лиазы CORI3-как B. napus XP_013653143 48.1 237
CIV_13 44 Цистин лиазы CORI3-как B. Рапа XP_009108611 48,3 213
CIV_14 38 Фруктоза Бисфосфат aldolase B. Рапа XP_009115993 38,4 226
CIV_15 45 Цистин лиазы CORI3-как B. Рапа XP_009108611 48,3 219
CIV_16 45 Цистин лиазы CORI3 B. Рапа CDY69765 46,9 209
CIV_17 38 Фруктоза Бисфосфат aldolase B. Рапа XP_009115993 38,4 124
CIV_18 18 Peptidyl проли цис транс глюкозоизомеразная CYP18-3-как B. napus XP_009101932 18.3 128
CIV_19 45 Цистин лиазы CORI3-как B. Рапа XP_009108611 48,3 177

Таблица 3: определены белковых компонентов из сложных IV. Несколько ligases тРНК и далее белки были найдены в пределах комплекса tRNA привязки с помощью MALDI-TOF массовые спектрометрического анализа после 3D-страницы.

Discussion

Флоэмы — отсек высокий интерес, поскольку она представляет собой крупный транспортный маршрут для photoassimilates и также важно для дальней передачи сигналов между различными завод частей9,20,34, 35. Помимо мелких молекул были причастны макромолекулы как белков и РНК с флоэма обслуживания и сигнализации4,7,8. Анализ состава флоэмы, ограниченная доступность ограничивается флоэма образцов в большинстве видов растений. Насекомое стилет техника широко применяется, но экспериментально требовательных и приводит в очень небольших количествах флоэма образцы11. Один простой метод, используемый для выборки флоэма-ЭДТА способствовали экссудацию12. ЭДТА chelates ионов двухвалентной как кальция и таким образом предотвращает закрытие сито пластины P-белков и callose. Она проста в использовании, но подвержена загрязнению поврежденных клеток и разбавленной пробы. Истощает EDTA-ионов двухвалентной также может привести к нарушению существующих комплексов. Однако она позволяет выборки из широкого спектра видов, включая модель завод A. thaliana15. Спонтанное экссудацию флоэма sap происходит только в небольшое количество видов растений. Это инвазивный метод, который предполагает значительные повреждения тканей растений10. Мы недавно создали B. napus как вид модели для изучения переноса на большие расстояния4,8,20. Здесь флоэма sap можно отведать от небольших разрезов, которая уменьшает ранив эффекты и источников загрязнения.

Использование методов выборки, протеома флоэма образцы из различных видов растений была исследована в последние годы7,8,17,,3637, 38,39. Для этих исследований протеом, белки извлекали и химически осажденный под денатурации условия и поэтому не позволяют выводы о: протеин и белка: взаимодействие нуклеиновых кислот представляют родной условиях. Co Иммунопреципитация (CoIP) и наложение анализов указывается, что основных рибонуклеопротеида комплекс может существовать в флоэмы sap из тыквы40, но не было доказано, что любой макромолекулярных комплексов существуют в родной условиях в течение Флоэма системы.

Синий страницу машинный код, представленный Schägger et al. 26, в сочетании с последующим разрешением гель электрофорез шаги позволяют осуществить разделение отдельных компонентов крупных белковых комплексов. С помощью 3D-страница анализ родной B. napus флоэма экссудата, мы недавно можно было продемонстрировать, что несколько высокий молекулярный вес: протеин и RNP комплексы существуют в образцах флоэма и ферментативно активной4. Альтернативные методы для изоляции белковых комплексов, а также RNPs как гель-проникающей хроматографии размер может существовать, но не с точки зрения резолюции по сравнению с БН-страницы. Кроме того для приемлемого качества сложных разделения, размер исключение столбцов матрицы должны быть адаптированы согласно общей сложных молекулярных масс проводится расследование. Анализ комплексов разного размера, поэтому, требуют различные типы столбцов, которые является дорогостоящими и не позволяют как мощные фокусировки как BN-страница.

Важнейшие шаги для анализа комплексов от B. napus включают в себя общее количество флоэма sap, используется в качестве исходного материала. По крайней мере 600 мкл пример флоэма являются необходимыми и могут быть получены из пяти хорошо поливать растения. Для 3D-страницы и BN Северный blotting необходимо начать первоначального млрд лари с достаточное количество образцов флоэмы. Для достижения этой цели, образцы флоэма сосредоточены до 20-30 мкг белка могут быть загружены в каждый хорошо и по крайней мере, triplicates же выборки выполняются параллельно. Слишком низкая или слишком высокая концентрация уменьшить обнаружения комплексов (рис. 3). Флоэма образцы должны быть собраны в реакции трубы на льду и следует хранить замороженные для последующего использования избежать деградации белка и оборот. Ингибиторы протеазы были найдены в всех флоэма протеомов анализируется, но также полностью активные протеасом был описан в флоэмы B. napus4. Кроме того объем и состав флоэма образцов зависит от времени точку выборки и условий окружающей среды10. Поэтому необходимо позаботиться о том, чтобы собирать в то же время дня в аналогичных условиях. Лечение стресса (например , засуха) может уменьшить количество флоэмы, которые могут быть собраны. Чтобы определить единый белки по масс-спектрометрии, обязательно ограничить возможные кератин загрязнений, перчатках все время. Кератин приводит к дополнительные сигналы во время массовых спектр анализа и препятствует идентификации белков. Запуск BN-страницы на высоком напряжении или при температуре окружающего воздуха может привести к Отопление геля, что может привести к разборке хрупких комплексов.

Протокол, представленные здесь подходит для анализа комплексов: протеин. Мы также показывают, что он может использоваться для обнаружения конкретных РНК, содержащихся в комплексах параллельно. Для достижения этой цели, мы недавно представил протокол для Северный blotting4млрд. РНК подвержены деградации РНКазы загрязнений. Чтобы ограничить такой деградации DEPC-лечение, воды должны использоваться.

Основные ограничения метода представленных включают оценки молекулярной массы белковых комплексов разделенных BN-страницы, так как поведение миграции зависит от размера, формы и даже Посттрансляционная модификации комплексы31, 41. Оценка размера RNP комплексов является еще более сложной из-за влияния на поведение миграции нуклеиновых кислот. Она может также не быть предотвращено что комплексов такого же размера совместно мигрировать в одной одной полосе. Это может привести к ошибочной прогнозирование сложных композиций. Поэтому проверка наблюдаемых взаимодействия с дополнительных методов, например , функциональные анализы4, может оказаться необходимым. Также только слабо или временно связанные с комплексом высокомолекулярных белков может быть потеряно в буфер млрд. Чтобы избежать этого, образцы могут быть высокоструктурированные, что также может привести к артефактам, или может предотвратить идентификации белков, или буфер условия могут быть оптимизированы.

В отличие от классического 2D-страницы, сочетание мочевины - и SDS-PAGE позволяет разделение согласно гидрофобность и молекулярный вес вместо Изоэлектрическая точка (pI) и молекулярный вес 28и не ограничивает разделение белков ряд конкретных Пи. Похож на классический 2D-страница, разделенных белки видны как одного пятна, но по диагонали линия 4,28 (рис. 5, рис. 6). Более гидрофобные белки появляются в точках выше диагонали, тогда как более гидрофильные белки находятся ниже линии28. Концентрацию полиакриламида, используемые в настоящем протоколе будет отделить протеины между 25 до 80 кДа хорошо. Разрешить разделение меньше или больше белков полиакриламида концентрация может быть изменено или градиент гели могут использоваться в третьем измерении. Компонентов сложных IV (рис. 3), разделенных 3D-страница (рис. 6) были вырезать, трипсина переваривается и проанализированы по масс-спектрометрии. Это привело к идентификации нескольких тРНК ligases. Компоненты другие комплексы были недавно опубликованы 4. Наши 3D-страницы включено разделение различных ligases, а именно аспартат, аспарагин, треонина, лизина и глицин и ligases, с подобными молекулярными весами проникли (Таблица 3). С помощью зонда tRNA специфичные метионина, мы смогли обнаружить потенциально связанных tRNA в сложном IV, но если полнометражного tRNA или фрагменты tRNA в комплексе не могут подвергаться с зондами используется. Чтобы проверить, если действительно связанные внутри комплекса, так и не совместно перенос нуклеиновые кислоты, протеазы переваривается флоэма sap образцы может служить подходящим миграционного контроля.

Ранее предположил, что белка перевод может произойти внутри трубки флоэмы сито, поскольку почти большинство компонентов всей рибосомы, а также удлинение факторы были найдены в флоэмы образцы4,7. Наш вывод тРНК и ligases тРНК, как представляется, поддерживают эту идею. Однако tRNA фрагменты присутствует в флоэмы образцы из тыквы, было показано, быть сильными ингибиторами перевод42 и функциональных рибосомы, как представляется, отсутствует4, предполагая, что перевод не может иметь место.

Взятые вместе, протокол, представленные здесь позволяет разделение родной: протеин и даже RNP комплексов от флоэмы образцов и разделения и идентификации их отдельных компонентов с высоким разрешением. Применение этого метода позволяет открытие новых белков и RNP комплексов в образцах флоэма и поэтому может выяснить новые функции в этом отсеке узкоспециализированные завод.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы благодарим Дженнифер Дик и Urszula Zarzenska за их научной поддержки. Эта работа была финансовой поддержке карьеры интеграции Грант (CIG, PCIG14-GA-2013-63 0734) Европейской Комиссией в рамках 7-й Рамочной программы, Грант LFF-GK06 «DELIGRAH» (Landesforschungsförderung Гамбург) и DFG Грант (DFG KE 856_6-1) присуждена JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics