마우스 결 장 종양 모델에서 콜론 미생물 생물 다양성에 환경 농축의 효과 정의 하는 방법

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

환경 농축 (EE) 생활, 스트레스, 질병 사이 연결의 기반이 되는 메커니즘을 공개 하는 데 사용 되는 동물 주택 환경입니다. 이 프로토콜에서는 콜론 tumorigenesis EE의 마우스 모델을 사용 하 여 특별히 microbiota 생물 다양성 동물 사망률에 영향을 줄 수 있는 변경을 정의 하는 프로시저를 설명 합니다.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

여러 최근 연구 인간의 질병 개선에 풍부한 환경에서 생활의 유익한 효과 설명 했습니다. 마우스에서 환경 농축 (EE) tumorigenesis 마우스 면역 시스템을 활성화 하는 것을 줄여 또는 종양 microenvironment에서 향상 된 미생물 다양성을 포함 하 여 상처 복구 응답을 자극 하 여 종양 베어링 동물 생존에 영향을 줍니다. 여기에 마우스 대 장 종양 모델에서 미생물의 생물 다양성에 환경 농축의 효과 평가 하기 위해 자세한 절차입니다 제공. 동물 사육 및 동물 유전자 형 및 마우스 식민지 통합을 위한 고려 사항에 관한 주의 사항 설명, 모두는 궁극적으로 미생물 생물 다양성에 영향을. 이러한 예방 조치를 주의 더 균일 한 미생물 전송, 수 하 고 따라서 연구 결과 혼동 수 비 처리 종속 효과 완화할 것 이다. 또한,이 절차에서는 microbiota 변경 다음 장기 환경 농축 원심 결에서 수집 하는 자에서 분리 된 DNA의 16S rDNA 시퀀싱을 사용 하 여 특징입니다. 본질적인 microbiota 불균형은 염증 성 장 질환과 결 장 암, 뿐만 아니라 비만 및 다른 사람의 사이에서 당뇨병의 병 인에 연관 된다. 중요 한 것은, 다양 한 인간 질병을 정리 할 수 있는 존재 하는 강력한 마우스 모델 질병에서 미생물 병 인의 역할을 연구 하기 EE 및 미생물 분석을 위한이 프로토콜을 활용할 수 있습니다.

Introduction

환경 농축 (EE) 연구 활용 사회적 자극 (대형 주택 새 장, 동물의 더 큰 그룹), 인지 자극 (오두막, 터널, 중첩 물자, 플랫폼) 및 신체 활동 (실행에 영향을 미칠 복잡 한 주택 매개 변수 바퀴)입니다. EE은 질병 개시 및 barbering 유도 탈모 증, 알 츠 하이 머 병을 포함 한 마우스 모델의 다양 한 배열을 사용 하 여 진행에 증가 한 활동 및 사회 및 인지 향상 된 상호 작용의 효과 이해 하는 많은 실험실에 의해 이용 되어 레트 증후군, 그리고 여러 종양 및 소화기 질병 모델1,2,,34,,56.

여러 마우스 모델 콜론 tumorigenesis 쥐에 연구 개발 되었습니다. 아마도 가장 잘 정의 된 모델은 Apc 마우스. Apc 마우스 19907, 윌리엄 비둘기의 실험실에서 개발 되었다 그리고 일반적으로 인간 대 장 암 연관 된 APC 유전자에 돌연변이의 마우스 모델 사용 되었습니다. APC 돌연변이 은닉 하는 인간, 달리 Apc 마우스는 주로 결 장 종양의 아주 드문와 작은 창 자 종양을 개발 합니다. 그러나, Tcf4에 단일 쫓 고 녹아웃 heterozygous 돌연변이와 Tcf4Het 대립 유전자는 훨씬 콜론 tumorigenesis Apc 대립 유전자8과 결합 될 때 증가 합니다. 최근, 콜론 tumorigenesis의이 마우스 모델 콜론 tumorigenesis6EE의 효과 결정 하기 위해 사용 되었습니다. 바이스 에 공부, 남성 및 여성 4 개의 다른 마우스 라인에 EE의 생리 및 phenotypic 효과 (야생-타입 (WT), Tcf4Het / + Apc+ +, Tcf4+ + Apc분 / +, Tcf4 Het / + Apc분 / +)) 정의 된. 아마도 가장 흥미로운 발견 EE 크게 둘 다 남성과 여성 결 장 종양 베어링 동물의 수명을 증가 했다. 이 시연 EE 적어도 줄일 수 있습니다 일부 증상의 콜론 tumorigenesis, 연관 및 동물 건강을 개선. 놀랍게도, 남성에서이 향상 된 수명 감소 tumorigenesis의 직접적인 결과 이며 대신 종양 상처 치유 향상 된 미생물 생물 다양성6을 포함 하는 응답의 개시에 연결 했다.

재미 있는 결과 함께 몇 가지 EE 특정 연구 출판 되었습니다. 그러나, 기술적인 관점에서 중요 한 결과 종종 없습니다 다른 실험실에 번역. 매우 복잡 한 문제, 아니라 농축 장치 및 주택 사용, 하지만 또한 침구, 음식, 환기, 번 식, 유전학, 방, 그리고 동물 프로토콜에서 활동은 다른 실험실 간의 동일한 EE 방법론을 유지 요구 사항, 다른 사람의 사이에서9,,1011. 한 예로 어디 동물 안정적으로 통합 마우스 식민지 따라서 유전 배경 및 식단 구성, 비 처리 관련된 효과 피하기 위해 정규화 동물의 통합 이다. 추가로, 많은 전자 연구 질병, 그리고 일반적인 마우스 농업 관행 본질적인 미생물10,12의 구성에 영향을 수 있습니다 방법에 미생물의 중요성의 실현 하기 전에 완료 되었습니다.

제대로 수행 하지 경우 전자에서 번 식 전략 및 동물 배치 스트레스를 증가 시킬 수 있습니다. 이후 EE 연구 다 수의 남성과 여성의 동물과 여러 genotypes 활용, 실험적인 체제 어려울 수 있습니다 결합 될 여러 새끼에서 동물에 대 한 요구를 주어진. 따라서, 한 번 식 및 전략 이유 다른 담가에서 올바른 유전자의 이유 동물의 결합을 위한 허용 하도록 개발 되었다. 이 대 한 기본 근거 새끼 중 microbiota를 정상화 하 고 스트레스를 줄이기 위해 동물 실험 환경으로 이동 하는 때 이었다. 미생물 댐10에서 전달 되었다. 식민지에 미생물 다양성을 제공 하려면 여성 잭슨 실험실에서 구입 하 고 실험9,,1012시작 하기 전에 한 달 동안 식민지에 통합 했다. 더 정상화 미생물 생물 다양성 동물 사이, 여성 공동 사육 이전 지 내게 했다. 번 식, 양육 하는 동안 공동 주택 및 탈출 하는 능력에 따라 간호 새끼 모성 배려13,14, 미생물 정규화를 가능 하 게 발전의 스트레스 수준을 향상. 비-전자를 방지 하기 위해 관련은 미생물에 대 한 효과, 모든 실험 동물의이 공동 주택 방지 한 실험으로 다른 담가에서 여러 남성을 결합할 때 발생 한 전투 및 추가적인 스트레스. 마지막으로, 모든 genotypes의 동물의 동등한 숫자는 연습장에 포함 됐다. 이 genotypes, 전반에 걸쳐 향상 된 microbiota 생물 다양성에 대 한 기회를 제공 하 고 제거 coprophagia (동물의 경향이 자 소비) 또는 전체 연구. 에 가능한 유전자 형 관련 행동 차이의 기여

이 프로토콜은 이전 EE 연구 미생물 연구, 더 균일 한 미생물 인구 수 있도록 microbiota 정규화 microbiota 전송 및 동물 식민지 통합의 알려진된 측면을 포함 하도록 확장 하는 전략을 제공 합니다. 사이 실험 동물. 이러한 예방 조치를 주의 하는 것은 수 비 처리 관련된 microbiota 차이의 연구 결과 혼동 때문 필수적 이다. 제거 하는 비-전자 관련 microbiota 변화 특히 질병 개발 및 진행 하는 동안 microbiota 구성에 EE의 역할을 정의 하는 연구자 수 있게 된다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

여기에 설명 된 모든 메서드는 프로토콜 기관 동물 관리 및 사용 위원회 (IACUC) 유타 대학에 의해 승인에 따라 수행 했다.

1. 실험 설계 및 전자 제어 케이지 설치

참고: 참고로, 실험 설계에 대 한 개요를 보여 줍니다 (그림 1).

  1. 컨트롤 (NE)와 EE 케이지 설정 (그림 2).
    1. 북동 감 금 소를 설정 하려면, 농축 장치 부족 압력가 기존의 제어 연습장 (표 1)을 사용 합니다.
    2. 큰 감 금 소, 밧줄 고리 및 터널 (자료 테이블)에 맞게 충분히 큰 감 금 소 당 1 구멍을 드릴 다운 합니다.
    3. 강아지를 양육 하 고 EE 케이지를 설정 하려면, 두 개의 큰 압력가 연습장 소독된 밧줄 보안된 터널 및 2 소독된 플랫폼 바닥 공간 (표 1)을 연결 합니다. 전자 실험에 대 한 소독 바퀴, 터널, 이글루, 오두막, 크롤링 공, 실행 하 고 EE 케이지 내에서 자료를 중첩을 제공 합니다.
    4. 동등한 환기를 제공 하기 위해 통풍이 랙에 EE와 네브라스카 케이지를 놓습니다.
      참고: 2 플랫폼 (표 1)와 함께 두 개의 큰 연습장 설치15 양육 강아지 당 12 임신 여성의 최대 허용 ( 테이블의 자료를 참조, 문서 및 표 2에 3.2 단계).
    5. 마우스 피드 광고 libitum 반구 표준 차 및 압력가 역방향 삼 투 물.
    6. 살 균 침구 재료와 마우스를 제공 합니다.
      참고: 모든 조작 빈 새 장과 감 금 소 동물의 오염을 방지 하기 위해 후드에서 수행 되어야 합니다. 큰 감 금 소의 케이지 조작에 대 한 접착 필름으로 감 금 소에 구멍을 커버.
  2. 동물 사육에 대 한 준비. 2 주 전에 짝짓기에 대 한 단일 큰 새 장 (표 1)에 집 15 2 달 오래 된 여성 그룹. 별도로 짝짓기 전에 2 주 동안 2 달 오래 된 littermate 남성 집.
    참고: Breeding 위한 암컷의 수는 실험과 필요한 동물의 수에 따라 달라 집니다. 이 연구에서는 15 여성 이용 하였다 12 연결된 암컷을 얻기 위해 최대는 1.1.2 (표 2)에서 설명 하는 설치를 양육 하는 강아지에서 허용 되는 수.
  3. 번 식, 폐하와 댐 동물, 2 여성 당 1 남자 결합. 아침에 첫 번째 검사는 동물 밤 동안 성관계는 시각적 표시 일지도 모른다 질 플러그에 대 한 되어야 합니다.
    참고: 하우스 남성 그리고 여성까지 각 여성 연결 되어 함께. 질 플러그 외부 경우에 시각적으로 확인할 수 있습니다.
    1. 내 면된 플러그 감지, 프로브를 질에 삽입 되 고 조사 쉽게 삽입 되지 않도록 질 플러그 있으면 (16; 섹션 4.3.6 참조).
      참고: 밤에 발생 한 짝짓기 이후 플러그 ½ 하루로 감지 하는 아침을 기록 합니다.
    2. 여성 질 플러그, 일단 큰 강아지 그룹 주택 다른 성관계 여성 (농축 장치 없이 1.1.2 단계에서 설치)에 대 한 감 금 소에 그들을 전송.
    3. 바꾸기 여성 신규 unmated 그룹 보관 되어 암컷과 짝짓기 성관계 하 고 7 일간의 기간에 새끼의 최대 수를 얻기 위해 짝짓기를 계속.
      참고: 모든 동물의 7 일 안에 배달 날짜를가지고 있어야 합니다.
  4. 임신 여성 그룹 주택 하나의 큰 강아지 감 금 소 (농축 장치 없이 1.1.2 단계에서 설치) 내에서 발생 하는 모든 새끼를 낳을 수 있습니다.
    1. 강아지 번호 및 생일, 그리고 나이의 7 일 유전형 새끼를 시작.
      1. 13,17그들을 식별 하는 숫자 코드와 나이의 7 일에 그들의 발가락에 새끼를 문신.
      2. 70% 에탄올과 발가락을 깨끗 하 고 부드럽게 발가락17 에 평행 하 게 피부 표면에 잉크를 포함 하는 마이크로-문신 장치 삽입 ( 재료의 표참조).
      3. Incising 7 일 된 신생아에서 직물의 작은 조각에 의해 꼬리 끝에서가 위로 유전형 조직을 수집 합니다.
    2. 조직에서 게놈 DNA를 분리 하 고 18에 설명 된 대로 기존의 인가요 메서드를 사용 하 여 PCR을 수행.
    3. 엄마와 함께 대형 연습장으로 14 ~ 21 일에 섹스에 의해 별도 동물.
      참고: 이전 새끼, 자신의 피드 수 있습니다 젊은 새끼 그들의 자신의 먹이를 충분히 오래까지 간호사에 게 계속 확인 합니다.
    4. 21-28 일에 배포 남성과 여성 동물 별도로 유전자 형에 의해 북동 또는 EE 환경, 케이지 (그림 2A) 당 각 유전자의 동일한 비율을 유지 하.
      참고: 각 네브라스카 또는 EE 장에 허용 하는 동물의 총 수 IACUC (표 2)에 의해 허용 되는 최대 수에 따라 확인 합니다. 북동 감 금 소는 대부분 5 동물 (표 2). EE 케이지, 사회적 자극, 아니 20 하 고 공간 제한에 더 이상 41 동물 EE 케이지 (표 2)에서 허용 되어야 한다.

2. 나이의 16 주에의 자 컬렉션

  1. 1 ~ 2 일 이전에 희생의 자 컬렉션을 시작 하 고 별도로 살 균 도구를 사용 하 여 해 부 동안 희생의 날에 대변을 수집 합니다.
    참고: 동시 컬렉션 1-2 일전에 수집의 자 없는 자는 컬렉션의 시간에 존재 하는 가능성으로 인해 샘플의 손실을 방지 하기 위해 도움이 됩니다.
    1. 수집 대변 살아있는 동물, 신중 하 게 아저씨에서에서 동물 깨끗 한 감 금 소에. 자 살 균 microfuge 관으로 소독 집게를 사용 하 여 수집 합니다.
      참고: 일반적으로 동물의 자, 움직일 때 살 균 microfuge 관으로 직접 빠른 대변 수집 수 있는 제거 하 게 됩니다. 움직일 때 동물 즉시 배변 하지 않습니다, 깨끗 한 감 금 소에 배치 하 고 (일반적으로 최대 1 h) 똥을 동물에 대 한 기다립니다.
    2. 희생의 하루에 대변을 수집 합니다.
      1. 동물을 euthanizing 동물 isoflurane에 흠뻑 목화 공 작은 컨테이너를 포함 하는 벨 항아리에 장소. 호흡의 정지 (2 분) 후 일반적으로 관찰 되 면 결 장 해 부를 허용 하도록 그것의 뒤에 동물을 하다.
      2. 마우스 복 부에 70% 에탄올을 적용 됩니다.
      3. 집게와 요도 개통 앞쪽 피부를 리프트 하 고는 흉 곽에 도달할 때까지 복 부 정중 선 따라 잘라가 위를 사용 하 여 각 다리 쪽으로 첫 번째 절 개의 기지에서 잘라. 피부를 다시 접어과 위를 사용 하 여 동일한 패턴에 복 벽을 통해 잘라.
      4. 집게를 사용 하 여 해 부 및 원심 결 장 곧은 창 자에서 분리를 항문에 원심 결 파악. 당기면 집게, 수직으로 콜론 콜론 출시 mesentery 통해 잘라가 위를 사용 합니다.
      5. 바로 아래 맹 결 고 필터 종이에 누워. 집게를 사용 하 여 삽입할 열려가 위 한쪽에 있도록 루멘 여 콜론 튜브의 상단을 들어. 경도, 인접, 하 splay 원심 오픈 콜론 세로로 잘라.
      6. 소독 집게를 사용 하 여 살 균 microfuge 관으로 원심 결 장에서 대변을 수집 합니다.
  2. -80 ˚C에 microfuge 관 세균성 DNA 고립의 시간까지 대변을 저장 합니다.
    참고: 자 뿐만 아니라 희생의 날에 다른 샘플 전체 혈액, 혈 청, 플라즈마, 정상 및 종양 조직 결 장 및 작은 창 자, microsomes, 지방 조직 에서 수집 합니다. 하는 연구에서 정의 된 질문을 해결 합니다.

3. 게놈 DNA 분리의 자에서

참고: 자의 자 병원 체 탐지 프로토콜을 다음에서 미생물 DNA 분리 상업 키트를 활용. 무게 동안 직접-80 ˚C 냉장고와 드라이 아이스에 저장소에 대 한 샘플을 제거 합니다.

  1. 실 온 (RT)의 자 세포의 용 해 버퍼의 1.4 mL를 포함 하는 깨끗 한 microfuge 관에 대변의 220 밀리 그램까지 전송 ( 재료의 표참조).
  2. 철저 하 게 균질 고체 (그림 2B)를 1 분 동안 소용돌이 샘플. 5 분 (를 포함 하 여 그람 양성 박테리아) 모든 박테리아를 lyse 95 ˚C 정지 열.
  3. 와 동 15 s 그리고 작은 자 솔리드 1 분 20000 x g에서 원심 분리기에 대 한 샘플. 2 mL microfuge 관 상쾌한 전송. 각 샘플을 PCR 억제제, 소용돌이 태블릿 용 해 될 때까지 흡수 한 태블릿을 추가 하 고 1 분 동안 RT에서 샘플을 품 어.
  4. 원심 3 분 20000 x g에서 샘플 하 고는 상쾌한 새로운 microfuge 관으로 전송. 새로운 1.5 mL microfuge 관으로 20000 x (20 mg/mL 주식) 성분 K의 3 분 Aliquot 15 μ g에서 원심. 샘플의 200 μ 가수분해 K. 포함 된 튜브에 플라스틱
  5. 추가 guanidinium 염화 물 세포의 용 해 버퍼 튜브에, 15에 대 한 철저 하 게 소용돌이의 200 μ s ( 재료의 표참조) 관에 에탄올 (96-100%)의 10 분 추가 200 μ에 대 한 70 ˚C에서 샘플을 품 어와 vortexing에 의해 잘 혼합.
  6. 장소는 실리 카 2 mL 컬렉션 튜브에 스핀 열을 기반으로 하 고 열에 샘플을 적용 합니다. 뚜껑과 20000 x g에서 1 분 동안 원심 분리기를 닫습니다.
  7. 새로운 2 mL 컬렉션 튜브는 열 전송 및 500 μ 워시 버퍼 1 열으로의 열 그리고 20000 x g. 전송 열 새로운 2 mL 컬렉션 튜브에 1 분 동안 원심 분리기 뚜껑과 500 μ 워시 버퍼 2의 열에 추가 추가 모자와 3 분 20000 x g에서 원심 분리기를 닫습니다.
  8. 폐쇄 하는 모자와 함께 새로운 2 mL 컬렉션 튜브에 열을 전송 하 고 잔여 워시 버퍼를 제거 하려면 20000 x g에 추가 1 분에 대 한 원심. 1.5 mL microfuge 관을 표시 하는 열을 전송 하 고 막에 EDTA를 포함 하는 차입 버퍼의 200 μ를 추가 하 여 샘플을 elute ( 재료의 표참조).
  9. 뚜껑을 닫고 1 분 20000 x g. 삭제 열에서 1 분 동안 원심 분리기 샘플에 대 한 RT에서 품 어.

4. DNA 농도 결정 및 PCR 위한 샘플 준비

참고: fluorometer와 각 샘플에 있는 genomic DNA 농도 결정 하는 상용 dsDNA 형광 분석 결과 활용 ( 재료의 표참조). 형광 성 염료는 특히 두 배 좌초 된 DNA를 바인딩해야 합니다.

  1. 각 샘플 (199 µ L dsDNA 마스터 믹스에 각 샘플의 1 µ L) 및 1시 50분의 1: 200 희석 준비 표준 희석. DsDNA 설정을 사용 하 여 fluorometer에 분석.
    참고: PCR에 DNA의 높은 볼륨 억제 될 수 있다, 따라서, 사용 하는 DNA의 PCR의 최종 볼륨의 10% 이상 되지 않아야 합니다. fluorometer로 형광 염료에 바인딩된 DNA만 형광은 최종 계산 된 DNA 농도에 오염 물질의 가능한 기여 제거 샘플에서 DNA의 정확한 측정을 수 있습니다. 이 정도의 정확한 정량 다운스트림 시퀀싱 응용 프로그램에 대 한 필수적입니다.
  2. 5 ng/μ 10 mm Tris, pH 8.5 각 샘플의 작업 서식 파일 주식 수 있도록 적절 한 양으로 희석 하는 PCR 서식 파일을 준비 합니다.
  3. -20 ° c.에 샘플 저장

5. 디자인 뇌관에서 16S에 원하는 V 지역

  1. 선택적으로 원하는 V 16S rRNA 지구를 증폭 하기 위하여 뇌관을 디자인 합니다.
  2. 다양 한 문의 대 한 대략적인 적중률 확인 하19Ribosomal 데이터베이스 프로젝트 프로브 일치, 뇌관을 분석 합니다.
    참고: V1-V3 지역, 사용 하는 현재의 연구 출판 뇌관 Bosshard 앞으로20, V1 지역 위치 8에서 현재 533 역21, 533 v 3 지역 내에서 위치에 바인딩하는 바인딩. 프라이 머는 인덱싱 오버행 어댑터 시퀀스를 포함 해야 합니다.
  3. 뇌관을 디자인할 때는 16S metagenomics 라이브러리 준비22 (표 3)을 시퀀싱에 대 한 권장 각 뇌관의 5' 끝에 어댑터 시퀀스를 포함 합니다.
  4. 이러한 큰 뇌관 카트리지 정화와 음성 합성. Desiccated 뇌관을 다시 구성 하 고 10 mM Tris, pH 8.5에서에서 1 μ M 재고 일 PCR을 희석.

6. Amplicon PCR 증폭 오버행 어댑터 시퀀스 V 지구 22 연결

  1. amplicon PCR 반응 혼합 표 4에 설명 된 대로 설정 합니다.
  2. 접시에 접착제 분명 PCR 플레이트 인감을 놓고 amplicon 표 5에 매개 변수를 사용 하 여 PCR을 실행 합니다.
  3. (선택 사항) Amplicon amplicon 크기의 정량적 측정을 가능 하 게 높은 감도 DNA 분석 결과 agarose 젤에 PCR 제품을 실행 ( 재료의 표참조).
    참고: 이 연구에서 amplicon 크기는 550 bp (그림 3A).

7. 22 비즈 PCR 정리를 사용 하 여 자기

  1. 1000 x g 결로 수집을 1 분 동안에 빠르게 amplicon PCR 격판덮개 원심
    참고: PCR 튜브 스트립 오염을 최소화 하기 위해 PCR 번호판 대신 사용할 수 있습니다. 관 뚜껑을 폐기 하 고 결코 다시 사용.
  2. 잘, 각 amplicon PCR 균등 하 게 분산, 자석의 20 μ 추가 하 자석 구슬 비즈 소용돌이 다음 플라스틱 전체 볼륨 아래로 천천히 10 번.
  3. 품 어 RT에서 5 분 장소 PCR 접시 2 분 마그네틱 스탠드에 대 한 때까지 자석 구슬 수집과 상쾌한 분명 하다. 제거 하 고 삭제는 상쾌한.
  4. 워시 200 μ 신선한 80% 에탄올 PCR 접시는 자석에 서 구슬과 30 품 어 마그네틱 스탠드에 RT에서 s. 조심 스럽게 제거는 상쾌한.
  5. 두 번째 시간에 대 한 세척을 반복 합니다. 이제, 미세 피 펫 팁을 사용 하 여 우물에서 어떤 잔여 에탄올을 제거 하 고 10 분 동안 건조 공기를 허용 하.
  6. 마그네틱 스탠드에서 PCR 플레이트를 제거 하 고 추가 10 mM Tris pH 8.5의 52.5 μ 각 잘. 최대 플라스틱 하 고 아래로 10 번 구슬을 일시 중단 하 고 2 분 동안 실 온에서 품 어.
  7. PCR 플레이트 마그네틱 스탠드 자석 구슬 수집 하 고 깨끗 한 PCR 접시에는 상쾌한의 50 μ를 전송를 전송. 접시에 접착제 분명 PCR 플레이트 인감을 놓고 1 주일-20 ˚C에 저장 합니다.

8. 인덱스 PCR 접시 체계의 준비

참고: V1-V3 라이브러리를 생성 하려면 두 번째 PCR 인덱스 수행 키트 ( 재료의 표참조). 기본 인덱싱 구성표 (그림 3B23) 각 샘플에 대 한 독특한 듀얼 인덱스 조합을 매핑하는 데 사용 되었다.

  1. 각 샘플 2 인덱스 뇌관의 독특한 조합을 있는지 확인 하십시오 (, 듀얼 색인).

9. 인덱스 설명된 22 로 어댑터 시퀀스에 바코드를 부착 하는 PCR을 수행 합니다.

  1. 인덱싱에 도움 인덱스 플레이트 설비에 새로운 96 잘 접시를 PCR amplicons (깨끗 한 amplicons)의 2.5 μ를 전송 합니다.
  2. 인덱스 1을 주선 하 고 준비 된 접시 그래픽 (그림 3B)의 예와 2 뇌관을 색인.
    참고: 시각적 신호 뇌관 에러를 피하기 위해 제공 됩니다: 인덱스 2 뇌관 튜브 있어야 흰색 모자와 명확한 솔루션, 인덱스 1 뇌관 튜브 오렌지 모자와 노란색 솔루션 있어야 하는 동안.
  3. 표 6에 설명 된 대로 인덱스 PCR 혼합 반응을 조립 한다. 10 번 위아래로 pipetting으로 혼합. 접착제 분명 PCR 판 도장 커버 하 고 1 분 동안 실 온에서 1000 x g에서 수집 원심.
  4. 색인 표 7에 매개 변수를 사용 하 여 PCR을 실행 합니다.

10. 최종 PCR 라이브러리 정화

참고: 이 PCR 대 청소는, 위의 단계 7 사용 하 자석 구슬 PCR22인덱스의 PCR 청소를 수행.

  1. 1000 x g 결로 수집을 1 분 동안에 빠르게 10 단계에서 PCR 격판덮개 원심
  2. 잘, 각 amplicon PCR 균등 하 게 분산, 다음 20 μ의 자석 추가 자석 구슬 비즈 소용돌이 다음 위아래를 섞어 천천히 10 번 전체 볼륨 플라스틱.
  3. 5 분에 대 한 RT에서 품 어.
  4. 장소 PCR 접시 2 분까지 자석 구슬 수집 하 고 표면에 뜨는 마그네틱 스탠드에 분명 하다. 제거 하 고 삭제는 상쾌한.
  5. 워시 200 μ 신선한 80% 에탄올 PCR 접시는 자석에 서 구슬과 30 품 어 마그네틱 스탠드에 실 온에서 s. 조심 스럽게 제거는 상쾌한.
  6. 두 번째 시간에 대 한 세척을 반복 합니다.
  7. 두 번째 세척에 따라 우물에서 어떤 잔여 에탄올을 제거 하 고 10 분 동안 건조 공기를 허용 하는 미세 피 펫 팁을 사용 합니다.
  8. 마그네틱 스탠드에서 PCR 플레이트를 제거 하 고 추가 10 mM Tris pH 8.5의 52.5 μ 각 잘. 최대 플라스틱 하 고 아래로 10 번 구슬을 일시 중단 하 고 2 분 동안 실 온에서 품 어.
  9. PCR 플레이트 마그네틱 스탠드 자석 구슬 수집 하 고 깨끗 한 PCR 접시에는 상쾌한의 50 μ를 전송를 전송. 접시에 접착제 분명 PCR 플레이트 인감을 놓고 1 주일-20 ˚C에 저장 합니다.
  10. (선택 사항) Agarose 젤 또는 amplicon 크기의 정량적 측정을 가능 하 게 높은 감도 DNA 분석 결과에서 실행 하는 인덱스 PCR 제품 ( 재료의 표참조).
    참고: 이 연구에서 마지막 인덱싱된 라이브러리 크기는 668 bp (그림 3C-D).

11. 계량, 정상화, 및 시퀀싱에 대 한 인덱싱된 라이브러리 수영장

  1. 각 샘플의 DNA 농도 fluorometer와 dsDNA 형광 분석 결과 키트 결정 (재료의 표 참조).
    1. 각 인덱싱된 샘플 (190 µ L dsDNA 마스터 믹스 및 표준의 10 µ L) 표준 샘플 (199 µ L dsDNA 마스터 믹스, 버퍼 및 시 약을 포함 하는 각 샘플의 1 µ L)의 1: 200 희석을 준비 합니다. DsDNA 설정을 사용 하 여 fluorometer에 분석.
  2. DNA 농도 계산에 따라 평균 라이브러리 크기를 계산 하 여 라이브러리를 정상화. 어댑터 길이, 인덱스 길이 및 뇌관에서 V amplicon 크기를 요약 하 여이 작업을 수행 하 고 특정 실제 크기는 비슷합니다 (그림 3C, 22참조) 계산 된 크기를 agarose 젤 제품 보기.
    1. 또는, DNA 무결성, amplicon 크기 및 농도 (테이블의 자료, 그림 3D)의 정량적 측정을 가능 하 게 높은 감도 DNA 분석 결과 사용 합니다.
      참고: 이 연구에서는 평균 라이브러리 크기 요약 어댑터 길이, 인덱스 길이 및 뇌관에서 V1-V3 amplicon 크기에 따라 계산 했다. 평균 크기는 668 혈압.
    2. 샘플의 농도 표 8에 수식을 사용 하 여 정규화 됩니다.
  3. 4 nM 및 수영장 5 샘플을 희석 시퀀싱에 대 한 단일 관으로 각 4 nM 샘플에서 μ.

12. 순서는 차세대 시퀀싱 시스템을 사용 하 여 라이브러리 및 데이터 구문 분석

  1. 시퀀스는 라이브러리입니다.
    참고: 이 연구를 위해 대학의 유타 높은 처리량 유전체학 코어 라이브러리 변성 및 샘플 시퀀싱 ( 6,22에 설명) 하는 대로 수행 합니다.
  2. 데이터를 구문 분석 합니다.
    참고: 풀링된 샘플에서 데이터를 분리, 인덱스 읽기 확인 되었고 ( 22에서 같이)를 분리.
  3. FASTQ 파일을 생성 하 고이 이후의 데이터 분석을 위해 활용.

13. 16S Amplicon 라이브러리에서 시퀀스 데이터 분석

참고: 이 단계는 바이스 에 설명 된 대로 수행. 2017,6.

  1. (참조 자료의 테이블; 자유롭게 사용할 수 있는 데이터 분석 도구 설치 24).
  2. (25,26에서 같이) 시퀀스 데이터에서 역다중화 fastq 파일을 조립. 모든 unassembled 시퀀스를 삭제 합니다.
  3. 드 노 보 오픈 분류학 단위 (OTU) 따기 ( 27에서 설명)와 프로토콜을 다음과 같은 분석을 수행 합니다.
    1. 28에 설명 된 대로 sampleID에 의해 단일 fastq 파일에 시퀀스 및 그룹 시퀀스 97% 또는 OTUs에 큰 유사성을 빈. 150과 75% 정체성29,30의 최소 시퀀스 길이 설정 코어의 대표적인 시퀀스를 정렬 합니다. 설명된28로 분류를 지정 합니다.
      참고: 샘플 범주화 될 수 있습니다 및31, 분류학 할당 및 OTU 표 건설32분석.
    2. 설명 하는 이름 및 링크 샘플 식별 하 고 유효성을 검사할 매핑 파일33,34샘플의 특성을 식별 하는 매핑 파일을 만듭니다.
    3. OTU 네트워크 OTUs 매핑 파일35를 사용 하 여 샘플 설명에 링크를 확인 합니다.
    4. 플롯36통해 taxa를 요약 하 여 관계 되는 풍부의 점에서 분류 요약을 계산 합니다.
    5. 균일 한 시퀀싱 깊이 샘플에 적절 한 샘플의 알파 다양성을 탐구 한다. 알파 다양성에 대 한 적절 한 깊이 정의 하려면 37에 설명 된 대로 biome 요약 테이블 명령을 사용 하 여 각 샘플에서 관찰 된 총 수를 요약 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

여러 연구 결과 정신 신체 의학의 실천 건강 결과 개량 한다 설명 했다. 마찬가지로, 마우스, 환경 농축 향상 된 수명 등 종양 상처 복구6결과 향상 시킵니다. 따라서, 전자 절차는 첫 번째 실험 (그림 1)의 개시 전에 미생물을 정상화 하는 동안이 표현 형에 microbiota의 역할을 정의 하는 것을 목적으로 개발 되었다. 중요 한 것은, 모든 사육 동물의 번 식, 시작 전 적어도 한 달 동안 마우스 식민지에 통합 되어 있으며 신생아 강아지 공동 실험 전에 microbiota 전송 정상화를 하나의 큰 감 금 소에 어머니와 함께 지 내게. 동물 21, 28 일 사이, 각 유전자 형의 동등한 숫자는 투약를 중단 시킨 그들의 각각 주택, EE 또는 북동 환경 (그림 2A)으로. 16 주에 수집 되는 모든 동물에서 자 고 무 균된 (그림 2B), 세균성 DNA 분리 뒤. 마지막으로, 16S amplicons에서 증폭 됩니다 대변 미생물 DNA와 바코드 동시에 모든 미생물 라이브러리의 시퀀싱에 대 한 수 있도록 인덱스 (그림 3). WT 및 종양 동물 NE와 EE 조건에서 베어링에서 식별 된 고유 시퀀스는 그림 4에 나와 있습니다. 흥미롭게도, EE WT 동물, 생물 다양성을 향상 되지 않습니다 하지만 성은이 방법은 생물 다양성 개선 수 보여주는 종양 베어링 동물 (그림 4), 생물 다양성 증가. 생물 다양성이 증가 문 Proteobacteria, 중요 한으로 Alphaproteobacteria, Betaproteobacteria, 클래스에서 증가 하 고 병원 성 Gammaproteobacteria (그림 5에서에서 감소의 증가 존재에 기 인할 수 있다 ; 추가 표 1)입니다. 가장 큰 증가 Betaproteobacteria에는 속 Sutterella, 가능성이 공생 분 비 IgA 저하 (그림 6,38도 참조)에 참여 하는 클래스 이다.

Figure 1
그림 1 : 실험 일정의 표현. 프로토콜의 대부분은 7 일 단위로 수행으로 짧은 밴드 7 일 창을 나타냅니다. 이 또한 실험에서 강아지 나가의 범위의 시각화에 에이즈. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : EE와 북동 주택 조건 및의 자 homogenates (로 프로토콜에서 설명). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : 16 미생물 라이브러리 준비. (A)의 자 genomic DNA에서 파생 된 Unpurified PCR amplicon 제품. (B) 인덱싱 플레이트 그래픽 사용 하는 소프트웨어에 의하여 설계 (테이블의 재료, 23). 듀얼 인덱스 조합, I7 (인덱스 1; 행) 및 I5 (색인 2; 열), 각 샘플에 대 한 표시 됩니다. 각 인덱스는 8 길이 혈압. 샘플 번호 EE 연구에서 각각 마우스 숫자를 참조 하십시오. (C) Unpurified 인덱스 PCR 제품. (D) 최종의 품질 분석 및 순화 16S 라이브러리 풀링된. (A, C, D) 검은 화살표 550 bp amplicon 및 668 bp 인덱싱된 라이브러리를 나타냅니다. 빨간색 화살표 표시 와 같이 정화 다음 제거 하는 일반적인 제품 위 더 낮은 표식 크기 표식 크기 기준에 대 한 샘플에 추가 되며. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 : 알파 다양성의 EE를 다음 변경 내용을 Tcf4Het / + Apc분 / + 동물. WT의 알파 다양성 및 Tcf4Het / + Apc분 / + 베어링 동물 종양. 20000 읽기, NE 및 pWT EE에서 0.64와 네브라스카의 EE = Tcf4Het / + Apc분 / +, p= 0.03 웰 치 교정으로 2-표본 t-검정을 사용 하 여. 바이스 에서 적응. 2017,6. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5 : EE 중재 변경 다음의 EE Tcf4Het / + Apc분 / + 동물. R-ggplot2 문 Proteobacteria와 Alphaproteobacteria, Betaproteobacteria, 및 Gammaproteobacteria 클래스에에서 변화를 나타내는 상자-수염 음모를 생성. Outliers는 원으로 표시 됩니다. p= 0.005 웰 치 정정 2 샘플 t-테스트를 사용 하 여. 오류 바 평균 (SEM)의 표준 오차를 사용 하 여 계산. 바이스 에서 적응. 2017,6. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6 : Sutterella 다음의 EE의 관계 되는 풍부의 변화 Tcf4Het / + Apc분 / + 동물. Outliers는 원으로 표시 됩니다. p= 0.005 웰 치 교정으로 2-표본 t-검정을 사용 하 여. 바이스 에서 SEM. 적응을 사용 하 여 계산 된 오차 막대. 2017,6. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Supplemental Table 1
보충 표 1: 분류의 박테리아 로부터 격리 NE와 EE 쥐에서 수집 된의 자. (A) 문, (B) 클래스, (C) 주문, (D) 가족, 및 (E) 속 수준 genotypes 걸쳐 분류. 네브라스카와 동일한 유전자 형의 EE 또는 하 WT의 비교 Tcf4Het / + Apc분 / +. P-값은 웰 치 교정으로 2-표본 t-검정을 사용 하 여 계산 됩니다. 바이스 에서 적응. 2017,6. 이 파일을 다운로드 하려면 여기를 클릭 하십시오.

항목 총 면적 (2인치) 총 면적 (cm2) 케이지 크기 (인치) 패 x 폭 x 높이 케이지 크기 (cm) 패 x 폭 x 높이
한 컨트롤 케이지 (네브라스카) 68.25 440.32 10.5 x 6.5 x 5.5 26.67 x 16.51 x 13.97
하나의 큰 케이지 (EE) 264.36 1706.32 13.87 x 19.06 x 7.75 35.24 x 48.42 x 19.69
두 명의 큰 감 금 소 (EE) 528.72 3412.64 13.87 x 19.06 x 7.75 @ 2 35.24 x 48.42 x 19.69 @ 2
두 가지 플랫폼 (EE) 93 600 11.8 x 3.94 x 2.95 @ 2 30 x 10 x 7.5 @ 2
두 가지 플랫폼 (EE)와 두 명의 큰 연습장 621.72 4013 13.87 x 19.06 x 7.75 + 2 11.8 x 3.94 x 2.95 @ @ 2 35.24 x 48.42 x 19.69 + 2 30 x 10 x 7.5 @ @ 2

표 1: EE와 네브라스카 케이지 크기와 평.

동물 감 금 소에 허용 필요한 인치 동물 당 제곱 EE 케이지 지역 (2인치) 총 동물 수
최대 25 12 2 (4013 cm2) 622 최대 25
25 + 15 2 (4013 cm2) 622 최대 41
쓰레기와 여성 51 2 (4013 cm2) 622 최대 12

표 2: 공간에 따라 장에 동물의 숫자를 허용 15 .

Amplicon PCR 뇌관
앞으로 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
로커 스 특정 시퀀스는 굵게 표시 됩니다 그리고 비-굵게 오버행 어댑터 시퀀스.

표 3: Amplicon PCR 뇌관.

Amplicon PCR 반응 설정
볼륨
미생물 DNA (5ng/μ) 2.5 μ
뇌관을 전달 (1 μ M; 5.1.2 단계에서) 5.0 μ
반전 뇌관 (1 μ M; 5.1.2 단계에서) 5.0 μ
뜨거운 시작 준비 믹스 X 2 12.5 μ
25.0 μ

표 4: Amplicon PCR 혼합.

Amplicon PCR 설정
3 분 동안 95 ° C
25 주기:
30 초 동안 95 ° C
30 초 동안 55 ° C
60 초 동안 72 ° C
3 분 동안 72 ° C
4 ° C에서 개최

표 5: Amplicon PCR 프로그램을 설정합니다.

인덱스 PCR 바코드 어셈블리
DNA 2.5 μ
인덱스 뇌관 1 (N7XX) 2.5 μ
인덱스 뇌관 2 (S5XX) 2.5 μ
뜨거운 시작 준비 믹스 X 2 12.5 μ
PCR 학년 물 5 μ
25 μ

표 6: PCR 혼합 색인.

인덱스 PCR 설치
3 분 동안 95 ° C
8 주기:
30 초 동안 95 ° C
30 초 동안 55 ° C
30 초 동안 72 ° C
5 분 동안 72 ° C
4 ° C에서 개최
-20 ° C에서 저장소

표 7: 인덱스 PCR 프로그램 설정 최대

풀링을 위해 수식 농도
(Ng/μ에 DNA 농도) x 106 nM에서 농도 =
(평균 라이브러리 크기 x 660 g/mol)
이 연구에서 예가입니다.
(85.2 ng/μ) x 10 ^6 = 193.3 nM
(660 g / mol x 668 bp)

표 8: 샘플 풀링 하기 전에 정규화에 대 한 수식

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 절차는 microbiota의 자 정상 또는 종양 동물 베어링의 환경 풍부를 다음에서 분리 된의 분석에 대 한 수 있습니다. 다른 남녀의 genotypes 많은 동물을 얻기 위해 사육을 포함 하는 큰 실험 이기 때문에, 필수적 이다 동물 실험의 시작 전 사이 미생물 정상화 EE 비를 피하기 위해 관련 미생물에 대 한 효과 생물의 다양성입니다.

네브라스카 및 전자 상태 사이의 일관성을 위해 번 식 과정은 모든 마우스 처음 같은 미생물에 노출 해야 하 고, 따라서, 비슷한 미생물 내용 것으로 예상 된다 위해 수행 됩니다. 그것은 가능한, 그리고 그 마우스 유전자, 미생물 구성에 영향을 줍니다. 이러한 이유로, 유전자 형 당 마우스 숫자는 대변을 소비 하는 어떤 동물 든 지는 미생물의 유사한 다양성을 발생할 것입니다 특정 조건은 NE와 EE 사이 유지 됩니다.

실험 EE를 디자인할 때 몇 가지 어려움은 명백한 있습니다. 첫째, 동물 실험에 필요한 총 수 실험 내용에 따라 달라 집니다 하지만 총 수 또한 장에 허용 하는 동물의 수에 의해 제한 됩니다. 예를 들어 예비 EE 실험에서 기록 데이터 주변 마우스 생존 정의 이전 실험에서 관찰 메커니즘 기본 향상 된 생존 하는 동물의 수를 계산 하기 위해 사용 되었다. 이 데이터를 비교 그룹에 17 동물의 총 어디 알파 2 면 t-검정에 생존에 차이 감지 하는 80% 전원에 대 한 필요 했다 = 0.05. 그래서, 실험적인 그룹에 있는 감 금 소 당 20-24 (또는 41) 동물 대 제어 그룹에서 4-5 동물 파워 계산을 수용 해야 합니다. 따라서, 여러 가지 제어 그룹 연습장 실험 케이지 함께 필요 합니다. 또한, 복잡 한 genotypes, 그것 어렵다 필요한 번 식 암컷의 큰 번호를 필요로 각 유전자의 충분 한 동물 번호를 얻을. 그러나, 적은 유전자 변형 차이 현재 다른 모델, 동일한 유전자의 더 많은 동물 들이이 시스템에서 분석 될 수 있다와 적은 브리 더 필요 하다. 미국에서 12 임신 여성 공간 (표 2)의2 에서 633에 보관 수 있습니다. 이 문제는 새끼 나이가, 그들은 더 많은 공간을 차지. 남자 새끼는 14-21 일 여성 새끼에서 분리 되어, 그 특정 국가에 공간 규칙을 승인 된 예외 가능 있을 수 있습니다. 그렇지 않으면, 남성 및 여성 새끼 genotyped 수 선택 하 고 다음 최대 마우스 숫자 아래에 있어 어머니와 젊은 나이에 분리. 이러한 연구에 대 한 승인을 얻을 하 고 공간 제한에 현지 규칙을 준수 하는 필수적 이다. 마지막으로, microbiota, 함께 microbiota 구성에도 작은 차이 감지 하는 데 필요한 동물의 수는 선험적으로계산 하기 어려운. 이 연구에 (서) 동안 중요 한 차이 microbiota에 동물의 수가 증가 하는 것 이라고 microbiota EE 쥐 사이 더 많은 변수 또는 약간 변경 되는 EE에 의해 공개 수 그룹 당 4 동물 들과 함께 발견 됐다.

이 방법 문서에서는 특정 장비와 침구는 사용 되, 표면에는 필수적인 나타나지 않을 수 있습니다. 그러나, 일관성에 영향을 주는 여러 가지 비 명백한 문제 발생 될 수 있습니다 하 고 비싼,이 매우 큰에 착수 하 고 시간이 많이 걸리는 연구 이전에 해결 되어야 필요가 있다. 하나의 주요 문제는 케이지 환기. 장에 동물의 큰 숫자, 환기는 문제가 되 고 제어 및 실험적인 감 금 소 사이 일관 된 환경을 제공 하려고 할 때 대부분 연구자를 고려 하지 않습니다 문제입니다. 설명된 설정에서 모든 새 장을 실험에 걸쳐 환기를 맞춰야 하는 제어 통풍이 캐비닛에 배치 됩니다 새 장. 이 때 통풍이 캐비닛에 적합 하지는 않습니다 연습장 사용 하 여 수행할 수 없습니다. 다른 실험 사이 환기를 정상화 하 고 제어 하는 것을 의미 하지만 이러한 메서드는이 연구에서 탐험 하지 동물을 테스트 하 고 일관 되 게 적용, 수. 침구 비슷한 일관성 문제가 발생합니다. 이 연구에 사용 된 결 장 암 모델 시스템, 소화기 질환을가지고 있는 동물 침구, 특정 유형의 섭취는 특히 옥수수 속 침구, 소화 방해 및 질병. 그것은 동물 섭취 하지 않으면 점령, 제어 환경에서 침구를 경우 마음에 계속 해야 합니다. 이 현상 및 후속 일관성 없는 건강 효과 모든 데이터 뿌리깊은 영향을 줍니다.

16S ribosomal 유전자는 세균성 인구를 공부 하는 수단으로 사용 되었습니다. 그것은 유전 가변성, v 1-v 9과 세균성 종39사이 상대적으로 변함 산재 보존된 지역 9 개 지역 포함. V1-V3 지역 특히, 종 수준 id39의 높은 확률을 제공합니다. 유사한 V1-V3 대 장 암 (CRC)에 연구와 고급 대 장 Adenoma 관심의 3 문의 있는 변화: Bacteroidetes, Firmicutes, 및 Proteobacteria21,,4041. 그것은 또한 알려졌다 운동 미생물 인구 이동 하 고 Firmicutes42증가로 이어질 수 있습니다. 이러한 이유로이 연구 adenoma 및 CRC에 변경 될 것으로 알려져 이러한 문의에 잠재적으로 환경 농축의 효과 정의 하는 16 metagenomic 라이브러리 준비 프로토콜22 다음 V1-V3 뇌관을 사용 하 여 미생물 인구를 확인. 이 절차는 증폭 하 고 다른 변수 영역 16S rRNA 유전자의 순서를 수정할 수 있습니다. 한 가지 방법은 microbiota 프로브에 의해 식별 됩니다 샘플에 존재의 계통 발생 분류 이해 하 프로브 일치를 사용 하는 것입니다. 이 방법에서는, 프로브를 구체적으로 정의 하 고 phylogenetically 이익의 미생물 분류 대상 수 있습니다. 이 대변 샘플에 있는 microbiota의 다른 특성을 허용 하 고 종양 질병의 진행에 영향을 미칠 수 있습니다 마우스를 베어링의 미생물에서 추가 EE 종속 변경 공개 수 있습니다.

Sutterella 베어링 동물 종양의 EE를 따라 가장 변경된 속으로 확인 되었습니다 속이이 절차를 사용 하 여. 이 절차는 인간 질병의 유전자 변형된 모델에 미생물 구성에 섭 동 효과 분석 하는 것을 의미 하는 어떤 방법 든 지를 활용 하는 연구에 맞게 적용할 수 있습니다. 예를 들어 전자, 대신 마우스 Sutterella 접종 미생물 생물 다양성을 증가 하 고 16 주 된 남성 종양 동물 베어링에서 수리를 상처 충분 한 인지 정의를 Sutterella 로 주사 될 수 있습니다.

의심의 여지가,이 프로토콜의 가장 독특한 측면 EE 이전 microbiota 정상화 및 전자 연구에 걸쳐 미생물 다양성을 유지 하는 우려입니다. 미생물 연구는 지속적으로 개선 하 고, 이후 그것은 특성화는 미생물에 대 한 보다 강력한 방법, 발생 하 고이 프로토콜에 미생물 특성화 무용지물이 될 것입니다. 예를 들어 현재 연구 16S rRNA를 증폭 하는 데 사용 하는 프로브는 조사는 선택 되 고 모든 박테리아는 미생물에 특성화 하지 않습니다에 따라 바이어스를 있다. 조사는 미생물을 특성화 하는 데 사용 하는 방법을 향상 시킬 의심할 여 지 없이 것입니다, 디자인 하 고 실행 하는 전자의 기초 실험 전자 실험의 필수적인 패싯 유지 됩니다 염두에는 미생물의 정규화를 유지 하는 동안.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 그들은 충돌의 관심을가지고 선언.

Acknowledgements

B. 달리는 통계 조언과 국립 암 연구소 수상 P30 CA042014에 의해 지원 되는 이러한 기술 코어에 대 한 액세스에 대 한 유타 대학 생물 통계학 핵심 라이브러리 시퀀싱 및 K. 바우처에 대 한 유타 대학 게놈 코어에는 감사 합니다. 설명 하는 프로젝트는 국립 암 연구소 보조금 P01 CA073992 K01 CA128891와 사냥꾼 암 재단에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics