Phloem Sap utvalg fra Brassica napus for 3D-side av Protein og Ribonucleoprotein komplekser

Biology
 

Summary

Her presenterer vi en protokoll for å analysere protein sammensetningen av store innfødt protein: protein og protein: nukleinsyre komplekser fra oljevekster voldtekt (B. napus) phloem sårvæske ved hjelp av en 3D polyakrylamid gel geleelektroforese (side) tilnærming kombinere blå Opprinnelig (BN) med to denaturing sider etterfulgt av masse spectrometric identifikasjon.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Pahlow, S., Ostendorp, A., Krüßel, L., Kehr, J. Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes. J. Vis. Exp. (131), e57097, doi:10.3791/57097 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Prøvetaking av phloem for høyere planter er ofte arbeidskrevende og betydelig avhengig av plantearter. Imidlertid kan proteom studier under denaturing forhold oppnås i forskjellige plantearter. Native protein: protein og protein: nukleinsyre komplekser fra phloem prøver ennå knapt er analysert, selv om de kan spille en viktig rolle i opprettholdelsen av denne spesialiserte kupé eller langdistanse signalering. Store molekylær samlinger kan isoleres ved hjelp av en blå innfødt gel geleelektroforese (BN-side). Deres protein komponenter kan skilles med en påfølgende natrium dodecyl sulfate (SDS-side). Imidlertid overføre proteiner med lignende molekylvekt co, hva kan hindre protein identifikasjon av massespektrometri. Kombinere BN-side med to forskjellige denaturing gel geleelektroforese trinn, nemlig Tris-Tricine-urea og SDS-side, muliggjør ytterligere separasjon av proteiner i henhold til deres hydrophilicity/hydrophobicity og dermed øker oppløsning og suksess protein identifikasjon. Det kan skille proteiner som bare avviker i deres posttranslational modifikasjoner. I tillegg kan blå innfødt Nord blotting brukes for å identifisere RNA komponenter i macromolecular komplekser. Vi viser at våre protokollen er egnet til å rakne protein og RNA komponenter av innfødte protein: protein og ribonucleoprotein (RNP) komplekser forekommer i phloem prøver. Kombinere en blå Opprinnelig side med to forskjellige denaturing siden trinn kan hjelpe skille ulike typer store protein komplekser, og kan også en økt identifisering rente for sine komponenter av massespektrometri. Videre er protokollen robuste nok til å samtidig oppdage potensielt bundet nukleinsyrer innen enkelt protein komplekser.

Introduction

The langdistanse rør av phloem er avgjørende for tildeling av organisk næringsstoffer i høyere planter, men er også involvert i å regulere forskjellige prosessene viktig for vekst og utvikling, patogen defense og tilpasningen til uønskede miljøforhold. Foruten liten effektor som ioner, phyto-hormoner eller metabolitter seg, makromolekyler som proteiner og RNAs har nylig dukket opp som potensielle signaler.

Studier har vist at phloem lasting av proteiner er avhengige og kontrollert av exclusion størrelsesgrensen (SEL) av pore-plasmodesmal koble følgesvenn celler (CC) og sil elementer (SE) som er vanligvis mellom 10 til > 67 kDa1 , 2 , 3. men til tross for disse størrelse begrensninger større proteiner og protein komplekser er funnet innenfor phloem systemet utfordrende ideen om størrelse utelukkelse4, og selv uspesifikke tap av proteiner fra kopi se har vært foreslått5 .

Multiprotein samt store ribonucleoprotein komplekser spille viktige roller i biosyntesen og opprettholde den strukturelle integriteten av cellen6. Det er bevis for at phloem-mobile protein-protein og ribonucleoprotein komplekser finnes4,7, hittil lite om deres funksjon er kjent. Phloem sil elementer har protein: protein og RNP komplekser vært innblandet med langdistanse transport og / eller signalnettverk8,9. Er nødvendig for å rakne funksjoner translocated komplekser, studere deres sammensetning under varierende miljømessige eller stress forhold. For å oppnå dette, innfødt komplekser må isoleres og deres komponenter må skilles med høy nok oppløsning.

For å isolere høy-molekylvekt komplekser fra phloem, er det først nødvendig for å få sap eksempler i tilstrekkelig kvalitet og kvantitet. Teknikken som benyttes for phloem prøvetaking avhenger av plantearter rundt. Tre hovedmetoder for å få phloem sap finnes 10: insekt stylectomy11, EDTA-tilrettelagt exudation12og spontan exudation13.

Phloem prøver fra Arabidopsis thaliana (A. thaliana), store modellen anlegget i laboratorier over hele verden, kan bare hentes av EDTA-tilrettelagt exudation eller bladlus stylectomy14,15. Begge metodene føre til svært fortynnede phloem sap eller svært lav eksempel beløp. EDTA-tilrettelagt exudation er også utsatt for forurensning og kanskje ikke representerer virkelige phloem sammensetning16. Spontan phloem exudation er begrenset til plantearter som cucurbits, lupine eller yucca, der kutte av plantedeler fører til en spontan utslipp av phloem sap som kan enkelt samlet13,17,18, 19. Vi har nylig etablert oljevekster voldtekt (Brassica napus) som en egnet modellsystem for phloem analyse, siden det er en nær slektning av A. thaliana og flere microliters av phloem sap kan fås fra små incisions som har vist seg å være høy renhetsgrad4,8,20. Videre ble B. napus Genova orden utgitt i 201421.

Bortsett fra bladlus stylectomy, alle phloem samling metoder beskrevet inkluderer skade av omkringliggende vev på stedet av prøvetaking og sammensetningen av phloem sap kan endre svar på skader. Derfor er det viktig å sjekke kvaliteten på phloem prøver, uavhengig av sampling metoden brukes. Det finnes ulike metoder for kvalitetskontroll av samlet phloem sap, f.eks ved fastsettelse av RNase aktivitet22,23, RT PCR med primere mot Rubisco8,24eller analyse av sukker sammensetning8.

Forskjellige metoder for å isolere og separate protein komplekser kan brukes, inkludert størrelse utelukkelse Ture, sukrose tetthet ultracentrifugation eller prøve filtrering gjennom membraner med forskjellige molekylvekt kuttet offs. Disse metodene tillater imidlertid ikke høy oppløsning. Teknikken kalles blå Opprinnelig side (BN-side), først beskrevet av Schägger et al. 25, er overordnet i oppløsning. Det ble brukt til å bestemme molekylvekt av store innfødt protein komplekser fra ulike organeller eller cellular lysates og deres relative antall26,27.

For å ytterligere belyse komplekse sammensetningen av protein komplekser, er det nødvendig å skille de enkelte komponentene under denaturing forhold, fører til fullstendig demontering av komplekse komponenter. Dette kan oppnås ved en andre dimensjonen SDS side 28,29 eller for å oppnå høyere oppløsning, med en andre dimensjon av isoelectric fokus (IEF) etterfulgt av en third dimension av SDS side30 og påfølgende identifikasjon av proteiner med massespektrometri.

I denne protokollen beskriver vi prøvetaking av ren phloem sap fra B. napus planter og analyse av protein komplekser fra slike phloem prøver med en 3D electrophoretic tilnærming kombinere BN-side med Tris-Tricine-urea-side og SDS-side. Atskilt protein komplekse komponenter identifiseres senere av massespektrometri. Dessuten, introdusere vi blå innfødt Nord blotting som tillater påvisning av RNAs i store RNP komplekser4, utvide anvendelsesområdene av tilnærming.

Protocol

1. prøvetaking og forberedelse av phloem sap fra B. napus planter 4,8,20

  1. Phloem sap prøvetaking, bruke fuktig 8-uke-gamle B. napus planter som Vis bare første blomstrende for å hindre pollen forurensing.
  2. Bruk en sprøyte nål (Ø 0,8 mm) og vises punctate sitter stammen flere ganger. Gjenta på flere andre sitter stammer og andre planter vil ha nok phloem sap (figur 2a).
    Merk: For analyse, er det anbefalt å starte med minst 600 µL av phloem sap. 4 til 5 planter vil gi mellom 200 og 700 µL av phloem sap.
  3. Tørk av i første slipp fra skadde områder med filter papir. Disse dråper hovedsakelig inneholder svært forurenset materiale fra omkringliggende skadet vev og må forkastes.
  4. Samle følgende dråper av pipettering og lagre den innsamlede sårvæske i et pre kjølt konisk 1,5 mL reaksjon rør på 20 ° C med en isfri kjølesystemet.
  5. Fortsett å samle til ingen ytterligere slipp formasjon er observerbare, men ikke lenger enn 1t. Denne fremgangsmåten kan gjentas etter to dager uten betydelige tap av samlet phloem sap.
    Merk: Samlet phloem sap kan brukes umiddelbart eller lagret ved-80 ° C i fremtidige analyser. For-80 ° C lagring, sjokk frostvæske reaksjon røret i flytende nitrogen.
  6. Konsentrere seg phloem prøven til ca 1/6th av første centrifugal konsentratorer med en molekylvekt kuttet (MWCO) av 10.000 Daltons (Da). Sentrifuge konsentrert prøven på 4 ° C og 20.000 x g i minst 15 min fjerne støvpartikler.
    Merk: Phloem sap konsentrasjon ikke føre til betydelig tap av proteiner.
  7. For påfølgende analyse, fortsetter du med trinn 3.1.

2. phloem sap renhet kontroll med revers transkriptase PCR (RT-PCR) 4,8,20

  1. Isolere totale RNA fra phloem sap bruker en RNA utvinning standardmetode for flytende materiale (f.eks TRIzol eller fenol-kloroform utvinning etterfulgt av isopropanol nedbør fra vandige fasen og etanol vaske trinnene i henhold til den produsentens protocol).
    Forsiktig: Fenol-kloroform er giftig. Arbeid under hette med riktig personlig verneutstyr. Den utpakkede RNA kan lagres i etanol ved-80 ° C i opp til seks måneder.
  2. Fjerne forurensning av DNA av fordøyelse med DNase jeg (1 u/µg) for 45 min ved 37 ° C og deaktivere enzymet legger til EDTA i en siste konsentrasjon av 5 mM og ruge prøven ved 75 ° C i 10 min.
  3. For å få ren RNA, rense og konsentrere prøven for en annen rensing trinn (f.eks ved hjelp av RNA opprydding Kits, i henhold til produsentens instruksjoner).
  4. Utføre en revers transkriptase PCR (RT-PCR) for syntese av cDNA med en cDNA syntese kit med 150 ng av ren som beskrevet av produsenten er protokollen.
    Merk: CDNA kan lagres på 20 ° C til fremme bruk.
  5. Bruke 5 µL av cDNA som en mal for en standard PCR reaksjon som er angitt av produsenten, forsterke rom-spesifikke utskrifter og sjekk av agarose gel geleelektroforese. Bekreft renheten av phloem prøver med f.eks primere for rubisco liten delenhet, thioredoxin h og pollen pels protein (figur 1b, tabell 1).

3. blå Opprinnelig side 4,25,26,31

  1. Bruk enten selv helte innfødt gradient gels som beskrevet andre steder27 eller kommersielle Bis-Tris gradient gels.
  2. Last 20 til 30 µg av konsentrert protein utvalget per brønn på gel i minst triplicates.
  3. Kjøre gel på 4 ° C og 150 V med mørk blå katoden buffer B og anode buffer (tabell 2) til prøven bestått 1/3rd av gel (ca. 20 til 30 min, figur 3a).
    Merk: For Nord blotting, en enkelt gel lane er tilstrekkelig, mens for analyse av protein sammensetning av 3D side og massespektrometri anbefales det å kombinere samme band fra opptil ti gel baner å konsentrere mindre rikelig proteiner.
  4. Pause kjøre og exchange mørk blå katoden buffer B med lys blå katoden buffer B/10 (tabell 2) og Fortsett. Fullføre gel når blå foran begynner å elute av gel (ca. 120-180 min, figur 3a).
    Merk: Ferdig blå innfødt gel kan lagres på 4 ° C i minst en uke. Langvarig lagring kan føre til diffus band og bør unngås. Mørk blå buffer B kan gjenbrukes.

4. alternativ: Påvisning av RNA bruker blå innfødt Nord blotting 4

  1. Kuttet ut forskjellige band eller bruke hele gel kjørefelt fra blå innfødt gel og overføre dem på en nylon membran av semi tørr blotting på 3,5 mA/cm2 for 60 min og merke øvre og nedre gel grensen med en blyant på membranen (figur 4a).
  2. Etter blotting, vask membranen med DEPC-behandlet vann og tørke mellom to filter papir.
  3. Utføre UV-crosslinking av blotted membranen med 120.000 µJ/cm2 (85 s Hvis bruker Crosslinker i Tabellen for materiale).
  4. Pre hybridize membranen med 6 mL av hybridisering buffer (kommersielle eller selv-laget) for 60 min på 68 ° C i hybridisering ovn (figur 4a).
  5. Legge til en ekstra 1 mL av hybridisering bufferen som inneholder 4 µL av 3-biotinylated sonder (100 nM).
  6. Inkuber membranen med sonde over natten, mens nedkjøling ovnen fra 68 ° C til 37 ° C.
  7. Vask membranen med buffer med 2 x SSC og 0,1% SDS, i 5 minutter ved romtemperatur å fjerne sonder bundet uspesifikt.
    Forsiktig: SDS kan forårsake irritasjon. Bruke hansker og Laboratoriefrakk når du arbeider med SDS og SDS inneholder løsninger.
  8. Utføre påvisning av 3-biotinylated sonder på membran f.eks Streptavidin-HRP-konjugert og luminol som en pepperrot peroxidase (HRP) underlaget, noe som resulterer i en følsom chemiluminescent reaksjon (figur 4a).

5. second dimensjon: Tris-Tricine-urea side 4,28

  1. Avgiftsdirektoratet enkelt band fra blå innfødt gel. Kombinere band fra prøvene kjøres i parallell baner å oppnå en ytterligere konsentrasjon av (figur 5).
    Merk: Forbrukeravgift band kan lagres i én reaksjon rør til fremme bruk på 4 ° C.
  2. Hell en 12% Tris-Tricine-urea gel (tykkelsen på 1 mm, 6.8 cm x 8,6 cm (bredde x lengde)). Forberede 10 mL av gel løsning A skiller gel (tabell 2), hell mellom to glass og tallerkener og overlegg med isopropanol. Fjern isopropanol etter polymerisasjon er ferdig og overføre 4 mL av gel løsning B (tabell 2) for stabling gel på gel og sett inn en 10 godt gre.
    Forsiktig: Unpolymerized akrylamid kan være neurotoxic og TEMED er skadelig ved innånding. Alltid bruke personlig verneutstyr og arbeid under en hette.
  3. Overføre forbrukeravgift gel bandene til en 1,5 mL reaksjon rør og legge 1 mL av 2 x SDS eksempel bufferen for balanse av gel brikkene (figur 5, tabell 2).
    1. Inkuber prøvene i 10 min i romtemperatur, før koking i en oppvarming blokk (95 ° C) eller i en mikrobølgeovn og ruge prøvene igjen ved romtemperatur for ytterligere 15 min.
    2. Stable flere equilibrated gel brikker som representerer samme kompleks i én enkelt gel lomme.
    3. Utføre geleelektroforese med anoden og katoden kjører buffere på 150 V i 45 til 60 min og avgiftsdirektoratet hele gel kjørefelt.
  4. Inkuber kuttet kjørefelt for 20 min i surt buffer (100 mM Tris, 100 mM eddiksyre) og equilibrate i 125 mM Tris-HCl, pH 6.8 for en annen 20 min (figur 5).

6. tredje dimensjon: SDS-side 4,32

  1. Hell en 15% SDS skille gel ifølge Laemmli32 (tykkelse: 1,5 mm, 6.8 cm x 8,6 cm (bredde x lengde)) (tabell 2) og Legg et tynt lag med en 4% stabling gel ovenfor.
    Advarsel: SDS, akrylamid og TEMED er toksisk og skadelig. Arbeid under hette og bruke personlig verneutstyr.
  2. Overføre equilibrated gel kjørefelt på SDS gel og dekke gel med 0,5% (w/w) agarose i 1 x SDS kjører buffer med spor av bromophenol blå (figur 5).
  3. Kok SDS kjører buffer med agarose i mikrobølgeovn før lasting på gel.
  4. For å kjøre en protein markør for å beregne molekylvekt enkelt komponentene, sett filter papir i den ene enden av gel til agarose befestet eller bruke en spesiell kam brukes vanligvis for IPG gels.
  5. Kjøre gel på 150 V for 60 min og flekken flekker gel med enten kolloidalt Coomassie, sølv flekken eller andre metoden passer for påfølgende masse spectrometric analyse.
  6. Analysere synlig protein flekker med masse spectrometric tilnærminger som matrix-assistert laser desorpsjon/ionisering tid-av-fly (MALDI-TOF) eller LC--MS-/ MS massespektrometri.
    Merk: Vi anbefaler for å bruke den kolloidalt Coomassie flekker som allerede beskrevet33. I våre hender, enda mindre rikelig proteiner kan være tilstrekkelig farget og tillater en masse spectrometric analyse med rimelig kvalitet.

Representative Results

Her presenterer vi en protokoll som tillater analyse av protein: protein og protein: RNA blant phloem prøver fra Brassica napus. Arbeidsflyten er illustrert i figur 1. En stor fordel av B. napus over andre modellen organismer er muligheten for relativt lett phloem prøvetaking fra små punkteringer i sitter stilken. Kan få ren phloem prøver i relativt store mengder. Når prøvetaking phloem, er det alltid tilrådelig å kontrollere forurensing, for eksempel ved RT PCR8. En representant resultatet fra en ren phloem prøve er avbildet i figur 2. Non-forurenset phloem prøver skal vise et synlig band for thioredoxin h, mens noe signal for rubisco og pollen pels proteinet skal vises. Rubisco liten delenhet kan tjene som en kontroll i prøver fra blader, sitter stammer eller pollen. Thioredoxin h skal være synlig i alle prøvene, siden dens mRNA har blitt funnet i phloem av ulike arter, mens pollen pels protein transkripsjon skal bare vises i blomst knopp prøver. Forurensing kan oppstå når phloem prøvetaking er utført på fullt blomstrende planter (pollen pels protein), eller når de første dråpene fra phloem prøvetaking punkteringer ikke forkastes riktig (rubisco).

Før BN-siden er det obligatorisk å konsentrere phloem sap. Bruker 20 til 30 µg protein Vel, minst fire store protein kompleks band blir synlige når BN side av B. napus phloem sap, for lav eller for høy konsentrasjoner tillater ikke et klart skille mellom komplekser (Figur 3). Det anbefales å laste flere gel band som representerer samme kompleks i én enkelt lomme i andre dimensjon gel å ytterligere konsentrere proteiner fra hver enkelt gjennomsnittskompleks for nedstrøms behandling og påfølgende masse spectrometric identifikasjon.

For å identifisere de individuelle komponentene i phloem macromolecular komplekser, vi kombinert BN-startsiden med andre dimensjon Tris-Tricine-urea og en tredje dimensjon SDS-side for å oppnå en separasjon av enkelt proteiner. Her kan en separasjon med høy oppløsning observeres på grunn av det annet protein migrasjon opptreden i urea og SDS side gels. Vanligvis vises proteiner som hører til en enkelt som en diagonal linje over gel. Proteiner over denne linjen har en økt hydrophobicity, mens proteiner under linjen representerer mer hydrofile seg28 (figur 5, figur 6).

For karakterisering av RNP komplekser brukte vi en del av en BN side gel for å utføre BN Nord blotting. Etter blotting av en hele kjørefelt på en nylon membran og crosslinking av UV stråling, kan RNA visualiseres ved hjelp av RNA-spesifikke sonder som vist i Figur 4. Her er det vist at en bestemt tRNA finnes bare i ett bestemt kompleks. Protein komponentene i tRNA-binding komplekset kan undersøkes ytterligere ved hjelp av 3D gel tilnærming som beskrevet ovenfor. Masse spectrometric analyser viste at dette komplekset inneholder hovedsakelig tRNA-ligases hva bekrefter tRNA binding aktiviteten ved BN Nord blotting.

Figure 1
Figur 1: flyten av analyse av ribonucleoprotein komplekser innarbeide phloem saft av oljevekster voldtekt. Etter prøvetaking og forberedelse av phloem prøver utføres BN-side for å skille innfødt komplekser. Slike BN side gels Tillat parallell analyse av nukleinsyrer ved BN Nord blotting og identifikasjon av protein komponentene i komplekser av massespektrometri. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: prøvetaking og renhet kontroll over phloem saft av B. napus. Etter punktering sitter stilken 8-10 uke gamle oljevekster voldtekt planter med en steril sprøyte nål, sårvæske samles med en pipette og overført til en iskald reaksjon tube (a) å bekrefte renheten av de phloem prøvene RT PCR er utført, forsterke utskrifter av thioredoxin h, rubisco liten delenhet og pollen pels protein i vev-spesifikke prøver (b) RT PCR uten revers transkriptase ble utført som kontroll (-). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: BN-side. Skjematisk fremstilling av blå Opprinnelig side med konsentrert phloem prøver av B. napus. (a) etter lasting gradient protein gel med 15-20 µL av konsentrert phloem sap, utføres BN-side med 1 x mørk blå katoden buffer B på 150 V i 20-30 minutter en kald rommet. Deretter bufferen utveksles mot 1 x lys blå katoden buffer B/10 og siden er ferdig på 150 V til 120-180 minutter før mørkeblått kjører foran går tom gel. BN side geléer viser fire forskjellige band som representerer fire forskjellige høy-molekylvekt komplekser. (b) lasting for lite (c) eller for mye (d) phloem proteiner reduserer synligheten av personlige komplekser. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: BN Nord blotting. Skjematisk fremstilling av BN Nord blotting metoden. (a) en kjørefelt av BN-side overføres på en nylon membran av semi-tørr blotting. Etter UV-crosslinking og pre hybridisering, er membranen ruges med RNA bestemt sonder (her en metionin tRNA-spesifikke sonde), som er biotinylated på 3-slutten i hybridisering ovn over natten. Gratis sonder fjernes ved å vaske trinnene og oppdagelsen av den er utført av en streptavidin-HRP-konjugert og luminol. Bruker denne tilnærmingen, observerte vi at komplekse IV BN-siden inneholder metionin tRNA. (b) Coomassie farget gel og tRNA blot ligner to forskjellige gel baner kjøre parallelt for å unngå overføring forskjeller. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: 3D-siders. Skjematisk fremstilling av 3D-side tilnærming. Flere band fra samme kompleks er forbrukeravgift fra en BN side gel, ruges i lasting buffer og overført til en brønn i den andre dimensjonen Tris-Tricine-urea-side. Etter geleelektroforese, er hele gel baner kuttet ut vasket i surt syre buffer, equilibrated og plassert på en 15% SDS side gel. Etter den tredje dimensjonen side er atskilt proteiner Coomassie farget og analyseres av massespektrometri. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: representant resultater etter 3D-siders. I den første dimensjonen BN siden dukket opp flere komplekser. Deres protein komponenter kan skilles ytterligere med to etterfølgende denaturing sider, noe som resulterer i en flekk skrå. Klikk her for å se en større versjon av dette tallet.

Sonde Sekvens
Thioredoxin h
frem: CTCAAGGCAGCCAAAGAATC
omvendt: ATGGCCTGAACATCGAACTC
Rubisco liten kjede
frem: TTCACCGGCTTGAAGTCATC
omvendt: CCGGGTACTCCTTCTTGCAT
Pollen pels protein BRU77666
frem: TCAGAACTGGAGCTTCAACG
omvendt: TTCCTTAATGGCCTCAGTGG

Tabell 1: primere brukt for phloem prøve renhet kontroll. For å bekrefte phloem eksempel renhet kan primere spesifikke for rubisco små kjeden, thioredoxin h og pollen pels protein brukes til cDNA forsterkning.

Buffere og løsninger Innhold Kommentar
mørk blå katoden buffer B 15 mM Bis-Tris pH 7.0
50 mM Tricine
0.02% (w/v) Coomassie blå G250
oppskriften er tilpasset fra Fiala et al. 17
pH skal justeres til 7.0
Bufferen kan gjøres som en 10 x lager
lys blå katoden buffer B/10 15 mM Bis-Tris pH 7.0
50 mM Tricine
0,002% (w/v) Coomassie blå G250
Bufferen kan tilberedes ved å fortynne katoden buffer B med katoden buffer uten Coomassie
anode buffer
50 mM Bis-Tris pH 7.0
Bufferen kan tilberedes som en 10 x lagerløsning
2 x SDS eksempel buffer
125 mM Tris-HCl pH 6.8
4% SDS
20% glyserol
0,2 M DTT
0.02% (w/v) bromophenol blå
Overføre buffer 1 x TBE buffer
89 mM Tris pH 7.6
89 mM borsyre
2 mM EDTA
TBE bufferen kan gjort og lagret som aksjer 5 x eller 10 x. Det er viktig å bruke RNase-fri vaskebuffer vann.
2 x SSC buffer
300 mM NaCl
30 mM Na3citrate pH 7.0
3 x gel buffer
3 M Tris
1 M HCl
0,3% SDS

pH 8.45
oppskrift tilpasset fra Schägger 19
Tris-Tricine gel løsning A
For 10 mL:
30% akrylamid-bisacrylamide (29:1) 3.34 mL
6 M Urea
3 x gel buffer 3.34 mL
70% glyserol 1,4 mL
legge til ddH2O til 10 mL
10% APS 40 ΜL
TEMED 4 ΜL
Vekt 6 M Urea og legge 3 x gel buffer, akrylamid-bisacrylamide løsning og 70% gycerol. Varme til 60 ° C i et vannbad til solubilize urea. Legg ddH2O til 10 mL, 10% APS og til slutt TEMED for polymerisering.
Tris-Tricine gel løsning B
For 6 mL:
30% akrylamid-bisacrylamide (29:1) 0,8 mL
6 M Urea
3 x gel buffer 1,5 mL
legge til ddH2O 6 mL
10% APS 45 ΜL
TEMED 4.5 ΜL
Vekt 6 M Urea og legge 3 x gel buffer og akrylamid-bisacrylamide løsning. Varme til 60 ° C i et vannbad til solubilize urea. Legg ddH2O til 10 mL, 10% APS og til slutt TEMED for polymerisering.
1 x Tris-Tricine kjører buffer (anode)
100 mM Tris
22,5 mM HCl

pH 8,9
oppskrift tilpasset fra Schägger 19
1 x Tris-Tricine kjører buffer (katode)
100 mM Tris
100 mM Tricine
1% SDS


pH 8,25
oppskrift tilpasset fra Schägger 19
Sure buffer
100 mM Tris
100 mM eddiksyre
4% SDS stabling gel
For 2 mL:
ddH2O 1.4 mL
30% akrylamid-bisacrylamide (37.5:1) 0,33 mL
1 M Tris pH 6.8 0,25 mL
10% SDS 20 ΜL
10% APS 20 ΜL
TEMED 2 ΜL
15% SDS skille gel
For 10 mL:
ddH2O 2.3 mL
30% akrylamid-bisacrylamide (37.5:1) 5 mL
1.5 M Tris pH 8,8 2.5 mL
10% SDS 100 ΜL
10% APS 100 ΜL
TEMED 4 ΜL
1 x SDS kjører buffer
25 mM Tris
192 mM glysin
0,1% SDS
Coomassie flekk løsning
5% (w/v) aluminet sulfate-(14-18)-hydrat
10% (v/v) etanol (96%)
2% (v/v) orthophosphoric syre (85%)
0.02% (w/v) Coomassie briljant blå G-250
 
ULTRAhyb Ultrasensitive hybridisering Buffer Ambion, Life Technologies

Tabell 2: løsninger og buffer oppskrifter. Liste over alle buffere og løsninger nødvendig for 3D-side analyse.

Spot nei. MW obs. [kDa] Identifikasjon Organisme Tiltredelse nei. MW [kDa] MASKOT score
CIV_1 130 Antatte sykdom motstand protein At4g19050 B. napus CDX78917 131.1 110
CIV_2 130 Antatte sykdom motstand protein At4g19050 B. napus CDX78917 131.1 89
CIV_3 100 Varme sjokk 70 kDa protein 14-lignende B. napus XP_013748865 89.9 113
CIV_4 90 Eukaryote forlengelse faktor 2
Celledeling kontrollere protein 48 homolog A
B. napus
B. napus
CDX90241
CDY41316.1
89.5
89.5
111
197
CIV_5 85 Varme sjokk protein 90-2-lignende B. rapa XP_009132342 79,8 172
CIV_6 80 Threonin - tRNA ligase
Glycine - tRNA ligase
B. oleracea
B. napus
XP_013599115
CDY43195
81.5
80.8
110
88
CIV_7 70 Varme sjokk protein 70 kDa
Lysin - tRNA ligase-lignende
B. oleracea
B. napus
XP_013685267
XP_013747530
67.8
69.9
230
150
CIV_8 65 Myrosinase
Aspartate - tRNA ligase 2
Asparagine - tRNA ligase 1
B. napus
B. napus
B. napus
ABQ42337
XP_013670803
XP_013729126
60.6
61,6
63,5
183
141
153
CIV_9 60 Myrosinase B. napus ABQ42337 60.6 164
CIV_10 55 Adenosylhomocysteinase 2-lignende B. rapa XP_009135865 53.1 139
CIV_11 55 Forlengelse faktor 1-alpha 1-lignende B. oleracea XP_013586115 51,9 161
CIV_12 50 Cystine lyase CORI3 som B. napus XP_013653143 48,1 237
CIV_13 44 Cystine lyase CORI3 som B. rapa XP_009108611 andel på 48,3 213
CIV_14 38 Fruktose-bisphosphate aldolase B. rapa XP_009115993 38.4 226
CIV_15 45 Cystine lyase CORI3 som B. rapa XP_009108611 andel på 48,3 219
CIV_16 45 Cystine lyase CORI3 B. rapa CDY69765 46.9 209
CIV_17 38 Fruktose-bisphosphate aldolase B. rapa XP_009115993 38.4 124
CIV_18 18 Peptidyl-prolyl cis-trans isomerase CYP18-3 som B. napus XP_009101932 18.3 128
CIV_19 45 Cystine lyase CORI3 som B. rapa XP_009108611 andel på 48,3 177

Tabell 3: identifisert protein komponentene fra komplekse IV. Flere tRNA ligases og videre proteiner er funnet innenfor tRNA binding komplekset bruker MALDI-TOF masse spectrometric analyse etter 3D-side.

Discussion

Phloem er en kupé av høy rente, siden det utgjør den viktigste ruten for photoassimilates, og er også avgjørende for langdistanse signalering mellom ulike anlegg deler9,20,34, 35. I tillegg til små molekyler, har makromolekyler som proteiner og RNAs vært innblandet med phloem vedlikehold og signalnettverk4,7,8. Analyse av phloem sammensetning er begrenset av begrenset tilgjengelighet til phloem prøver i de fleste plantearter. Insekt stylet teknikken er allment gjeldende, men eksperimentelt krevende og resulterer i svært små mengder phloem prøver11. En enkel teknikk som brukes for phloem prøvetaking er EDTA-tilrettelagt exudation12. EDTA chelates divalent ioner som kalsium og dermed hindrer lukking av sil plater av P-proteiner og callose. Det er enkelt å bruke, men er utsatt for forurensning av skadede celler og prøver er utvannet. Tappe divalent ioner av EDTA kan også føre til en oversikt over eksisterende komplekser. Det kan imidlertid utvalg fra en rekke arter inkludert modell anlegget A. thaliana15. Spontan exudation av phloem sap bare oppstår i et lite antall plantearter. Det er en invasiv metode som involverer betydelig skade på plante vev10. Vi har nylig etablert B. napus som modell Art for å studere langdistanse transport4,8,20. Her kan phloem sap prøves fra små incisions, noe som reduserer såret effekter og beskyttet mot kontaminering.

Bruke ulike prøvetaking teknikker, proteom av phloem prøver fra forskjellige plantearter har blitt undersøkt i årene7,8,17,36,37, 38,39. For disse proteom studier, proteiner ble pakket ut og igangsatte under denaturing forhold og derfor tillater ikke konklusjoner om protein: protein og protein: nukleinsyre interaksjoner presentere under innfødt forhold. Co-immunoprecipitation (CoIP) og overlegg analyser indikerte at en stor ribonucleoprotein kompleks kan finnes i phloem sap gresskar40, men det var ikke vist at noen macromolecular komplekser finnes under innfødt forhold i den phloem system.

Blå Opprinnelig side, introdusert av Schägger et al. 26, i kombinasjon med påfølgende oppløsning gel geleelektroforese trinn aktiverer separasjon av de enkelte komponentene i store protein komplekser. Bruke 3D-side analyser av innfødte B. napus phloem sårvæske, kunne vi nylig viser at flere høy molekyl vekt protein: protein og RNP komplekser finnes i phloem prøver og er enzymatisk aktive4. Alternative metoder for å isolere protein komplekser samt RNPs som størrelse utelukkelse kromatografi kan finnes, men mislykkes i oppløsning sammenlignet med BN-side. Videre for en rimelig kvalitet komplekse separasjon må størrelse utelukkelse kolonnen matriser tilpasses etter de generelle komplekse molekylvekt etterforsket. Analysere komplekser forskjellige vil derfor kreve ulike kolonner som er kostnadskrevende og tillater ikke som høy fokus makt som en BN-side.

Avgjørende skritt å analysere komplekser fra B. napus omfatter den totale mengden phloem sap som starter materiale. Minst 600 µL av phloem prøve er nødvendig og kan fås fra fem fuktig planter. For 3D-side og BN Nord blotting er det nødvendig å starte første BN gel med en tilstrekkelig mengde phloem prøver. For å oppnå dette, phloem prøvene er konsentrert til 20-30 µg protein kan lastes inn i hver godt og minst triplicates på samme utvalget kjøres parallelt. For lav eller for høy konsentrasjoner reduserer påvisning av komplekser (Figur 3). Phloem prøver må samles inn reaksjon rørene på is og bør lagres fryses for senere bruk å unngå protein fornedrelse og omsetning. Proteasehemmere har blitt funnet i alle phloem proteomes analysert, men også en fullt aktive proteasome ble beskrevet i phloem B. napus4. Videre avhenger volum og sammensetningen av phloem prøver av tidspunkt for prøvetaking og miljøforhold10. Derfor må utvises å samle på samme tid av dagen under like forhold. Stress behandlinger (f.eks tørke) kan redusere mengden av phloem som kan bli samlet. For å identifisere enkelt proteiner av massespektrometri, er det obligatorisk å begrense mulige keratin forurensing av seg hansker hele tiden. Keratin fører til flere signaler under masse spec analyse og vanskeliggjør protein identifikasjon. Kjører BN-siden på et høyere spenning eller ved omgivelsestemperatur kan føre til oppvarming av gel det demontering av skjøre komplekser.

Protokollen presenteres her er egnet for analyse av protein: protein komplekser. Vi viser også at den kan brukes til å oppdage bestemte RNAs i komplekser parallelt. For å oppnå dette, introdusert vi nylig en protokoll for BN Nord blotting4. RNAs er utsatt for degradering av RNAse forurensing. Hvis du vil begrense slike fornedrelse DEPC-behandlet, vannet skal brukes.

Viktigste begrensninger av presentert metoden omfatter estimering av molekylvekt av protein komplekser med BN-side, siden overføring virkemåten avhenger av størrelse, form og selv posttranslational modifikasjoner av komplekser31, 41. Størrelse estimering av RNP komplekser er enda mer komplisert på grunn av påvirkning av nukleinsyrer på migrasjon virkemåten. Det kan ikke være forhindret også at komplekser av samme størrelse co migrere i ett enkelt band. Dette kan føre til feilaktige prediksjon av komplekse komposisjoner. Derfor bekrefte observert samhandlingene med komplementære teknikker, kan f.eks av funksjonelle analyser4, være nødvendig. Også kan proteiner bare svakt eller transiently knyttet til en macromolecular gå tapt i BN bufferen. For å unngå dette, prøver kan være krysskoblet, hva kan også føre til gjenstander eller kan hindre protein identifikasjon, eller bufferen betingelsene kan optimaliseres.

I motsetning til klassisk 2D-side, kombinasjonen av urea - og SDS-side for separasjon hydrophobicity og molekylvekt i stedet for isoelectric punkt (pI) og molekylvekt 28, og begrenser ikke separasjon proteiner fra en bestemt pI utvalg. Ligner på klassiske 2D-side, atskilt proteiner er synlig som enkelt flekker, men på en diagonal linje 4,28 (figur 5, figur 6). Mer hydrofobe proteiner vises i flekker over denne diagonal, mens mer hydrofile proteiner finnes under linje28. Polyakrylamid konsentrasjonen i denne protokollen vil skille proteiner mellom 25 til 80 kDa godt. For å tillate en separasjon av mindre eller større proteiner i polyakrylamid konsentrasjon kan varieres eller gradient gels kan brukes i den tredje dimensjonen. Komponentene i komplekse IV (Figur 3) med 3D-siden (figur 6) ble skåret ut, trypsin fordøyd og analyseres av massespektrometri. Dette resulterte i identifikasjon av flere tRNA ligases. Komponentene i andre komplekser har vært publisert nylig 4. Vår 3D-side aktivert separasjon av forskjellige ligases, nemlig aspartate, asparagine, threonin, lysin og glysin ligases, med lignende molekylvekt (tabell 3). Bruker en metionin tRNA-spesifikke sonde, vi kunne oppdage potensielt bundet tRNA i komplekse IV, men hvis full lengde tRNA eller tRNA fragmenter i komplekset kan ikke bli diskriminert med sonder brukes. For å sjekk hvis nucleic syrer virkelig bundet innenfor komplekset og ikke co migrering, protease fordøyd phloem sap kan eksempler tjene som passer migrasjon kontroller.

Det har vært spekulert tidligere at protein oversettelsen kan oppstå i phloem sil rør, siden nesten de fleste komponentene i det hele ribosom samt forlengelse faktorer har blitt funnet i phloem prøver4,7. Våre funn av tRNA og tRNA ligases synes å støtte denne ideen. Men tRNA fragmenter tilstede i phloem prøver fra gresskar har vist seg å være potent hemmere av oversettelse42 og funksjonelle ribosomer synes å være fraværende4, antyder at oversettelsen ikke skje.

Samlet kan protokollen presenteres her separasjon av innfødte protein: protein og selv RNP komplekser fra phloem prøver og separasjon og identifikasjon av sine enkelte komponenter med høy oppløsning. Anvendelsen av denne metoden kan roman protein og RNP blant phloem prøver og kan derfor belyse nye funksjoner i denne svært spesialisert fabrikk kupé.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi takker Jennifer Deke og Urszula Zarzenska for vitenskapelig støtte. Dette arbeidet ble økonomisk støttet av en karriere integrering Grant (CIG, PCIG14-GA-2013-63 0734) av Europakommisjonen 7th framework programmet, grant LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg) og DFG tilskudd (DFG KE 856_6-1) tildelt JK.

Materials

Name Company Catalog Number Comments
1.5 mL reaction tubes Eppendorf 30120086
10 well comb for SDS PAGE, thickness 1 mm BioRad 1653359
2-Propanol AppliChem 131090
30 % Acrylamide-bisacrylamide solution (29:1) solution BioRad 1610156
30 % Acrylamide-bisacrylamide solution (37.5:1) solution BioRad 1610158
96 % Ethanol Carl Roth P075
Acetic acid Carl Roth 6755
Agarose Lonza 50004
Aluminum sulfate-(14-18)-hydrate AppliChem 141101
Ammonium peroxodisulfate (APS) Carl Roth 9592.3
Bis-Tris AppliChem A3992
Boric acid AppliChem A2940
Bromophenol blue AppliChem A2331
Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa) Sartorius VS0102
Chemiluminescent Nucleic Acid Detection Module Kit Thermo Fisher Scientific 89880
Chromatography papers e.g. 3 mm CHR Whatman 3030-153
CoolBox M30 System Biocision BCS-133
Coomassie brilliant Blue G-250 AppliChem A3480
Diethyl pyrocarbonate (DEPC) AppliChem A0881
Dithiothreitol (DTT) AppliChem A1101
DNase I AppliChem A3778
Ethanol abs. AppliChem A3693
Ethylenediaminetetraacetic acid (EDTA) AppliChem A1103
Gel Imaging system e.g. Chemidoc Touch BioRad 1708370
GeneRuler 1kb plus Thermo Fisher Scientific SM1331
Glycerol AppliChem 141339
Glycine AppliChem 131340
Heating block TS1 Biometra 846-051-500
Hybridization oven e.g. GFL Hybridization Incubator 7601 GFL 7601
Hypodermic needle (0.8 mm) B Braun 4658309
IPG gel comb, thickness 1 mm BioRad 1653367
Labeling of RNA e.g.Biotin 3'end DNA Labeling Kit Thermo Fisher Scientific 89818
Native gradient gel e.g. Novex NativePAGE 4–16% Bis-Tris protein gel Invitrogen BN1002BOX
Nylon membrane e.g. Hybond-N+ Amersham Pharmacia RPN203B
Ortho-phosphoric acid Carl Roth 6366.1
PageRuler prestained protein ladder Thermo Fisher Scientific 26616
Power supply for Gel electrophoresis EPS Amersham Pharmacia 18-1130-01 available from GE Healthcare
RNA Cleanup Kit Qiagen 74204
Semi dry blot e.g. Fastblot 43B semi dry Blot Biometra 846-015-100
Sodium chloride (NaCl) AppliChem A1149
Sodium dodecyl sulfate (SDS) AppliChem 142363
Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit Thermo Fisher Scientific K1621
Tetramethylethylenediamine (TEMED) AppliChem A1148
Tricine AppliChem A3954
Tris AppliChem A1086
Tri-sodium citrate dihydrate AppliChem A3901
TRIzol Reagent Thermo Fisher Scientific 15596026
ULTRAhyb Ultrasensitive Hybridization Buffer Thermo Fisher Scientific AM8670
Urea AppliChem A1360
UV Crosslinker e.g. Stratalinker 2400 Agilent NC0477671 from Fisher Scientific
Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System Thermo Fisher Scientific or BioRad EI0001 or 1658004
Wipers e.g. KIMWIPES Delicate Task Wipers Kimberly-Clark 34120

DOWNLOAD MATERIALS LIST

References

  1. Kempers, R., van Bel, A. J. E. Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa. Planta. 201, (2), 195-201 (1997).
  2. Stadler, R., et al. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 41, (2), 319-331 (2005).
  3. Imlau, A., Truernit, E., Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell. 11, (3), 309-322 (1999).
  4. Ostendorp, A., et al. Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes. New Phytol. 214, (3), 1188-1197 (2017).
  5. Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts. Plant Cell. 28, (9), 2016-2025 (2016).
  6. Sali, A., Glaeser, R., Earnest, T., Baumeister, W. From words to literature in structural proteomics. Nature. 422, (6928), 216-225 (2003).
  7. Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function. Mol. Cell. Proteomics. 8, (2), 343-356 (2008).
  8. Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. Towards the proteome of Brassica napus phloem sap. Proteomics. 6, (3), 896-909 (2006).
  9. Lucas, W. J., Yoo, B. C., Kragler, F. RNA as a long-distance information macromolecule in plants. Nat. Rev. Mol. Cell. Bio. 2, (11), 849-857 (2001).
  10. Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. Plant Mineral Nutrients. 953, 185-194 (2013).
  11. Kennedy, J. S., Mittler, T. E. A Method of obtaining Phloem Sap via the Mouth-parts of Aphids. Nature. 171, (4351), 528 (1953).
  12. King, R. W., Zeevaart, J. A. Enhancement of Phloem exudation from cut petioles by chelating agents. Plant Physiol. 53, (1), 96-103 (1974).
  13. Alosi, M. C., Melroy, D. L., Park, R. B. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase. Plant Physiol. 86, (4), 1089-1094 (1988).
  14. Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. Phloem sap intricacy and interplay with aphid feeding. Comptes rendus biologies. 333, (6-7), 504-515 (2010).
  15. Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method. J Vis Exp. (80), e51111 (2013).
  16. Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum). J. Virol. Methods. 198, 75-81 (2014).
  17. Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L). BMC Plant Biol. 11, (1), 36 (2011).
  18. Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.). Plant Physiol. 94, (4), 1714-1720 (1990).
  19. Yoo, B., et al. A Systemic Small RNA Signaling System in Plants. Plant Cell. 16, (8), 1979-2000 (2004).
  20. Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 53, (5), 739-749 (2008).
  21. Chalhoub, B., et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 345, (6199), 950-953 (2014).
  22. Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. Detection of several mRNA species in rice phloem sap. Plant Cell Phys. 39, (8), 895-897 (1998).
  23. Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements. J Exp. Bot. 53, (369), 631-637 (2002).
  24. Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants. Dev. 126, (20), 4405-4419 (1999).
  25. Schägger, H., Cramer, W. A., von Jagow, G. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217, (2), 220-230 (1994).
  26. Schägger, H., von Jagow, G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199, (2), 223-231 (1991).
  27. Fiala, G. J., Schamel, W. W. A., Blumenthal, B. Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates. J Vis Exp. (48), e2164 (2011).
  28. Rais, I., Karas, M., Schägger, H. Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification. Proteomics. 4, (9), 2567-2571 (2004).
  29. Schägger, H. Tricine-SDS-PAGE. Nature protocols. 1, (1), 16-22 (2006).
  30. Wittig, I., Braun, H. -P., Schägger, H. Blue native PAGE. Nat Protoc. 1, (1), 418-428 (2006).
  31. Eubel, H., Braun, H. -P., Millar, A. H. Blue-native PAGE in plants: a tool in analysis of protein-protein interactions. Plant Methods. 1, (1), 11 (2005).
  32. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, (5259), 680-685 (1970).
  33. Dyballa, N., Metzger, S. Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels. J Vis Exp. (30), (2009).
  34. Turnbull, C. G. N., Lopez-Cobollo, R. M. Heavy traffic in the fast lane: long-distance signalling by macromolecules. New Phytol. 198, (1), 33-51 (2013).
  35. Hall, S. M., Baker, D. A. The chemical composition of Ricinus phloem exudate. Planta. 106, (2), 131-140 (1972).
  36. Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry. J. Exp. Bot. 55, (402), 1473-1481 (2004).
  37. Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. Proteomics of curcurbit phloem exudate reveals a network of defence proteins. Phytochemistry. 65, (12), 1795-1804 (2004).
  38. Walz, C., Juenger, M., Schad, M., Kehr, J. Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes. Plant J. 31, (2), 189-197 (2002).
  39. Kehr, J. Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects. J Exp. Bot. 57, (4), 767-774 (2006).
  40. Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex. Plant Cell. 21, (1), 197-215 (2009).
  41. Schamel, W. W. Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE. J. Immunol. Methods. 252, (1-2), 171-174 (2001).
  42. Zhang, S., Sun, L., Kragler, F. The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation. Plant Physiol. 150, (1), 378-387 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics