Muestreo de Sap de líber de Brassica napus para 3D-página de proteínas y complejos de ribonucleoproteína

Biology
 

Summary

Aquí presentamos un protocolo para analizar la composición de proteína de proteína: proteína nativa grande y proteínas: complejos de ácido nucleico de colza (B. napus) exudado líber utilizando un enfoque 3D poliacrilamida gel electroforesis (PAGE) combinando azul nativo (BN) con dos páginas desnaturalización seguida de identificación espectrométrica de masa.

Cite this Article

Copy Citation | Download Citations

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Muestreo el floema de las plantas superiores es a menudo laborioso y significativamente dependiente de las especies de plantas. Sin embargo, estudios de proteoma bajo desnaturalizar condiciones pueden lograrse en diferentes especies de plantas. Nativa: proteína y proteína: complejos de ácidos nucleicos de muestras de líber aún apenas se han analizado, aunque podría desempeñar un papel importante en el mantenimiento de este compartimiento especializado o en la señalización de larga distancia. Grandes ensamblajes moleculares pueden ser aislados mediante una electroforesis nativa azul (BN-PAGE). Sus componentes de proteínas se pueden separar por un dodecil sulfato de sodio posterior página (SDS-PAGE). Sin embargo, las proteínas con pesos moleculares similares Co migran, lo que puede dificultar la identificación de proteínas por espectrometría de masas. Combinación de BN-PAGE a dos diferentes desnaturalización gel de electroforesis, es decir, Tris-Tricina-urea y SDS-PAGE, permite la separación adicional de proteínas según su hidrofilicidad/hidrofobicidad y así aumenta la resolución y el éxito de identificación de proteínas. Incluso permite distinguir proteínas que sólo difieren en sus modificaciones postraduccionales. Además, el borrar norteño nativa azul se puede aplicar para identificar los componentes de RNA en complejos macromoleculares. Demostramos que nuestro protocolo es adecuado para desentrañar la proteína y RNA componentes de proteína: proteína nativa y complejos de ribonucleoproteína (RNP) que ocurre en las muestras de líber. Combinar un azul nativo con dos pasos diferentes de página desnaturalización puede ayudar a separar los diferentes tipos de complejos de proteínas grandes y también permite una tasa de aumento de la identificación de sus componentes por espectrometría de masas. Además, el protocolo es lo suficientemente robusto como para detectar simultáneamente potencialmente enlazados ácidos nucleicos dentro de complejos de proteína sola.

Introduction

Los conductos de larga distancia del floema son esenciales para la asignación de nutrientes orgánicos en las plantas superiores, pero también están involucrados en la regulación de diferentes procesos importantes para el crecimiento y desarrollo, defensa del patógeno y la adaptación a las adversas condiciones ambientales. Además de pequeños generadores como los iones, fitohormonas o metabolitos propios, macromoléculas como las proteínas y RNAs recientemente han surgido como potenciales señales.

Los estudios han demostrado que la carga del floema de las proteínas es tamaño dependiente y controlado por el límite de exclusión de tamaño (SEL) de las unidades poro plasmodesmal conectar células acompañantes (CC) y elementos (SE) que se encuentran típicamente en el rango de 10 a del tamiz > 67 kDa1 , 2 , 3. sin embargo, a pesar de estas proteínas más grandes de la limitaciones de tamaño y de la proteína se han encontrado complejos dentro del sistema de líber desafiando la idea de exclusión de tamaño4, y aún no específica pérdida de proteínas del CC que SE ha sido sugerida5 .

Complejos de multiproteínas como grandes ribonucleoproteína juegan un papel fundamental en la biosíntesis y mantenimiento de la integridad estructural de la célula6. Hay pruebas de que complejos de proteínas y ribonucleoproteína de líber-móvil existen4,7, pero hasta la fecha se conoce poco sobre su función. En elementos de floema tamiz: proteína y RNP complejos se han implicado con transporte interurbano o señalización de8,9. Para desentrañar las funciones de los complejos translocados, estudiando su composición bajo variables ambiental o condiciones de estrés es necesarias. Para lograr esto, nativos complejos tienen que ser aislados y sus componentes deberán estar separadas con suficiente resolución.

Para aislar los complejos de alto peso molecular desde el floema, es necesario obtener muestras de sap en suficiente calidad y cantidad. La técnica que puede utilizarse para el muestreo de floema depende de las especies vegetales de interés. Tres métodos principales para obtener la savia del floema existen 10: insectos stylectomy11, exudación de EDTA facilita12y exudación espontánea13.

Muestras de líber de thaliana de Arabidopsis (dea. thaliana), la planta modelo importantes en laboratorios de todo el mundo, sólo pueden obtenerse un facilitado de EDTA exudación o pulgón stylectomy14,15. Ambos métodos conducen a la savia del floema altamente diluido o cantidades de muestra muy bajo. Exudación de EDTA facilita también es propensa a la contaminación y no pudo representar el floema real composición16. Exudación espontánea líber se limita a plantar especies como cucurbitáceas, lupino o yuca, donde cortar partes de la planta lleva a una emisión espontánea de savia del floema que puede ser fácilmente recogidos13,17,18, 19. Recientemente establecimos colza (Brassica napus) como un sistema de modelo adecuado para el análisis del floema, ya que es un pariente cercano de a. thaliana y varios microlitros de savia del floema pueden obtenerse en pequeñas incisiones que se ha demostrado que ser de alta pureza4,8,20. Además, la secuencia del genoma B. napus fue lanzada en 201421.

Excepto pulgón stylectomy, todos los métodos de colección de líber descritos incluyen daño del tejido en el sitio de muestreo, y la composición de la savia del floema puede cambiar en respuesta a la lesión. Por lo tanto, es esencial para comprobar la calidad de las muestras de líber, independientemente del método de muestreo aplicado. Existen diferentes métodos para el control de calidad de sap líber recogidos, por ejemplo, por determinación de la actividad22,23Rnasa, RT-PCR con cebadores contra Rubisco8,24o el análisis del azúcar composición8.

Pueden aplicarse diferentes métodos para aislar y separar los complejos, incluyendo la cromatografía por exclusión de tamaño, ultracentrifugación de densidad de sacarosa o filtración de la muestra a través de membranas con distinto peso molecular cortado offs. Sin embargo, estos enfoques no permiten alta resolución. La técnica denominada página nativa azul (BN-PAGE), primero descrita por Schägger et al. 25, es superior en términos de resolución. Fue utilizado con éxito para determinar los pesos moleculares de complejos de proteína nativa grande de varios organelos o Lisados celulares y su abundancia relativa26,27.

Para aclarar más lejos la composición compleja de complejos de la proteína, es necesario separar los componentes individuales bajo desnaturalizar condiciones, hacia el desmontaje de los componentes del complejo. Esto puede lograrse mediante una segunda dimensión de SDS-PAGE 28,29 o, para lograr una resolución más alta, por una segunda dimensión de la concentración isoeléctrica (IEF) seguida por un third dimension de SDS-PAGE30 y posterior identificación de las proteínas mediante espectrometría de masas.

En este protocolo, se describen el muestreo de savia pura líber de las plantas B. napus y el análisis de los complejos de la proteína de estas muestras de floema usando un acercamiento electroforético 3D combina BN-PAGE con Tris-Tricina-urea-PAGE y SDS-PAGE. Los componentes complejos de proteínas separadas se identifican posteriormente mediante espectrometría de masas. Además, presentamos el borrar norteño nativa azul como método permitiendo la detección de ARN grande de complejos RNP4, extender la aplicabilidad del enfoque.

Protocol

1. muestreo y preparación de la savia del floema de B. napus plantas 4,8,20

  1. Para savia del floema de muestreo, el uso bien regado de 8 semanas de edad que mostrar sólo inicio de floración para evitar contaminación de polen de plantas de B. napus .
  2. Utilice una aguja hipodérmica (Ø 0,8 mm) y el tallo de la inflorescencia punteado varias veces. La repetición en varios otros vástagos de la inflorescencia y en otras plantas para obtener suficiente savia del floema (Figura 2a).
    Nota: Para el análisis complejo, es aconsejable comenzar con al menos 600 μl de savia del floema. 4 a 5 plantas producirá entre 200 y 700 μl de savia del floema.
  3. Limpie la primera gota de los sitios lesionados con papel de filtro. Estas gotas contienen material altamente contaminado de tejido lesionado y deban descartarse principalmente.
  4. Recoger las gotas siguientes mediante pipeteo y almacenar el exudado recogido en un tubo de ensayo previamente enfriada cónico 1.5 mL a-20 ° C utilizando un sistema de refrigeración libre de hielo.
  5. Seguir recogiendo hasta que ninguna otra formación de gota es observable, pero no más de 1 h. Este procedimiento se puede repetir después de dos días sin pérdida significativa de la savia del floema recogidos.
    Nota: La savia del floema recogida puede ser utilizada inmediatamente o almacenada a-80 ° C para futuros análisis. Para el almacenamiento de-80 ° C, choque congelar el tubo de reacción en nitrógeno líquido.
  6. Concentrar la muestra de líber a aproximadamente 1/6th del volumen inicial con concentradores centrífugos de un peso molecular (MWCO) corte de 10.000 Daltons (Da). Centrifugar la muestra concentrada a 4 ° C y 20.000 x g durante al menos 15 minutos eliminar las partículas de polvo.
    Nota: Concentración de savia del floema no conduce a una importante pérdida de proteínas.
  7. Para posteriores análisis complejo, continúe con el paso 3.1.

2. control de pureza de sap floema usando transcriptasa reversa PCR (RT-PCR) 4,8,20

  1. Aislar el ARN total de la savia del floema usando un método estándar de extracción de RNA para material líquido (por ejemplo, extracción de TRIzol o fenol-cloroformo seguido por la precipitación del isopropanol de la fase acuosa y etanol lavado pasos según la Protocolo del fabricante).
    PRECAUCIÓN: El fenol cloroformo es tóxico. Trabajar bajo una campana de equipos de protección personal apropiado. El ARN extraído puede almacenarse en etanol a-80 ° C hasta por seis meses.
  2. Eliminar la contaminación del ADN de digestión con ADNasa I (1 u/μg) durante 45 min a 37 ° C e inactivar la enzima mediante la adición de EDTA a una concentración final de 5 mM e incubar la muestra a 75 º C durante 10 minutos.
  3. Para obtener el RNA puro, purificar y concentrar la muestra mediante un paso de purificación (por ejemplo usando RNA Kits de limpieza, según las instrucciones del fabricante).
  4. Realizar una transcriptasa reversa PCR (RT-PCR) para la síntesis de cDNA con un equipo de síntesis de cDNA utilizando 150 ng de ARN puro del protocolo descrito por el fabricante.
    Nota: El cDNA puede almacenarse a-20 ° C hasta su uso posterior.
  5. Utilice 5 μl de cDNA como plantilla para una reacción de polimerización en cadena estándar según lo especificado por el fabricante, para amplificar transcritos específicos de compartimiento y compruebe por electroforesis en gel de agarosa. Por ejemplo, usando las cartillas para la subunidad pequeña de rubisco, tiorredoxina h y la proteína de la cápsida de polen (Figura 1b, tabla 1) para confirmar la pureza de las muestras de líber.

3. azul nativa página 4,25,26,31

  1. Utilice ya sea por vertido geles gradiente nativos como se describe en otra parte27 o comercial Bis-Tris gradiente geles.
  2. Carga 20 a 30 μg de la muestra de proteína concentrada por pozo en el gel en por lo menos triplica.
  3. Correr el gel a 4 ° C y 150 V con cátodo azul oscuro buffer B y buffer ánodo (tabla 2) hasta que la muestra pasa 1/3rd del gel (ca. 20 a 30 min, figura 3a).
    Nota: Para borrar norteño, un carril único gel es suficiente, mientras que para el análisis de composición de página 3D y espectrometría de masas que se recomienda combinar la misma banda de diez carriles de gel para concentrar las proteínas menos abundantes.
  4. Hacer una pausa en el funcionamiento y cambio cátodo azul oscuro buffer B con cátodo azul luz buffer B/10 (tabla 2) y continuar la carrera. Acabado el gel al frente blue comienza a eluir del gel (ca. 120 y 180 min, figura 3a).
    Nota: El acabado azul gel nativo puede almacenarse a 4 ° C durante por lo menos una semana. Un almacenamiento prolongado puede llevar a difundir bandas y debe evitarse. Tampón azul oscuro B puede ser reutilizado.

4. opcional: Detección de ARN utilizando azul nativa norte Blot 4

  1. Cortar vendas distintas o usar el carril de todo gel del gel nativo azul y transferencia a una membrana de nylon por semi seco borrar a 3,5 mA/cm2 durante 60 min y marcan la frontera gel superior e inferior con un lápiz en la membrana (figura 4a).
  2. Después de secado, lavar la membrana con agua tratada con DEPC y secar entre dos papeles de filtro.
  3. Realiza UV-reticulación de la membrana blotted con 120.000 μj/cm2 (85 s si se usa el Crosslinker en Tabla de materiales).
  4. Pre-hibridar la membrana con 6 mL de tampón de hibridación (comercial o hecho a sí mismo) de 60 minutos a 68 ° C en un horno de hibridación (figura 4a).
  5. Agregar un adicional 1 mL de tampón de hibridación que contiene 4 μL de sondas biotiniladas 3' (100 nM).
  6. Incubar la membrana con la sonda durante la noche, mientras se enfría el horno de 68 ° C a 37 ° C.
  7. Lavar la membrana con tampón que contiene 2 SDS x SSC y 0.1%, durante 5 minutos a temperatura ambiente para eliminar las puntas de prueba limitados inespecífica.
    PRECAUCIÓN: SDS puede causar irritaciones. Use guantes y bata de laboratorio al trabajar con SDS y SDS soluciones.
  8. Realizar la detección de las sondas biotiniladas 3' en la membrana por ejemplo con un conjugado estreptavidina-HRP y el luminol como sustrato de peroxidasa (HRP) de rábano, dando por resultado una reacción quimioluminiscente sensible (figura 4a).

5. segunda dimensión: Tris-Tricina-urea página 4,28

  1. Impuestos especiales solo bandas del gel nativo azul. Combinar bandas de las muestras en carriles paralelos para lograr una mayor concentración de proteínas complejas (figura 5).
    Nota: Bandas suprimidos pueden almacenarse en tubos de reacción solo hasta su posterior uso a 4 ° C.
  2. Vierta un gel Tris-Tricina-urea de 12% (espesor de 1 mm, 6,8 cm x 8,6 cm (ancho x longitud)). Preparar el gel de separación (tabla 2), 10 mL de solución de gel una vierte entre dos placas de vidrio y recubrimiento con isopropanol. Retire el isopropanol al terminar la polimerización y transferir 4 mL de solución B (tabla 2) en gel para el gel de apilamiento en el gel e insertar que un 10 bien peine.
    PRECAUCIÓN: La acrilamida no polimerizada puede ser neurotóxica y TEMED es dañino si se inhala. Siempre use el equipo de protección personal y trabajar bajo una campana.
  3. Transferencia de las bandas de gel suprimido en un tubo de reacción de 1,5 mL y añadir 1 mL de 2 x solución tampón de muestras de la SDS para el equilibrado de las piezas de gel (figura 5, tabla 2).
    1. Incubar las muestras durante 10 minutos a temperatura ambiente, antes de la ebullición en un bloque de calefacción (95 ° C) o en el microondas e incubar las muestras a temperatura ambiente durante 15 minutos más.
    2. Apilar varias piezas de gel equilibrado que representa el mismo complejo en un solo gel bolsillo.
    3. Realizar la electroforesis con ánodo y cátodo funcionando búferes a 150 V durante 45 a 60 min y suprimir el carril del gel todo.
  4. Incubar el carril cortado por 20 min en tampón ácido (100 mM Tris, ácido acético de 100 mM) y equilibrar en 125 mM Tris-HCl, pH 6.8 por otro 20 min (figura 5).

6. tercera dimensión: 4,de SDS-PAGE32

  1. Vierta un 15% de SDS separación de gel según Laemmli32 (espesor: 1,5 mm, 6,8 cm x 8,6 cm (ancho x longitud)) (tabla 2) y agregar una capa delgada de un 4% arriba del gel de apilamiento.
    PRECAUCIÓN: TEMED, acrilamida y SDS son tóxicos y perjudiciales. Trabajar bajo una campana y usar equipos de protección personal.
  2. La transferencia del carril del gel equilibrado sobre el gel de la SDS y cubrir el gel con agarosa 0.5% (p/p) de 1 x SDS ejecuta buffer suplementado con un rastro de azul de bromofenol (figura 5).
  3. Hervir el SDS ejecuta buffer con agarosa en el microondas antes de cargar en el gel.
  4. Para el funcionamiento de un marcador de proteína para estimar los pesos moleculares de los componentes individuales, inserte un trozo de papel de filtro en un extremo del gel hasta que la agarosa solidificada o usar un peine especial que se utiliza normalmente para los geles IPG.
  5. Correr el gel a 150 V durante 60 minutos y mancha el gel con Coomassie coloidal, plata o cualquier otra tinción adecuada para el posterior análisis de espectrometría de masa.
  6. Analizar los puntos accesibles de proteína usando espectrometría de masa enfoques como desorción láser asistida por matriz/ionización tiempo de vuelo (MALDI-TOF) o espectrometría de masas LC-MS/MS.
    Nota: Recomendamos utilizar el Coomassie coloidal tinción como ya descrito33. En nuestras manos, incluso menos abundantes proteínas puede ser suficientemente manchado y permite un análisis de espectrometría de masa con calidad razonable.

Representative Results

Aquí presentamos un protocolo que permite el análisis de proteína: proteína así como de complejos de proteína: RNA en muestras de líber de Brassica napus. El flujo de trabajo se ilustra en la figura 1. Una ventaja importante de B. napus sobre otros organismos modelo es la posibilidad de toma de muestras relativamente fácil líber de pequeñas perforaciones en el tallo de la inflorescencia. Esto permite para obtener muestras de líber puro comparable grandes cantidades. Cuando se muestrea el líber, es siempre recomendable para verificar la contaminación, por ejemplo por RT-PCR8. Un resultado representativo obtenido de una muestra de puro líber se representa en la figura 2. Muestras de líber contaminado no deben mostrar una banda visible de tiorredoxina h, considerando que no hay señal para la rubisco y la proteína de la capa de polen debe aparecer. La subunidad pequeña de rubisco puede servir como un control en muestras de hojas, tallos de la inflorescencia o el polen. Tiorredoxina h debe ser detectable en todas las muestras, ya que su ARNm se ha encontrado en el floema de diferentes especies, mientras que la transcripción de proteínas de polen capa sólo debe ser visible en las muestras de yema floral. Contaminación puede ocurrir cuando se realiza muestreo de líber en totalmente las plantas con flores (proteína de la capa de polen) o cuando las primera gotas de floema perforaciones de muestreo no son descartadas correctamente (rubisco).

Antes de la página de la BN es obligatorio para concentrar la savia del floema. Con 20 a 30 μg de proteína por bien, por lo menos cuatro bandas de complejos de proteínas principales llegan a ser visibles después de BN-página de savia del floema B. napus , demasiado baja o demasiado altas concentraciones no permiten una clara separación de los complejos (figura 3). Se recomienda para varias bandas de gel que representa el mismo complejo en un solo bolsillo del gel segunda dimensión a la concentración de las proteínas de cada único complejo para el procesamiento descendente y posterior identificación espectrométrica de masa de la carga.

Para identificar los componentes individuales de complejos macromoleculares líber, combinado la página inicial de BN con una segunda dimensión Tris-Tricina-urea y una tercera dimensión SDS-PAGE para lograr una separación de solo proteínas. Aquí, puede observarse una separación con alta resolución debido a los comportamientos de migración diferentes de proteínas en geles de SDS-PAGE y urea. Por lo general, las proteínas pertenecientes a un complejo único será visibles como una línea diagonal en el gel. Proteínas por encima de esta línea tienen una mayor hidrofobicidad, mientras que las proteínas por debajo de la línea representan más hidrofílicos28 (figura 5, figura 6).

Para la caracterización de complejos de RNP, utilizamos una parte de un gel de BN-página para realizar BN el borrar norteño. Después de borrar de un carril entero sobre una membrana de nylon y reticulación por radiación UV, el RNA se puede visualizar utilizando sondas de RNA específicas tal como se ilustra en la figura 4. Aquí se demuestra que un tRNA específico sólo está presente en un complejo específico. Los componentes de proteína del complejo ARNt-enlace pueden investigarse más utilizando el enfoque de gel 3D descrito anteriormente. Análisis de espectrometría de masa demostraron que este complejo contiene principalmente ARNt ligasas lo que confirma la actividad vinculante tRNA frotando BN norte.

Figure 1
Figura 1: flujo del análisis de complejos de ribonucleoproteína de trabajo en la savia del floema de colza. Después de la toma de muestras y preparación de muestras, líber, BN-PAGE se realiza para separar complejos nativos. Tales geles BN-PAGE permiten el análisis paralelo de los ácidos nucleicos por BN borrar norteño y la identificación de los componentes de proteína de los complejos por espectrometría de masas. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: control de muestreo y la pureza de la savia del floema de B. napus. Después de pinchar el tallo de la inflorescencia de plantas de violación de semilla oleaginosa de 8-10 semanas de edad con una aguja hipodérmica estéril, exudado se recoge con una pipeta y transferir a un tubo de reacción helada (a) para confirmar la pureza de las muestras del floema que se realiza RT-PCR, amplificación de las transcripciones de tiorredoxina h, subunidad pequeña de rubisco y proteína de la cápsida del polen en las muestras de tejidos específicos (b) RT-PCR sin transcriptasa inversa se realizó como control (-). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Página de la BN. Representación esquemática de página nativa azul con muestras de concentrado líber de B. napus. (a) después de cargar el gel gradiente de proteínas con 15-20 μl de savia del floema concentrado, BN-PAGE se realiza con tampón de cátodo azul oscuro 1 x B a 150 V durante 20-30 min en una cámara fría. Luego el tampón es intercambiado contra tampón de luz cátodo azul x 1 B/10 y la página es terminada a 150 V de 120-180 min hasta el azul oscuro funcionamiento frontal se queda sin el gel. Los geles de BN-página Mostrar cuatro bandas distintas que representan cuatro diferentes complejos de alto peso molecular. (b) carga (c) demasiado poco o demasiado proteínas líber (d) reduce la visibilidad de los complejos individuales. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: borrar norteño BN. Representación esquemática de la BN norte Blot el método. un carril de la página de la BN es transferido a una membrana de nylon semi-secar frotando. Después de la reticulación UV y la hibridación, se incuba la membrana con sondas específicas de RNA (sonda aquí un metionina ARNt específico), que están biotinilados en el extremo 3' en un horno de hibridación durante la noche. Las puntas de prueba libres se eliminan lavando pasos y la detección del ARN se lleva a cabo por un conjugado estreptavidina-HRP y luminol. Usando este acercamiento, se observa que el complejo IV en la página de BN contiene metionina ARNt. (b) el gel de la tinción de Coomassie y el blot de tRNA se asemejan a dos carriles diferentes gel ejecutar en paralelo para evitar diferencias de migración. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Página 3D. Representación esquemática del enfoque 3D-página. Varias bandas desde el mismo complejo son suprimidos de un gel de BN-PAGE, incubados en tampón de carga y transferidos en un pozo de la segunda dimensión Tris-Tricina-urea-página. Después de la electroforesis, gel todo carriles son corte, lavados en tampón ácido ácido, equilibrados y coloca en un gel de SDS-PAGE de 15%. Después de la página de tercera dimensión, las proteínas separadas son Coomassie teñidas y analizadas por espectrometría de masas. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: resultados del representante después de 3D-página. Dentro de la primera dimensión BN-PAGE aparecieron varios complejos. Sus componentes de proteína podrían ser separados más de dos páginas de desnaturalización posterior, resultando en un patrón del punto diagonal. Haga clic aquí para ver una versión más grande de esta figura.

Punta de prueba Secuencia de
Tiorredoxina h
adelante: CTCAAGGCAGCCAAAGAATC
inversa: ATGGCCTGAACATCGAACTC
Cadena pequeña de la RubisCO
adelante: TTCACCGGCTTGAAGTCATC
inversa: CCGGGTACTCCTTCTTGCAT
Proteína de la capa de polen BRU77666
adelante: TCAGAACTGGAGCTTCAACG
inversa: TTCCTTAATGGCCTCAGTGG

Tabla 1: Primers utilizados para el control de pureza de muestras de líber. Para confirmar la pureza de muestras de líber cartillas específicas para la cadena pequeña de la rubisco, tiorredoxina h y proteína de la cápsida de polen pueden utilizarse para la amplificación del cDNA.

Buffers y soluciones Contenido Comentario
buffer de cátodo azul oscuro B mM 15 Bis-Tris de pH 7.0
50 mM tricino
0,02% (p/v) azul de Coomassie G250
receta está adaptada de Fiala et al 17
debe ajustar pH a 7.0
Buffer se puede hacer como un stock de 10 x
buffer de luz cátodo azul B/10 mM 15 Bis-Tris de pH 7.0
50 mM tricino
0.002% (p/v) azul de Coomassie G250
Tampón se puede preparar por dilución buffer cátodo B con tampón de cátodo sin Coomassie
buffer de ánodo
mM 50 Bis-Tris de pH 7.0
Buffer puede ser preparado como un 10 x solución
2 x solución tampón de muestras de la SDS
125 mM Tris-HCl de pH 6.8
4% SDS
20% glicerol
0.2 DTT M
azul de bromofenol 0,02% (p/v)
Tampón de transferencia búfer 1 x TBE
89 mM de Tris pH 7.6
ácido bórico 89 mM
2 mM EDTA
Almacenador intermediario TBE puede ser hecho y almacenado como existencias de 5 x o 10 x. Es importante agua desionizada libre de Rnasa.
2 x tampón SSC
300 mM de NaCl
pH de citrato 30 mM Na37.0
3 x gel buffer
3 M Tris
Ácido clorhídrico de 1 M
0.3% SDS

pH 8.45
receta adaptada de Schägger 19
Tris-Tricina gel solución A
Para 10 mL:
30% acrilamida-bisacrilamida (29: 1) 3,34 mL
Urea de 6 M
3 x gel tampón mL 3,34
glicerol al 70% 1,4 mL
Añadir ddH2O a 10 mL
10% APS 40 ΜL
ΜL DE TEMED 4
Peso 6 M Urea y añadir 3 x gel tampón, la solución de acrilamida-bisacrilamida y gycerol 70%. Calentar a 60 ° C en un baño de agua para solubilizar la urea. Añadir ddH2O 10 ml, 10% APS y TEMED por polimerización.
Tris-Tricina gel solución B
De 6 mL:
30% acrilamida-bisacrilamida (29: 1) 0,8 mL
Urea de 6 M
3 x gel tampón 1.5 mL
Añadir ddH2O a 6 mL
10% APS 45 ΜL
ΜL DE TEMED 4.5
Peso 6 M Urea y añadir 3 x gel tampón, solución de acrilamida-bisacrilamida. Calentar a 60 ° C en un baño de agua para solubilizar la urea. Añadir ddH2O 10 ml, 10% APS y TEMED por polimerización.
1 x buffer de corriente Tris-Tricina (ánodo)
100 mM Tris
22.5 mM HCl

pH 8,9
receta adaptada de Schägger 19
1 x buffer de corriente Tris-Tricina (cátodo)
100 mM Tris
100 mM tricino
SDS 1%


pH 8.25
receta adaptada de Schägger 19
Buffer ácido
100 mM Tris
100 mM ácido acético
4% gel apilamiento de SDS
De 2 mL:
ddH2O 1.4 mL
30% acrilamida-bisacrilamida (37.5:1) 0,33 mL
1 M Tris pH 6,8 0.25 mL
ΜL DE SDS 20% 10
10% APS 20 ΜL
ΜL DE TEMED 2
15% SDS gel separador
Para 10 mL:
ddH2O 2.3 mL
30% acrilamida-bisacrilamida (37.5:1) 5 mL
1.5 M Tris pH 8,8 2,5 mL
10% SDS 100 ΜL
10% APS 100 ΜL
ΜL DE TEMED 4
1 x buffer correr de SDS
25 mM Tris
glicina 192 mM
0.1% SDS
Solución de tinción de Coomassie
-(14-18)-hidrato del sulfato de aluminio de 5% (w/v)
10% (v/v) de etanol (96%)
2% (v/v) de ácido ortofosfórico (85%)
0.02% (w/v) G-250 azul brillante de Coomassie
 
Tampón de hibridación ultrasensible de ULTRAhyb Ambion, Life Technologies

Tabla 2: soluciones y recetas del almacenador intermediario. Lista de todos los buffers y soluciones necesarias para el análisis de la página de 3D.

Punto no. OBS MW [KD] Identificación Organismo La adhesión no. MW [KD] Puntuación de mascota
CIV_1 130 Proteína de la resistencia supuesta enfermedad At4g19050 B. napus CDX78917 131.1 110
CIV_2 130 Proteína de la resistencia supuesta enfermedad At4g19050 B. napus CDX78917 131.1 89
CIV_3 100 Shock de calor 70 kDa proteína 14-como B. napus XP_013748865 89,9 113
CIV_4 90 Factor 2 de elongación eucariotas
División celular control homólogo 48 proteína A
B. napus
B. napus
CDX90241
CDY41316.1
89.5
89.5
111
197
CIV_5 85 Proteína de choque térmico 90-2-como B. rapa XP_009132342 79.8 172
CIV_6 80 Treonina - Arnt Ligasa
Glicina - Arnt Ligasa
B. oleracea
B. napus
XP_013599115
CDY43195
81.5
80,8
110
88
CIV_7 70 La proteína 70 kDa del choque del calor
Lisina - Arnt Ligasa-como
B. oleracea
B. napus
XP_013685267
XP_013747530
67.8
69.9
230
150
CIV_8 65 Mirosinasa
Aspartato - Arnt Ligasa 2
Asparagina - Arnt Ligasa 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60,6
61.6
63.5
183
141
153
CIV_9 60 Mirosinasa B. napus ABQ42337 60,6 164
CIV_10 55 Adenosylhomocysteinase 2-como B. rapa XP_009135865 53.1 139
CIV_11 55 1-alfa del factor de elongación 1-como B. oleracea XP_013586115 51.9 161
CIV_12 50 Liasa de cistina CORI3-como B. napus XP_013653143 48.1 237
CIV_13 44 Liasa de cistina CORI3-como B. rapa XP_009108611 48.3 213
CIV_14 38 Fructosa bifosfato aldolasa B. rapa XP_009115993 38.4 226
CIV_15 45 Liasa de cistina CORI3-como B. rapa XP_009108611 48.3 219
CIV_16 45 Liasa de cistina CORI3 B. rapa CDY69765 46.9 209
CIV_17 38 Fructosa bifosfato aldolasa B. rapa XP_009115993 38.4 124
CIV_18 18 Peptidil-prolil cis-trans isomerasa CYP18-3-como B. napus XP_009101932 18.3 128
CIV_19 45 Liasa de cistina CORI3-como B. rapa XP_009108611 48.3 177

Tabla 3: identificar los componentes de proteína del complejo IV. Varias ligasas tRNA y otras proteínas se han encontrado dentro del complejo de unión del tRNA usando MALDI-TOF análisis espectrométrico de masas después de 3D-página.

Discussion

El floema es un compartimento de gran interés, ya que constituye la ruta de transporte más importantes de fotoasimilados y es también esencial para señalización de larga distancia entre plantas diferentes partes9,20,34, 35. Además de moléculas pequeñas, macromoléculas como las proteínas y RNAs se han implicado con líber mantenimiento y señalización de4,7,8. El análisis de composición de líber está restringido por la limitada accesibilidad a muestras de floema en la mayoría de especies vegetales. La técnica del estilete insectos es ampliamente aplicable, pero experimentalmente exigente y los resultados en cantidades muy pequeñas de líber muestras11. Una técnica fácil, utilizada para el muestreo de líber es facilitado por EDTA exudación12. EDTA quelatos de iones divalentes como el calcio y así evita el cierre de las placas de tamiz por P-proteínas y Callosa. Es fácil de usar, pero es propenso a la contaminación por células dañadas y se diluyen las muestras. Agotamiento de iones divalentes con EDTA también podría llevar a una ruptura de los complejos existentes. Sin embargo, permite la toma de muestras de una gran variedad de especies incluyendo la planta modelo thaliana a.15. Exudación espontánea de savia del floema ocurre solamente en un pequeño número de especies de plantas. Es un método invasivo que consiste en lesiones importantes de tejidos de planta10. Recientemente establecimos B. napus como una especie de modelo para el estudio de transporte a larga distancia4,8,20. Aquí, savia del floema puede ser muestreado de pequeñas incisiones, que reduce la herida efectos y fuentes de contaminación.

Utilizando técnicas de muestreo diferentes, el proteoma de las muestras de líber de diferentes especies de plantas se ha investigado en los últimos años7,8,17,36,37, 38,39. Para estos estudios del proteoma, proteínas fueron extraídas y precipitadas bajo desnaturalizar condiciones y por lo tanto no permiten conclusiones sobre: proteína y proteína: interacciones de ácidos nucleicos presentan en condiciones nativas. Análisis de superposición y co-inmunoprecipitación (CoIP) indicaron que podría existir un importante complejo de ribonucleoproteína en la savia del floema de calabaza40, pero no se demostró que cualquier complejos macromoleculares existen bajo condiciones nativas dentro de la sistema de líber.

Azul página nativa, introducida por Schägger et al. 26, en combinación con pasos de electroforesis en gel de alta resolución posterior permiten la separación de los componentes de los complejos grandes. Usando análisis de la página de 3D de nativa B. napus exudado de líber, recientemente podríamos demostrar que varias proteínas: proteína de alto peso molecular y los complejos de RNP existen en muestras de líber y son enzimáticamente activa4. Métodos alternativos para aislar los complejos así como RNPs como cromatografía por exclusión de tamaño podrían existir, pero no en términos de resolución en comparación a la página de la BN. Además, una razonable calidad de separación complejo, matrices de columna de exclusión de tamaño debe ser adaptado según los pesos moleculares en general complejos siendo investigados. Análisis complejos de diferente tamaño por lo tanto exigirá diferentes tipos de columnas que es costo intensivo y no permite como enfoque de alta potencia como una página de BN.

Pasos críticos para analizar complejos de B. napus incluyen el total de la savia del floema utilizado como material de partida. Al menos 600 μl de la muestra del floema son necesarios y pueden obtenerse en cinco plantas bien irrigadas. Para 3D-PAGE y BN el borrar norteño es necesario poner el gel BN inicial con una cantidad suficiente de muestras de líber. Para ello, muestras de líber se concentran hasta 20 a 30 μg de proteína se pueden cargar en cada bien y por lo menos triplicado de la misma muestra se ejecuta en paralelo. Concentración demasiado baja o demasiado alta reduce la detección de complejos (figura 3). Líber muestras deben recogerse en tubos de reacción sobre hielo y deben almacenarse congelado para que su uso posterior evitar la rotación y la degradación de las proteínas. Inhibidores de la proteasa se han encontrado en los proteomas de líber analizados, pero también un proteasoma activo fue descrito en el floema de B. napus4. Además, volumen y composición de las muestras de líber dependen del momento de muestreo y condiciones ambientales10. Por lo tanto se debe tener cuidado para recoger al mismo tiempo del día en condiciones similares. Tratamientos de estrés (por ejemplo sequía) pueden reducir la cantidad de floema que se puede recoger. Para identificar las proteínas solo por espectrometría de masas, es obligatorio para limitar la contaminación posible de la queratina por usando guantes todo el tiempo. La queratina conduce a señales adicionales durante masa especificaciones análisis y dificulta la identificación de proteínas. Ejecutando la página BN a un voltaje mayor o a temperatura ambiente puede conducir a la calefacción del gel que pueda resultar en desmontaje de frágiles complejos.

El protocolo presentado aquí es conveniente para el análisis de complejos de proteína: proteína. También mostramos que pueden utilizarse para detectar ARN específica contenida en los complejos en paralelo. Para lograr esto, hemos introducido recientemente un protocolo para BN norte borrar4. RNAs son propensos a la degradación por contaminación de Rnasa. Para limitar esa degradación tratada con DEPC, debe utilizarse agua.

Principales limitaciones del método presentado incluyen la estimación del peso molecular de complejos de proteínas separadas por BN-PAGE, ya que el comportamiento de migración depende en el tamaño, forma e incluso modificaciones del posttranslational de los complejos31, 41. Estimación de tamaño de los complejos de RNP es aún más complicado debido a la influencia de los ácidos nucleicos en el comportamiento de la migración. Se puede también no ser prevenido que complejos del mismo tamaño migran conjuntamente en una sola banda. Esto puede conducir a la predicción errónea de composiciones complejas. Por lo tanto verificar las interacciones observadas con técnicas complementarias, por ejemplo, por análisis funcional4, puede ser necesario. También proteínas sólo débil o transitorio asociadas a un complejo macromolecular podrían ser perdidas en el búfer BN utilizado. Para evitar esto, las muestras pueden ser reticulado, lo que puede conducir también a artefactos o puede evitar la identificación de proteínas, o las condiciones de buffer pueden ser optimizadas.

En contraste con clásico 2D-PAGE, la combinación de urea y SDS-PAGE permite la separación según la hidrofobicidad y del peso molecular en vez de punto isoeléctrico (pI) y peso molecular 28y no limitar la separación de proteínas de un gama específica de pI. Similar al clásico 2D-PAGE, separadas proteínas son visibles como puntos individuales, pero en una diagonal línea 4,28 (figura 5, figura 6). Más proteínas hidrofóbicas aparecen en lugares por encima de esta diagonal, mientras más proteínas hidrofílicas se encuentran por debajo de la línea28. Las concentraciones de poliacrilamida utilizadas en este protocolo también separarán proteínas entre 25 y 80 kDa. Para permitir una separación de las proteínas más pequeñas o más grandes la poliacrilamida se puede variar la concentración o geles de gradiente se pueden utilizar en la tercera dimensión. Los componentes del complejo IV (figura 3) separados por 3D-PAGE (figura 6) fueron cortados, tripsina digiere y analizados por espectrometría de masas. Esto dio lugar a la identificación de varias ligasas de tRNA. Los componentes de los otros complejos han sido publicados recientemente 4. Nuestra página de 3D permitió la separación de ligasas diferentes, es decir, aspartato, Asparagina, treonina, ligasas lisina y glicina, con pesos moleculares similares (tabla 3). Utilizando una sonda de metionina ARNt específico, fueron capaces de detectar tRNA potencialmente consolidados dentro de complejo IV pero si tRNA completos o fragmentos de tRNA en el complejo no pueden ser discriminados con las sondas. Para comprobar si los ácidos nucleicos son realmente consolidados dentro del complejo y no Co migrar, proteasa digirió savia del floema podrían servir de muestras controles migratorios adecuados.

Se ha especulado antes que traducción de la proteína puede ocurrir dentro de tubos de tamiz del floema, ya que la casi mayoría de los componentes del ribosoma entero así como los factores de elongación se han encontrado en muestras de líber4,7. Nuestro hallazgo de tRNA y ligasas tRNA parece apoyar esta idea. Sin embargo, fragmentos de ARNt presentes en muestras de líber de calabaza han demostrado ser potentes inhibidores de la traducción en42 y los ribosomas funcionales parecen ser ausente4, lo que sugiere que la traducción no puede ocurrir.

Tomados en conjunto, el protocolo que presentamos permite la separación de proteínas: proteína nativa y hasta complejos de RNP de líber de muestras y la separación e identificación de sus componentes individuales de alta resolución. La aplicación de este método permite el descubrimiento de nuevas proteínas y complejos de RNP en muestras de floema y por lo tanto puede dilucidar nuevas funciones en este compartimiento de plantas altamente especializadas.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a Jennifer Deke y Urszula Zarzenska por su apoyo científico. Este trabajo fue apoyado por una beca de integración de carrera (CIG, 0734 PCIG14-GA-2013-63) la Comisión Europea dentro del 7 º Programa marco, la concesión LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg) y la concesión de la DFG (DFG KE 856_6-1) adjudicado a JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics