Échantillonnage de Sap de phloème de Brassica napus pour 3D-PAGE des protéines et des Complexes ribonucléoprotéiques

Biology
 

Summary

Nous présentons un protocole afin d’analyser la composition en protéines de grande protéine : protéine native et de protéines : acides nucléiques complexes de colza (b. napus) exsudat de phloème en utilisant une approche d’électrophorèse (PAGE) 3D gel de polyacrylamide combinant bleu natif (BN) avec deux PAGEs de dénaturation suivie d’identification par spectrométrie de masse.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Prélèvement, le phloème des plantes supérieures est souvent laborieux et significativement dépend de l’espèce végétale. Toutefois, des études dans des conditions dénaturantes proteome pourraient être atteint dans différentes espèces de plantes. Protéine : protéine et protéine : complexes d’acides nucléiques provenant d’échantillons de phloème ont encore guère été analysées, même si elles pourraient jouent un rôle important dans le maintien de ce compartiment spécialisé ou dans la signalisation sur de longues distances. Grands assemblages moléculaires peuvent être isolés d’une électrophorèse sur gel natif bleu (BN-PAGE). Leurs constituants protéiques peuvent être séparées par un dodécylsulfate de sodium ultérieur PAGE (SDS-PAGE). Toutefois, les protéines avec des poids moléculaires similaires co migrent, ce qui peut gêner l’identification des protéines par spectrométrie de masse. Combinant BN-PAGE avec deux différents dénaturation gel électrophorèse étapes, à savoir Tris-Tricine-urée et SDS-PAGE, permet la séparation supplémentaire de protéines selon leur hydrophilicité/hydrophobie et augmente ainsi la résolution et le succès d’identification des protéines. Il permet même de distinguer les protéines qui diffèrent seulement par leurs modifications post-traductionnelles. En outre, bleu natif northern blot peut être appliqué pour identifier les composants de RNA de complexes macromoléculaires. Nous montrons que notre protocole est adapté pour démêler les protéines et les composants de RNA de protéine : protéine native et complexes ribonucléoprotéiques (RNP) survenant dans les échantillons de phloème. Combinant un bleu PAGE native avec deux différentes étapes dénaturation de PAGE peut aider à séparer les différents types de complexes protéiques grand et permet également un taux accru d’identification de leurs composants par spectrométrie de masse. En outre, le protocole est assez robuste pour détecter simultanément des acides nucléiques potentiellement liés au sein de complexes protéiques unique.

Introduction

Les conduites sur de longues distances du phloème sont essentiels pour la répartition des nutriments organiques chez les plantes supérieures, mais sont également impliqués dans la régulation de nombreux processus différents importants pour la croissance et développement, défense de l’agent pathogène et l’adaptation aux effets indésirables conditions environnementales. Outre petits effecteurs tels que les ions, phytohormones ou métabolites eux-mêmes, les macromolécules comme les protéines et les ARN ont récemment émergé comme signaux potentiels.

Des études ont montré que le chargement de phloème des protéines est taille dépendant et contrôlé par la limite d’exclusion de taille (SEL) des unités pore-plasmodesmal reliant les cellules compagnes (CC) et filtrez les éléments (SE) qui sont typiquement de l’ordre de 10 à > 67 kDa1 , 2 , 3. Toutefois, malgré ces protéines plus grandes limites de taille et de protéines complexes ont été découverts dans le système de phloème contestant l’idée d' exclusion de taille4et perte même non spécifique des protéines du CC pour soi a été suggérée5 .

Des complexes ribonucléoprotéiques multiprotéiques ainsi que de grandes jouent un rôle essentiel dans la biosynthèse et le maintien de l’intégrité structurale de la cellule6. On constate qu’il existe des complexes protéine-protéine et ribonucléoprotéique phloème-mobile4,7, mais à ce jour, on sait peu sur leur fonction. En éléments criblés du phloème RNP complexes et protéines : les protéines ont été impliqués avec transport à longue distance et / ou signalisation8,9. Pour démêler les fonctions des translocations complexes, étudier leur composition sous des variables environnementale ou des conditions de stress est nécessaires. Pour y parvenir, natives complexes doivent être isolés et leurs composants doivent être séparés avec une résolution suffisante.

Pour isoler des complexes de poids moléculaire élevé de phloème, il faut d’abord obtenir des échantillons de sève en qualité et en quantité suffisante. La technique qui peut être utilisée pour l’échantillonnage de phloème dépend de l’espèce végétale d’intérêt. Trois méthodes principales pour obtenir la sève existent 10: insectes stylectomie11, facilitées par EDTA exsudation12et exsudation spontanée13.

Échantillons de phloème d' Arabidopsis thaliana (a. thaliana), l’usine modèle majeur dans les laboratoires du monde entier, ne peuvent être obtenues que par l’EDTA-facilité exsudation ou puceron stylectomie14,15. Les deux méthodes conduisent à sève hautement diluées ou montants d’échantillon très faible. Exsudation facilitées par EDTA est également sujette à la contamination et ne peut pas représenter le phloème véritable composition16. Exsudation spontanée de phloème se limite à planter des espèces comme les cucurbitacées, lupin ou yucca, où couper les parties de la plante entraîne une émission spontanée de sève qui peut être facilement collectées13,17,18, 19. Nous avons récemment mis en place les colzas (Brassica napus) comme un système de modèle approprié pour l’analyse de phloème, puisque c’est un proche parent du thaliana et plusieurs microlitres de sève peuvent être obtenus auprès de petites incisions qui s’est avéré être de grande pureté4,8,20. En outre, la séquence du génome de b. napus sortit en 201421.

À l’exception des pucerons stylectomie, toutes les méthodes de collecte de phloème décrites comprennent endommager des tissus sur le site d’échantillonnage environnants, et la composition de la sève peut changer en réponse à une lésion. Il est donc indispensable de vérifier la qualité des échantillons de phloème, quelle que soit la méthode d’échantillonnage appliquée. Il existe différentes méthodes pour le contrôle de la qualité de sève recueillies, par exemple par détermination de la RNase activité22,23, RT-PCR avec des amorces contre Rubisco8,24ou l’analyse du sucre composition8.

Différentes méthodes pour isoler et séparer des complexes protéiques peuvent être appliquées, y compris chromatographie d’exclusion, ultracentrifugation de densité de saccharose ou échantillon filtration à travers des membranes avec des poids moléculaires distinctes coupe offs. Cependant, ces approches ne permettent pas de haute résolution. La technique appelée bleue PAGE native (BN-PAGE), d’abord décrit par Schägger et al. 25, est supérieure en termes de résolution. Il a été utilisé avec succès pour déterminer le poids moléculaire de complexes de grosse protéine native de divers organites ou de lysats cellulaires et leur abondance relative26,27.

Pour plus amples élucider la composition complexe de complexes protéiques, il est nécessaire de séparer les différents composants dans des conditions, conduisant à un démontage complet des composants complexes dénaturantes. Ceci peut être réalisé par une deuxième dimension du SDS-PAGE 28,29 , ou, pour obtenir une résolution plus élevée, par une deuxième dimension de l’isoélectrofocalisation (IEF) suivie d’une third dimension de SDS-PAGE30 et l’identification ultérieure des les protéines par spectrométrie de masse.

Dans ce protocole, nous décrivons le prélèvement de sève pure de b. napus plantes et l’analyse des protéines complexes de ces échantillons de phloème en utilisant une approche électrophorétique 3D combinant BN-PAGE avec Tris-Tricine-urée-PAGE et SDS-PAGE. Les protéines séparées des composants complexes sont par la suite identifiés par spectrométrie de masse. En outre, nous introduisons bleu natif northern Blot comme une méthode permettant la détection d’ARN en grandes RNP complexes4, étendre l’applicabilité de l’approche.

Protocol

1. l’échantillonnage et préparation de sève de b. napus plantes 4,8,20

  1. Pour sève d’échantillonnage, utilisez bien arrosées 8 semaines cette floraison initial seulement voir l’afin d’éviter des contaminations de pollen de plantes de b. napus .
  2. Utiliser une aiguille hypodermique (Ø 0,8 mm) et ponctuée de l’inflorescence la tige plusieurs fois. Répétez à plusieurs autres tiges d’inflorescence et sur d’autres plantes pour obtenir assez sève (Figure 2 a).
    Remarque : Pour des analyses complexes, il est recommandé de commencer au moins 600 µL de sève. 4 à 5 plantes produiront entre 200 et 700 µL de sève.
  3. Essuyer la première goutte sur les sites accidentés avec filtre papier. Principalement, ces gouttes contiennent des matières hautement contaminés d’entourant les tissus lésés et doivent être jetés.
  4. Recueillir les gouttes suivants de pipetage et stocker l’exsudat recueilli dans un tube à essais préalablement réfrigérées conique 1,5 mL à-20 ° C à l’aide d’un système de refroidissement sans glace.
  5. Poursuivre la collecte jusqu'à ce qu’aucune autre formation de goutte n’est observable, mais pas plus de 1 h. Cette procédure peut être répétée après deux jours sans perte significative de sève recueillie.
    Remarque : La sève recueillie peut être utilisée immédiatement ou stockée à-80 ° C pour des analyses. Pour le stockage de-80 ° C,-congélation le tube de réaction dans l’azote liquide.
  6. Concentrer l’échantillon de phloème à environ 1/6ème de son volume initial à l’aide de concentrateurs centrifuges avec un poids moléculaire coupé (MWCO) de 10 000 Daltons (Da). Centrifuger l’échantillon concentré à 4 ° C et 20 000 x g pendant au moins 15 min enlever les particules de poussière.
    NOTE : Concentration de sève de phloème ne conduit pas à une perte importante de protéines.
  7. Pour leur analyse complexe, passez à l’étape 3.1.

2. contrôle de pureté du phloème sap à l’aide de la reverse transcriptase PCR (RT-PCR) 4,8,20

  1. Isoler l’ARN total de sève à l’aide d’une méthode d’extraction de RNA standard pour matières liquides (p. ex. TRIzol ou phénol-chloroforme extraction suivie d’isopropanol précipitation de la phase aqueuse et d’éthanol lavage étapes selon la Protocole du fabricant).
    ATTENTION : Phénol-chloroforme est toxique. Travailler sous une hotte avec équipement de protection individuelle appropriés. L’ARN extrait peut être conservée dans l’éthanol à-80 ° C pendant jusqu'à six mois.
  2. Élimination des contaminants de l’ADN par digestion avec la DNase I (1 u/µg) pour 45 min à 37 ° C et inactiver les enzymes en ajoutant EDTA à une concentration finale de 5 mM et incuber l’échantillon à 75 ° C pendant 10 min.
  3. Pour obtenir des RNA pur, purifier et concentrer l’échantillon par une autre étape de purification (par exemple à l’aide de Kits de nettoyage de RNA, selon les instructions du fabricant).
  4. Effectuer une reverse transcriptase PCR (RT-PCR) pour la synthèse de cDNA avec un kit de synthèse de cDNA en utilisant 150 ng d’ARN pur tel que décrit par le fabricant du protocole.
    Remarque : L’ADNc peut être stocké à-20 ° C jusqu'à l’utilisation ultérieure.
  5. Utiliser 5 µL de l’ADNc comme modèle pour une réaction de PCR standard tel que spécifié par le fabricant, pour amplifier les transcriptions de compartiment spécifique et vérifier par électrophorèse sur gel d’agarose. Confirmer la pureté des échantillons de phloème par exemple à l’aide d’amorces pour la petite sous-unité de rubisco, thiorédoxine h et la protéine de capside du pollen (Figure 1 b, tableau 1).

3. bleu natif PAGE 4,25,26,31

  1. Utiliser soit coulé des gels natifs de dégradé comme décrit ailleurs27 ou commerciales gels de gradient de Bis-Tris.
  2. Charge de 20 à 30 µg de l’échantillon de concentré de protéine / puits sur le gel en triplicates au moins.
  3. Exécutez le gel à 4 ° C et 150 V à l’aide de buffer de cathode bleu foncé B et anode (tableau 2) jusqu'à ce que l’échantillon passé 1/3rd du gel (env. 20 à 30 min, Figure 3 a).
    Remarque : Pour le transfert de Northern, une voie unique de gel est suffisante, tandis que pour l’analyse de la composition en protéines par PAGE 3D et spectrométrie de masse qu'il est recommandé de combiner la même bande de jusqu'à dix voies de gel pour concentrer les protéines moins abondantes.
  4. Interrompre la course et échange cathode bleu foncé tampon B cathode bleu clair tampon B/10 (tableau 2) et continuer la course. Terminer le gel exécuté au démarrage de la façade bleue éluer hors gel (environ 120 à 180 min, Figure 3 a).
    Remarque : Le gel natif bleu fini peut être stocké à 4 ° C pendant au moins une semaine. Une conservation prolongée peut conduire à diffuser des bandes et devrait être évitée. Tampon bleu foncé B puisse être réutilisé.

4. facultative : Détection de l’ARN à l’aide de bleu natif du Nord buvard 4

  1. Découper des bandes distinctes ou utiliser la voie de tout gel de gel bleu natif et transférez-les sur une membrane de nylon par demi-sec buvard à 3,5 mA/cm2 pour 60 min et marquer la frontière gel supérieur et inférieur avec un crayon sur la membrane (Figure 4 a).
  2. Après avoir éponger, laver la membrane avec de l’eau traitée DEPC et sécher entre deux papiers filtres.
  3. Effectuer des UV-réticulation de la membrane buvardages avec 120 000 MJ/cm2 (85 s si vous utilisez la RETICULATION dans la Table des matières).
  4. Les hybrider la membrane avec 6 mL de tampon d’hybridation (commercial ou autodidacte) pendant 60 min à 68 ° C dans un four à hybridation (Figure 4 a).
  5. Ajouter 1 mL d’un tampon d’hybridation contenant 4 µL de sondes de 3'-biotinylé supplémentaire (100 nM).
  6. Incubez la membrane avec la sonde du jour au lendemain, en refroidissant le four de 68 ° C à 37 ° C.
  7. Nettoyer la membrane avec un tampon contenant 2 SDS x SSC et 0,1 %, pendant 5 min à température ambiante pour retirer les sondes liés besoin.
    ATTENTION : SDS peut causer des irritations. Porter des gants et blouse de laboratoire lorsque vous travaillez avec le SDS et SDS contenant des solutions.
  8. Effectuer la détection des sondes de 3'-biotinylé sur la membrane par exemple avec un conjugué streptavidine-HRP et le luminol comme substrat peroxydase de raifort (HRP) raifort, entraînant une réaction chimiluminescente sensible (Figure 4 a).

5. deuxième dimension : Tris-Tricine-urée PAGE 4,28

  1. Des bandes individuelles de gel bleu natif de l’accise. Combiner les bandes d’échantillons sur des voies parallèles pour atteindre une concentration supplémentaire de protéines complexes (Figure 5).
    NOTE : Bandes excisées peuvent être stockés dans tubes de réaction unique jusqu'à utilisation ultérieure à 4 ° C.
  2. Versez un gel de Tris-Tricine-urée de 12 % (épaisseur de 1 mm, 6,8 cm x 8,6 cm (largeur x longueur)). Préparer le gel de séparation (tableau 2), 10 mL de la solution de gel A verser entre deux plaques de verre et de superposition avec de l’isopropanol. Supprimer l’isopropanol après que la polymérisation est terminée et le transfert de 4 mL de solution de gel B (tableau 2) pour le gel de concentration sur le gel et insérer qu'un 10 bien peigner.
    ATTENTION : L’acrylamide non polymérisée peut être neurotoxique et TEMED est nocif par inhalation. Toujours porter un équipement de protection individuelle et travailler sous une hotte.
  3. Transférer les bandes de gel excisées dans un tube de réaction de 1,5 mL et ajouter 1 mL de 2 x SDS solution tampon pour l’équilibration des pièces gel (Figure 5, tableau 2).
    1. Incuber les échantillons pendant 10 min à température ambiante, avant de faire bouillir dans un bloc chauffant (95 ° C) ou dans un four à micro-ondes et incuber les échantillons à nouveau à température ambiante pendant 15 minutes supplémentaire.
    2. Empilez plusieurs morceaux de gel équilibré qui représente le même complexe dans un gel unique poche.
    3. Effectuer l’électrophorèse de l’anode et la cathode exécutant des tampons à 150 V pendant 45 à 60 min et la voie gel toute l’accise.
  4. Incuber la voie coupée pendant 20 min dans un tampon acide (Tris, d’acide acétique 100 mM 100 mM) et équilibrer en 125 mM Tris-HCl, pH 6,8 pendant 20 min (Figure 5).

6. troisième dimension : SDS-PAGE 4,32

  1. Versez une SDD 15 % séparant gel selon Laemmli32 (épaisseur : 1,5 mm, 6,8 cm x 8,6 cm (largeur x longueur)) (tableau 2) et ajoutez une fine couche d’un 4 % gel ci-dessus d’empilage.
    ATTENTION : SDS, l’acrylamide et TEMED sont toxiques et nocives. Travailler sous une hotte et porter des équipements de protection individuelle.
  2. Transférer la voie gel équilibré sur le gel SDS et couvrir le gel d’agarose de 0,5 % (p/p) 1 x SDS tampon additionné d’une trace de bleu de bromophénol (Figure 5).
  3. Faire bouillir le SDS exécutant tampon avec agarose dans le four à micro-ondes avant chargement dans le gel.
  4. Pour faire fonctionner un marqueur protéique pour estimer le poids moléculaire des composants simples, insérez un morceau de papier filtre sur une extrémité du gel jusqu'à ce que l’agarose solidifié ou utilisez un peigne spécial, généralement utilisé pour les gels de l’IPG.
  5. Exécutez le gel à 150 V pour 60 min et tache le gel colloïdal Coomassie, tache argentée ou toute autre coloration méthode d’analyse par spectrométrie de masse ultérieure.
  6. Analyser les taches de protéines visibles en utilisant des approches par spectrométrie de masse comme du désorption-ionisation laser assistée par matrice (MALDI-TOF) temps de vol ou de CL-SM/SM spectrométrie de masse.
    Remarque : Nous recommandons d’utiliser le bleu de Coomassie colloïdal coloration comme déjà décrit33. Dans nos mains, encore moins abondantes protéines peut être suffisamment coloré et permet une analyse par spectrométrie de masse avec la qualité des données raisonnables.

Representative Results

Nous présentons ici un protocole qui permet l’analyse des protéines : protéines ainsi que des complexes protéine-ARN dans des échantillons de phloème de Brassica napus. Le flux de travail est illustré à la Figure 1. Un avantage majeur de b. napus sur autres organismes modèles est la possibilité de prélèvement d’échantillons de phloème relativement facile de petites perforations dans la tige de l’inflorescence. Cela permet d’obtenir des échantillons de phloème pure en relativement grande quantité. Lors de l’échantillonnage du phloème, il est toujours conseillé de rechercher des contaminations, par exemple par RT-PCR8. Un résultat représentatif obtenu auprès d’un échantillon de phloème pure est représenté à la Figure 2. Échantillons de phloème non-contaminés devraient montrer une bande visible pour la thiorédoxine h, alors qu’aucun signal de la rubisco et la protéine de capside de pollen ne doit apparaître. La petite sous-unité de rubisco peut servir comme un contrôle dans les échantillons de feuilles, les tiges de l’inflorescence ou pollen. Thioredoxin h devrait être détectable dans tous les échantillons, puisque son ARNm a été trouvé dans le phloème de différentes espèces, tandis que la transcription de protéine de manteau de pollen ne devrait être visible dans les échantillons de bourgeons floraux. Des contaminations peuvent se produire lors du phloème est réalisée entièrement angiospermes (protéine de capside du pollen) ou lorsque les gouttelettes premières de phloème d’échantillonnage crevaisons sont rejetées pas correctement (rubisco).

BN-PAGE intempestive, il est obligatoire de concentrer la sève. Chaque puits, avec 20 à 30 µg de protéines, au moins quatre bandes de complexes protéiques majeurs seront visibles qu’après BN-PAGE de b. napus sève, trop faible ou trop fortes concentrations ne permettent pas une séparation claire des complexes (Figure 3). Il est recommandé de charger plusieurs bandes de gel représentant le même complexe dans une poche unique du gel seconde dimension de concentrer davantage les protéines de chaque complexe unique pour fins d’identification par spectrométrie de masse et de traitement en aval.

Pour identifier les composants individuels des complexes macromoléculaires de phloème, nous combinée de la BN-PAGE initiale avec une deuxième dimension Tris-Tricine-urée et une troisième dimension SDS-PAGE, pour obtenir une séparation de protéines simples. Ici, on peut observer une séparation avec une haute résolution en raison des comportements de migration différentes protéines urée et gels SDS-PAGE. En règle générale, les protéines appartenant à un seul complexe sera visibles comme une ligne diagonale à travers le gel. Les protéines au-dessus de cette ligne ont une hydrophobie accrue, tandis que les protéines au-dessous du seuil représentent plus hydrophiles28 (Figure 5, Figure 6).

Pour la caractérisation des complexes de RNP, nous avons utilisé une partie d’un gel de BN-PAGE pour effectuer le transfert de Northern BN. Après avoir éponger d’une allée entière sur une membrane de nylon et la réticulation par irradiation UV, l’ARN peut être visualisée à l’aide de sondes spécifiques RNA, tel qu’illustré à la Figure 4. Ici, il est démontré qu’un ARNt spécifique n’est présent que dans un seul complexe spécifique. Les constituants protéiques de ce complexe ARNt-liaison peuvent être étudiées plus loin en utilisant la méthode gel 3D décrite ci-dessus. Les analyses par spectrométrie de masse ont montré que ce complexe contienne principalement ARNt-ligases ce qui confirme l’activité de liaison ARNt trouvée par BN northern blot.

Figure 1
Figure 1 : flux de l’analyse des complexes ribonucléoprotéiques de travail dans la sève du colza. Après échantillonnage et préparation des échantillons de phloème, BN-PAGE est effectuée pour séparer des complexes natives. Ces gels BN-PAGE permettent l’analyse parallèle des acides nucléiques par BN northern Blot et l’identification des éléments protéiques des complexes par spectrométrie de masse. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : contrôle d’échantillonnage et de la pureté de la sève de b. napus. Après ponction de la tige de l’inflorescence de 8 à 10 semaine vieux oléagineux viol plantes avec une seringue hypodermique stérile, exsudat est recueilli avec une pipette et transférée dans un tube de réaction glacée (a) pour confirmer la pureté des échantillons du phloème QUE RT-PCR est réalisée, amplifier les transcriptions de thioredoxin h, petite sous-unité de rubisco et protéine de capside du pollen dans les échantillons de tissu-spécifique (b) RT-PCR sans la transcriptase inverse a été réalisée sous contrôle (-). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3: BN-PAGE. Représentation schématique du bleue PAGE native avec des échantillons de phloème concentré de b. napus. (a) après le chargement le gel protéique dégradé avec 15-20 µL de sève concentrée, BN-PAGE est réalisée avec un tampon de cathode bleu foncé 1 x B à 150 V pendant 20-30 min dans une chambre froide. Puis le tampon est échangé contre 1 tampon de cathode bleu clair x B/10 et la PAGE est terminée à 150 V 120-180 min jusqu'à ce que le bleu foncé en cours d’exécution avant courses hors gel. Les gels de BN-PAGE montrent quatre bandes distinctes représentant les quatre différents complexes de poids moléculaire élevé. (b) (c) trop peu ou trop protéines du phloème (d) de chargement réduit la visibilité des complexes individuels. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : le transfert de Northern BN. Représentation schématique de la BN du Nord buvard méthode. une ruelle de la BN-PAGE est transférée sur une membrane de nylon en semi sèche en tamponnant. Après réticulation UV et pré-hybridation, la membrane est incubée avec des sondes spécifiques d’ARN (sonde ici une méthionine ARNt spécifiques), qui sont biotinylated à l’extrémité 3'-dans un four à hybridation pendant la nuit. Sondes libres sont éliminés par étapes de lavage et la détection de l’ARN s’effectue par un conjugué streptavidine-HRP et luminol. En utilisant cette approche, nous avons observé que le complexe IV de la BN-PAGE contienne méthionine ARNt. (b) le gel teinté de bleu de Coomassie et la tache de tRNA ressemblent à deux voies différentes gel s’exécutés en parallèle afin d’éviter des différences de migration. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : pages 3D. Représentation schématique de l’approche 3D-PAGE. Plusieurs bandes du même complexe sont excisés d’un gel de BN-PAGE, incubés dans le tampon de chargement et transférés dans un puits de la deuxième dimension Tris-Tricine-urée-PAGE. Après électrophorèse, gel toute voies sont découper, lavées à l’acide tampon acide, équilibrés et placés sur un gel SDS-PAGE de 15 %. Après la troisième dimension PAGE, les protéines séparées sont Coomassie souillé et analysé par spectrométrie de masse. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : représentant les résultats après pages 3D. Dans la première dimension BN-PAGE plusieurs complexes est apparus. Leurs constituants protéiques pourraient être séparées par deux les PAGEs suivantes sur la dénaturation, résultant en un motif diagonale spot. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Sonde Séquence
Thioredoxin h
avant: CTCAAGGCAGCCAAAGAATC
inverse : ATGGCCTGAACATCGAACTC
Rubisco chaînette
avant: TTCACCGGCTTGAAGTCATC
inverse : CCGGGTACTCCTTCTTGCAT
Protéine de capside de pollen BRU77666
avant: TCAGAACTGGAGCTTCAACG
inverse : TTCCTTAATGGCCTCAGTGG

Tableau 1 : amorces utilisées pour le contrôle de pureté du phloème échantillon. Pour vérifier la pureté d’échantillon du phloème amorces spécifiques pour la petite chaîne de rubisco, thiorédoxine h et protéine de capside de pollen peuvent être utilisés pour l’amplification de l’ADNc.

Tampons et Solutions Contenu Commentaire
tampon de cathode bleu foncé B 15 mM Bis-Tris de pH 7,0
50 mM Tricine
0,02 % (p/v) bleu de Coomassie G250
recette est adaptée du Fiala et coll. 17
pH doit être ajusté à 7.0
Mémoire tampon peut être fait comme un stock de 10 x
tampon de cathode bleu clair B/10 15 mM Bis-Tris de pH 7,0
50 mM Tricine
0,002 % (p/v) bleu de Coomassie G250
Mémoire tampon peut être préparé en diluant tampon cathode B avec le tampon de la cathode sans Coomassie
tampon de l’anode
50 mM Bis-Tris de pH 7,0
Mémoire tampon peut se transformer en un 10 x solution mère
2 x mémoire tampon échantillon de SDS
125 millimètres Tris-HCl pH 6,8
4 % SDS
20 % glycérol
0,2 TNT DE M
bleu de bromophénol 0,02 % (p/v)
Transfert tampon 1 x TBE
89 mM Tris pH 7,6
acide borique 89 mM
2 mM EDTA
Tampon TBE peut être réalisé et stockée sous forme de stocks de 5 x ou 10 x. Il est important de l’eau utilisation exempte de RNase désionisée.
2 x tampon SSC
300 mM NaCl
pH de citrate 30 mM Na37,0
3 x gel tampon
Tris de 3M
HCl 1 M
0,3 % SDS

pH 8 h 45
Recette adaptée de Schägger 19
Tris-Tricine gel solution A
Pour 10 mL :
30 % d’acrylamide-bisacrylamide (29 : 1) 3,34 mL
Urée 6 M
3 x 3,34 mL de tampon de gel
70 % de glycérol 1,4 mL
Ajouter ddH2O à 10 mL
10 % APS 40 ΜL
TEMED 4 ΜL
Poids 6 M urée et ajouter 3 x tampon gel, la solution d’acrylamide-bisacrylamide et 70 % gycerol. Chauffer à 60 ° C dans un bain d’eau à solubiliser l’urée. Ajouter ddH2O à 10 mL, 10 % APS et enfin TEMED pour la polymérisation.
Solution de gel tris-Tricine B
Pour 6 mL :
30 % d’acrylamide-bisacrylamide (29 : 1) 0,8 mL
Urée 6 M
3 x 1,5 mL de tampon de gel
Ajouter ddH2O à 6 mL
10 % APS 45 ΜL
TEMED 4.5 ΜL
Poids 6 M urée et ajouter 3 x solution de tampon et de bisacrylamide-acrylamide gel. Chauffer à 60 ° C dans un bain d’eau à solubiliser l’urée. Ajouter ddH2O à 10 mL, 10 % APS et enfin TEMED pour la polymérisation.
1 x Tris-Tricine tampon en cours d’exécution (anode)
100 mM Tris
HCl à 22,5 mM

pH 8,9
Recette adaptée de Schägger 19
1 x Tris-Tricine tampon en cours d’exécution (cathode)
100 mM Tris
100 mM Tricine
1 % SDS


pH 8.25
Recette adaptée de Schägger 19
Tampon acide
100 mM Tris
100 mM acide acétique
4 % gel d’empilement de SDS
Pour 2 mL :
ddH2O 1,4 mL
30 % d’acrylamide-bisacrylamide (37.5:1) 0,33 mL
1 M Tris pH 6,8 0,25 mL
10 % SDS 20 ΜL
10 % APS 20 ΜL
TEMED 2 ΜL
15 % SDS séparant gel
Pour 10 mL :
ddH2O 2,3 mL
30 % d’acrylamide-bisacrylamide (37.5:1) 5 mL
1.5 M Tris pH 8,8 2,5 mL
10 % SDS 100 ΜL
10 % APS 100 ΜL
TEMED 4 ΜL
1 x tampon en cours d’exécution de SDS
25 mM Tris
glycine 192 mM
0,1 SDS %
Coloration de solution de bleu de Coomassie
sulfate d’aluminium-(14-18)-hydrate de 5 % (p/v)
10 % (v/v) d’éthanol (96 %)
2 % (v/v) d’acide orthophosphorique (85 %)
0,02 % (p/v) G-250 Coomassie brillant bleu
 
Tampon d’hybridation ultrasensible ULTRAhyb Ambion, Life Technologies

Tableau 2 : Solutions et recettes tampon. Liste de tous les tampons et les solutions nécessaires pour l’analyse 3D-PAGE.

Spot n°. Obs. MW [kDa] Identification Organisme N° d’adhésion. MW [kDa] Score de mascotte
CIV_1 130 Protéine de résistance au maladie putatif At4g19050 B. napus CDX78917 131.1 110
CIV_2 130 Protéine de résistance au maladie putatif At4g19050 B. napus CDX78917 131.1 89
CIV_3 100 Heat shock 70 kDa protéine 14-like B. napus XP_013748865 89,9 113
CIV_4 90 Facteur d’élongation eucaryote 2
La division cellulaire contrôle homologue 48 protéine A
B. napus
B. napus
CDX90241
CDY41316.1
89,5
89,5
111
197
CIV_5 85 Chaleur de choc type protéine 90-2 B. rapa XP_009132342 79,8 172
CIV_6 80 Thréonine--ligase d’ARNt
Glycine--ligase d’ARNt
B. oleracea
B. napus
XP_013599115
CDY43195
81,5
80,8
110
88
CIV_7 70 Heat shock protéine de 70 kDa
Lysine - tRNA ligase-like
B. oleracea
B. napus
XP_013685267
XP_013747530
67,8
69,9
230
150
CIV_8 65 Myrosinase
Aspartate--ligase d’ARNt 2
Asparagine--ligase d’ARNt 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase type 2 B. rapa XP_009135865 53.1 139
CIV_11 55 Facteur d’élongation 1-alpha 1-like B. oleracea XP_013586115 51,9 161
CIV_12 50 Lyase cystine CORI3-like B. napus XP_013653143 48,1 237
CIV_13 44 Lyase cystine CORI3-like B. rapa XP_009108611 48,3 213
CIV_14 38 Fructose-diphosphate aldolase B. rapa XP_009115993 38,4 226
CIV_15 45 Lyase cystine CORI3-like B. rapa XP_009108611 48,3 219
CIV_16 45 Lyase cystine CORI3 B. rapa CDY69765 46,9 209
CIV_17 38 Fructose-diphosphate aldolase B. rapa XP_009115993 38,4 124
CIV_18 18 Peptidyl-prolyl cis-trans isomérase type CYP18-3 B. napus XP_009101932 18.3 128
CIV_19 45 Lyase cystine CORI3-like B. rapa XP_009108611 48,3 177

Tableau 3 : identifier les constituants protéiques du complexe IV. Plusieurs ligases tRNA et davantage de protéines ont été découverts dans le complexe de liaison ARNt analyse par spectrométrie de masse à l’aide de MALDI-TOF après 3D-PAGE.

Discussion

Le phloème est un compartiment d’un grand intérêt, car elle constitue l’itinéraire de transport important pour photoassimilates et est également essentiel pour la signalisation sur de longues distances entre plantes différentes pièces9,20,34, 35. En plus de petites molécules, macromolécules comme les protéines et les ARN ont été impliqués avec entretien de phloème et signalisation4,7,8. L’analyse de la composition de phloème est limité par l’accessibilité limitée aux échantillons de phloème dans la plupart des espèces végétales. La technique de l’insecte stylet est largement applicable, mais expérimentalement exigeants et se traduit par très petites quantités d' échantillons de phloème11. Une technique simple, utilisée pour l’échantillonnage de phloème est facilitée par EDTA exsudation12. EDTA chélates ions divalents comme le Calcium et empêche ainsi la fermeture des plaques criblées de P-protéines et callose. Il est facile à utiliser, mais est sujette à la contamination par les cellules endommagées et les échantillons sont dilués. Appauvrissant la couche d’ions divalents par l’EDTA pourrait également conduire à un effondrement des complexes existants. Cependant, il permet un échantillonnage d’un large éventail d’espèces dont la plante modèle Arabidopsis15. Exsudation spontanée de sève se produit uniquement dans un petit nombre d’espèces végétales. C’est une méthode invasive qui implique de lésion significative d’usine tissus10. Nous avons récemment mis en place b. napus comme espèce modèle pour l’étude des transports longue distance4,8,20. Ici, sève peut être dégusté de petites incisions, qui réduit les blessures des effets et des sources de contamination.

À l’aide de différentes techniques d’échantillonnage, le protéome d’échantillons de phloème de différentes espèces de plantes a été étudié au cours des dernières années7,8,17,36,37, 38,,39. Pour ces études de protéome, les protéines ont été extraites et précipités dans des conditions dénaturantes et par conséquent ne permettent pas de conclusions au sujet de protéines : protéines et protéines : interactions acides nucléiques présentent sous conditions natives. Co-immunoprécipitation (Pico) et essais de superposition a indiqué qu’un complexe ribonucléoprotéique majeur pouvant exister dans la sève de citrouille40, mais il n’était pas démontré que les complexes macromoléculaires présents dans des conditions natives dans le système de phloème.

Bleue PAGE native, présentée par Schägger et al. 26, en combinaison avec les étapes de l’électrophorèse sur gel haute résolution ultérieure permettent la séparation des différents composants de complexes protéiques importantes. En utilisant des analyses 3D-PAGE du natif de b. napus exsudat de phloème, nous pourrions récemment montrent que plusieurs high-molecular-weight protéine : protéine et complexes de RNP existent dans des échantillons de phloème et sont enzymatiquement actif4. Autres méthodes pour isoler les complexes protéiques ainsi que RNP comme chromatographie d’exclusion peut-être exister, mais en termes de résolution par rapport à BN-PAGE en cas d’échec. En outre, pour une qualité raisonnable de séparation complexe, matrices de taille exclusion colonne doivent être adaptées selon les poids moléculaires complexes dans l’ensemble à l’étude. Analyse des complexes de taille différente exigeront donc différents types de colonnes qui est intensif et ne permet pas comme haute puissance mise au point comme un BN-PAGE.

Les étapes essentielles pour analyser des complexes de b. napus comprennent le montant total de sève utilisée comme matériau de départ. Au moins 600 µL de l’échantillon du phloème sont nécessaires et peuvent être obtenus auprès de cinq plantes bien arrosées. 3D-PAGE et BN northern Blot, il est nécessaire de commencer le gel BN initial avec une quantité suffisante d’échantillons de phloème. Pour y parvenir, des échantillons de phloème sont concentrés jusqu'à 20 à 30 µg de protéines peuvent être chargés dans chaque bien et au moins réanalysés du même échantillon sont exécutés en parallèle. Des concentrations trop faibles ou trop élevées réduisent la détection des complexes (Figure 3). Phloème échantillons doivent être prélevés dans des tubes de réaction sur la glace et doivent être conservés congelés pour une utilisation ultérieure éviter le chiffre d’affaires et de la dégradation des protéines. Inhibiteurs de protéase ont été trouvés dans toutes les protéomes phloème analysés, mais aussi un protéasome pleinement actif a été décrite dans le phloème de b. napus4. En outre, volume et la composition des échantillons de phloème dépendent du temps-point de prélèvement et conditions environnementales10. C’est pourquoi il faut recueillir à la fois de la journée dans des conditions similaires. Traitements de stress (sécheresse,par exemple ) peuvent réduire la quantité de phloème qui peut être collecté. Pour identifier les protéines simples par spectrométrie de masse, il est obligatoire pour limiter les contaminations de kératine possible de porter des gants tout le temps. Kératine conduit à signaux supplémentaires lors de l’analyse de masse spec et entrave l’identification des protéines. Tourne le BN-PAGE à une tension plus élevée ou à température ambiante peut conduire au chauffage du gel pouvant survenir dans le démontage des complexes fragiles.

Le protocole présenté ici est destiné à l’analyse des complexes de protéine : protéine. Nous montrons aussi qu’il peut être utilisé pour détecter l’ARN spécifiques contenues dans les complexes en parallèle. Pour ce faire, nous avons récemment introduit un protocole pour BN northern Blot4. RNAs sont sujettes à la dégradation par des contaminations de RNAse. Afin de limiter cette dégradation DEPC-traitée, l’eau doit être utilisé.

Principales limites de la méthode présentée comprennent l’estimation du poids moléculaire de complexes protéiques séparées de BN-PAGE, étant donné que le comportement de migration dépend de la taille, la forme et même des modifications post-traductionnelles des complexes31, 41. Estimation de la taille des complexes de RNP est encore plus compliquée en raison de l’influence des acides nucléiques sur le comportement de migration. Elle peut également pas être prévenue que complexes de même taille migrent conjointement dans une seule bande. Cela peut conduire à la prévision erronée des compositions complexes. Donc vérifier les interactions observées avec des techniques complémentaires, par exemple par des essais fonctionnels4, peut être nécessaire. Également les protéines seulement faiblement ou transitoirement associées à un complexe macromoléculaire pourraient être perdus dans le tampon BN utilisé. Pour éviter cela, les échantillons pourraient être réticulé, ce qui peut aussi conduire à des artefacts ou empêchent l’identification des protéines, ou les conditions de la mémoire tampon peuvent être optimisées.

Contrairement aux pages 2D classique, la combinaison d’urée et SDS-PAGE permet la séparation selon l’hydrophobie et poids moléculaire au lieu de point isoélectrique (pI) et de poids moléculaire 28et ne limite pas la séparation de protéines d’un gamme spécifique pI. Semblable au classique 2D-PAGE, séparés des protéines sont visibles sous forme de taches simples, mais en diagonal de la ligne 4,28 (Figure 5, , Figure 6). Plus de protéines hydrophobes apparaissent dans des endroits au-dessus de cette diagonale, alors que plus hydrophiles protéines sont trouvent au-dessous de la ligne28. Les concentrations de polyacrylamide utilisées dans le présent protocole seront bien séparer des protéines entre 25 à 80 kDa. Pour permettre une séparation des protéines plus petites ou plus grandes le polyacrylamide concentration peut varier ou gels de gradients peuvent être utilisés dans la troisième dimension. Les composantes du complexe IV (Figure 3) séparés par 3D-PAGE (Figure 6) ont été supprimés, trypsine digéré et analysé par spectrométrie de masse. Cela a permis l’identification de plusieurs ligases ARNt. Les composants des autres complexes ont été publiés récemment 4. Notre PAGE 3D activé la séparation des différents ligases, nommément aspartate, asparagine, thréonine, lysine et glycine ligases, dont les poids moléculaires similaires (tableau 3). À l’aide d’une sonde d’ARNt spécifique de méthionine, nous étions capables de détecter des ARNt potentiellement lié au sein du complexe IV, mais si le tRNA pleine longueur ou des fragments de l’ARNt sont dans le complexe ne peuvent pas être distinguées avec les sondes utilisées. Pour vérifier si les acides nucléiques sont vraiment lié au sein du complexe et pas migrent, protéase digéré sève échantillons pourraient servir de contrôles migratoires approprié.

Il a été spéculé plus tôt que la traduction des protéines peut se produire dans les tubes criblés du phloème, étant donné que presque la plupart des composants de la ribosome ensemble, mais aussi les facteurs d’élongation ont été trouvés dans le phloème échantillons4,7. Notre découverte du Tarn et les ligases ARNt semble appuyer cette idée. Cependant, les fragments de tRNA présents dans des échantillons de phloème de citrouille ont démontré être puissants inhibiteurs de traduction42 et ribosomes fonctionnels semblent être absent4, ce qui suggère que la traduction ne peut avoir lieu.

Pris ensemble, le protocole présenté ici permet la séparation des protéines : la protéine native et même RNP complexes d’échantillons de phloème et la séparation et l’identification de leurs composants à haute résolution. L’application de cette méthode permet la découverte de la nouvelle protéine et complexes de RNP dans des échantillons de phloème et peut élucider par conséquent de nouvelles fonctions dans ce compartiment de plantes hautement spécialisés.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions Jennifer Deke et Urszula Zarzenska pour leur soutien scientifique. Ce travail a été soutenu financièrement par une subvention de l’intégration professionnelle (CIG, 0734 PCIG14-GA-2013-63) par la Commission européenne au sein du 7e programme-cadre, la subvention LFF-GK06 « DELIGRAH » (Landesforschungsförderung Hamburg) et l’octroi de la DFG (DFG KE 856_6-1) attribué à JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics