Метод для определения последствий экологических обогащения на биоразнообразие Микрофлора толстой кишки в мышиной модели опухоли толстой кишки

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Экологические обогащения (EE) является средой стойлового содержания, используемый для выявления механизмов, которые лежат в основе связи между образ жизни, стресс и болезни. Этот протокол описывает процедуру, которая использует модель мыши опухолей толстой кишки и EE конкретно определить изменения в микробиоты биоразнообразия, которые могут повлиять на животных смертности.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Несколько недавних исследований показали благотворное влияние жизни в среде обогащается на улучшении болезней человека. В мышей экологическая обогащению (EE) уменьшает tumorigenesis, активации иммунной системы мыши или влияет на выживаемость животных подшипник опухоли, стимулируя рану ремонт реагирования, включая улучшение микрофлора разнообразия, в микроокружения опухоли. Условии Вот подробные процедуры для оценки воздействия экологических обогащения на биоразнообразие микрофлора в мышиной модели опухоли толстой кишки. Описаны меры предосторожности относительно разведения сельскохозяйственных животных и соображения для животных генотип и мыши интеграции колонии, все из которых в конечном итоге влияет на микробного разнообразия. Слушая эти меры предосторожности могут позволить более равномерное микрофлора передачи и следовательно снимет-лечение зависит от эффектов, которые можно смешивать выводы исследования. Кроме того в этой процедуре, Микробиота изменения характеризуются использованием 16S рДНК секвенирования ДНК, изолированных от стула, собранных от дистальной двоеточие после долгосрочных экологических обогащения. Кишка микробиоты дисбаланс ассоциируется с патогенезе воспалительных кишечника болезни и рака толстой кишки, но и ожирения и диабета среди других. Важно отметить, что этот протокол для EE и микрофлора анализа могут быть использованы для изучения роли микрофлора патогенеза различных заболеваний, где существуют надежные мыши модели, которые можно резюмировать болезней человека.

Introduction

Экологическая обогащению (EE) исследования используют сложные жилья параметры влияют на социальные стимуляции (клетки большой корпус, больших групп животных), когнитивной стимуляции (хижины, туннелей, раскроя материалов, платформ) и физической активности (работает колеса). EE был использован много лабораторий, чтобы понять воздействие повышенной активности и улучшение социального и когнитивные взаимодействия на начало заболевания и прогрессии, используя широкий спектр моделей мыши, в том числе Парикмахерские искусственный алопеция, болезнь Альцгеймера, Синдром Ретта и несколько опухоли и пищеварительных болезней модели1,2,3,4,5,6.

Были разработаны несколько мышь модели для изучения опухолей толстой кишки у мышей. Возможно наиболее четко модель является мышь Apcмин . Apcмин мышь была разработана в лаборатории William голубя в 1990 году7и был использован как модель мыши мутаций в гене APC , которые обычно связаны с человеческой колоректального рака. В отличие от людей, укрывательство APC мутации, мышей Apcмин прежде всего Разработайте небольшие опухоли кишечника, с очень редко опухолей толстой кишки. Однако Tcf4Het аллелей с одной knockin нокаут гетерозиготных мутации в Tcf4, значительно увеличивает опухолей толстой кишки при сочетании с Apcмин аллеля8. Недавно эта модель мыши опухолей толстой кишки был использован для определения воздействия EE на толстой кишки tumorigenesis6. В Bice и др. исследования, физиологические и фенотипические эффекты EE на мужчин и женщин в четырех различных мыши линий (одичал тип (WT), Tcf4Het / + Apc+/ +, Tcf4+/ + Apcмин / +, и Tcf4 Het / + APCмин / +)) были определены. Возможно наиболее интересно было что EE значительно увеличивает продолжительность жизни как мужчин, так и женщин толстой кишки опухоль подшипник животных. Это свидетельствует, что EE может уменьшить по крайней мере некоторые из симптомов, связанных с опухолей толстой кишки и улучшения здоровья животных. Удивительно это улучшение жизни мужчин не является прямым результатом сокращения tumorigenesis и вместо этого был связан с начала опухоль ранозаживляющее ответ, в том числе улучшение микрофлора биоразнообразия6.

Несколько EE конкретные исследования были опубликованы с интересные результаты. Однако с технической точки зрения, важные результаты часто не могут быть переведены в другие лаборатории. Поддержание идентичные EE методологий между различными лабораториями является невероятно сложный вопрос, не только за счет обогащения устройства и жилищного строительства используется, но также постельные принадлежности, еда, вентиляция, селекции, генетики, активность в комнате и животных протокол требования, среди прочих9,10,11. Одним из примеров является животных интеграции, где животные должны быть стабильно интегрированы в колонии мыши, поэтому нормализация генетический состав фона и диеты, чтобы избежать-лечение соответствующих эффектов. Кроме того, многие EE исследования были завершены до реализации важности микрофлора в болезни и то, что общие практики животноводства мыши может влиять на состав10,микрофлора кишечника12.

Размещения стратегии и животных селекции в EE может увеличить стресс, если не выполняется должным образом. Поскольку исследования EE использовать большое количество как мужские и женские животных, так и несколько генотипов, экспериментальная установка может быть трудно учитывая требование для животных из нескольких пометов сочетаться. Таким образом селекции и отлучение стратегия была разработана для объединения отлученных животных правильным генотипа из разных пометов. Главным обоснованием для этого было нормализовать микрофлору среди пометов и уменьшить стресс, когда животные были перемещены в экспериментальной среде. Микрофлора была передана от плотины10. Предоставлять микробного разнообразия в колонию, женщины были приобретены у Джексона Labs и интегрированы в колонии на один месяц, прежде чем начался эксперимент9,10,12. Для дальнейшей нормализации микрофлора биоразнообразия между животными, женщины были совместно размещены до размножения. После разведения, коммунальных квартирах во время воспитания и возможность избежать щенков кормящих улучшить уровень стресса матери13,14, возможно содействия нормализации микрофлора. Для предотвращения не EE воздействия на микрофлора, этот коммунальных квартирах всех подопытных животных помешала боевых и дополнительных стресс, возникающая при объединении несколько мужчин из разных пометов в один экспериментальный клетку. Наконец равное количество животных всех генотипов были включены в клетках. Это предоставило возможность для улучшения микробиоты разнообразия различных генотипов и удалены вклад копрофагия (животного тенденцию потреблять табуретки) или возможные различия в поведении генотип конкретных к изучению общей.

Этот протокол предусматривает стратегию, которая расширяет предыдущие исследования EE включить известных аспектов микрофлора исследований, включая микрофлору передачи и животных колонии интеграции для нормализации микробиоты, чтобы включить более равномерное микрофлора населения между подопытных животных. Слушая эти меры предосторожности важно из-за различия-лечение связанных микробиоты способность смешивать выводы исследования. Устранение не EE связанные изменения микробиоты позволит исследователям конкретно определить роль EE на микробиоту композиции во время развития болезни и прогрессии.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все методы, описанные здесь были исполнены в соответствии с протоколами, утвержденным на институциональный уход животных и использование Комитет (IACUC) в университете штата Юта.

1. экспериментальный дизайн и EE и Настройка управления Кейдж

Примечание: Для справки, иллюстрируется наброски экспериментального дизайна (рис. 1).

  1. Управления (NE) и EE клеток (Рисунок 2).
    1. Чтобы настроить СВ клетки, используйте газобетона обычного управления клетках (Таблица 1), которые не хватает обогащения устройств.
    2. Для больших клетках сверлят одно отверстие в клетке, что является достаточно большим, чтобы вместить втулку и туннель (Таблица материалов).
    3. Чтобы настроить воспитания щенка и EE клетки, подключите два больших клетках газобетона с стерилизованные люверсах обеспеченных туннель и 2 стерилизованные платформы для увеличения площади (Таблица 1). Для EE экспериментов предоставляют стерилизованные запуска колеса, туннелей, иглу, хижины, обхода шарики и раскроя материала в клетках EE.
    4. Место EE и NE клетки в вентилируемых стойку для предоставления равных вентиляции.
      Примечание: Две большие клетки с 2 платформы (Таблица 1) позволяют максимум 12 беременных женщин за щенка, воспитание установки15 (см. Таблицу материалы, шаг 3.2 в документе и Таблица 2).
    5. Кормовых мышей ad libitum облученных стандартные Чоу и автоклавного обратного осмоса вода.
    6. Обеспечивают мышей с стерильных постельные принадлежности материалы.
      Примечание: Все манипуляции пустых клеток и клеток с животных должно быть сделано в капот для предотвращения загрязнения. Для манипуляции в клетке крупных клеток Закройте отверстие в клетке с липкой пленкой.
  2. Готовить животных для разведения. Группа дом 15 2 - месячного самок в один большой клетке (Таблица 1) за 2 недели до вязки. Отдельно дом 2 - месячного. помёте мужчины за 2 недели до вязки.
    Примечание: Количество женщин для разведения зависит эксперимент и количество животных, требуется. В этом исследовании, 15 женщин были использованы для получения 12 подключили женщин, который является максимальное число разрешенных в щенка, воспитание установки, описанные в 1.1.2 (Таблица 2).
  3. Для разведения, объединить родитель и дамбы животных, 1 кобель за 2 суки. Первая проверка утром должна быть для вагинальных свечей, которые могут быть признаком визуальный, что животные вязка в ночное время.
    Примечание: Дом кобеля и суки вместе, пока каждая самка подключена. Вагинальные вилка можно определить визуально, если он является внешним.
    1. Чтобы обнаружить внутреннюю вилки, зонд вставляется во влагалище и если присутствует Вагинальные вилка, зонд вставляется не легко (16; см. раздел 4.3.6).
      Примечание: Запись утром вилка определяется как ½ дня, так как спаривания произошло в ночь.
    2. После вагинальных свечей у самок, перевести их на большой щенка, воспитание клетка для группы жилья с другими растяжением самок (установка на шаге 1.1.2 без обогащения устройств).
    3. Заменить повязана самок с новой unmated группы размещается самок для спаривания и продолжить спаривания получить максимальное количество пометов в 7-дневный период.
      Примечание: Все животные должны иметь дату поставки в течение 7 дней друг от друга.
  4. Разрешить беременные самки рожают в группе жилья таким образом, чтобы все пометы вызываются в один большой щенка, воспитание Кейдж (установка на шаге 1.1.2 без обогащения устройств).
    1. Отслеживать номера щенка и рождений и начать генотипирования щенков в возрасте 7 дней.
      1. Татуировка щенков на их пальцы в возрасте с числовой код для идентификации их13,177 дней.
      2. Очистить мыс с 70% этанола и осторожно вставьте устройство микро тату, содержащий чернил на поверхности кожи, параллельно с ног17 (см. Таблицу материалы).
      3. Соберите ткани с ножницами для генотипирования из хвоста советы, промо небольшой кусок ткани от 7 - дневных новорожденных.
    2. Изолировать genomic дна из ткани и выполнять ПЦР с помощью обычного метода отчаянный, как описано в 18.
    3. Отдельные животные секс в 14-21 дней в большие клетки с матерями.
      Примечание: Убедитесь, что старшего возраста щенков способны прокормить свои собственные, и что молодые щенки продолжать медсестра до старого достаточно, чтобы прокормить их собственных.
    4. 21-28 дней распределяют мужские и женские животных отдельно от генотипа в NE или EE средах, убедившись в том сохранить равные пропорции каждого генотипа в клетке (рисA).
      Примечание: Убедитесь, что общее количество животных, допускается в каждой клетке, NE или EE основывается на максимальное число допускаемых IACUC (Таблица 2). СВ клетки имеют более 5 животных (Таблица 2). В клетках EE, для социальной стимуляции, не менее 20 и с ограничений пространства не более чем 41 животных должно допускаться в клетке EE (Таблица 2).

2. стул коллекции в возрасте 16 недель

  1. Начать коллекции стула 1-2 дня до жертву и отдельно собирать табурет на в день жертвоприношения во время вскрытия, используя стерильные инструменты.
    Примечание: Сбор Кала в то же время 1-2 дней до сбора может помочь избежать потери образца из-за возможности, что нет стула в момент сбора.
    1. Чтобы собрать стул от живых животных, тщательно загривок животного более чистой клетке. Соберите стул, с использованием стерильный пинцет в стерильных отцентрифугировать трубку.
      Примечание: Животные обычно устранит стула когда прикол, который позволяет для быстрого табурет коллекции непосредственно в трубу стерильных отцентрифугировать. Если животное не испражняются сразу, когда прикол, поместите его в клетку чистой и ждать животного к дефекации (обычно до 1 ч).
    2. Сбор Кала в день жертвоприношения.
      1. Для euthanizing животных, место животного в колпаке, содержащий небольшой контейнер с ватный тампон, смоченный в изофлюрановая. После прекращения дыхания наблюдается (обычно после 2 мин), положите животное на его обратно, чтобы позволить Колон рассечение.
      2. Применить 70% этанола в брюшную полость мыши.
      3. Снять кожу предшествовавшие уретры открытия с щипцами и используйте ножницы, чтобы вырезать вдоль вентральной midline до достижения грудной клетки и отрезать от основания первого разреза к каждой ногой. Загнуть кожи и используйте ножницы, чтобы вырезать через брюшной стенки в той же схеме.
      4. Используйте корнцанг понять дистальной части толстой кишки в анус вскрыть и отсоединить дистальной части толстой кишки из прямой кишки. Потянув двоеточие вертикально с щипцами, используйте ножницы, чтобы прорваться через брыжейка выпустить толстой кишки.
      5. Вырезать толстой кишки чуть ниже слепой кишки и заложить его на фильтровальной бумаге. Используйте корнцанг поднять в верхней части трубки Колон, открытия просвета позволяют одной стороне открытых ножницы должны быть вставлены. Разрезанные продольно, дистальнее проксимальный и скошенный открыть двоеточие вдоль пополам.
      6. Соберите стул от дистальной части толстой кишки в стерильных отцентрифугировать трубку с помощью стерильный пинцет.
  2. Табурет магазин в отцентрифугировать трубку на-80 ˚C до времени бактериальной ДНК изоляции.
    Примечание: В день жертвоприношения, помимо стула Соберите другие образцы как цельная кровь, сыворотка, плазма, нормальный и опухолевой ткани из толстой и тонкой кишки, микросом, жировой ткани и т.д. для решения определенных вопросов в исследовании.

3. геномной ДНК изоляции от стула

Примечание: Использование коммерческих комплект для изоляции микробной ДНК от стула после стула протокол обнаружения возбудителя. Удаление образцов непосредственно для-80 ˚C морозильника и хранилище на сухой лед во время взвешивания.

  1. Передачи до 220 мг табуретку чистой отцентрифугировать трубка, содержащая 1.4 мл буфера lysis комнатной температуры (RT) стул (см. Таблицу материалы).
  2. Вихревой образца за 1 мин до тщательно гомогенизировать твердых частиц (рис. 2B). Тепло подвеска до 95 градусов на 5 минут, чтобы лизировать всех бактерий (включая грамположительные бактерии).
  3. Вихревой образцы для 15 s, а затем центрифуги на 20000 x g за 1 мин до Пелле табурет тел. Передача супернатант отцентрифугировать 2-мл пробирку. Добавить одну таблетку для каждого образца для поглощения ингибиторы PCR, вихревой до тех пор, пока таблетка растворяется и Проинкубируйте образцы в РТ за 1 мин.
  4. Центрифуга для образца на 20000 x g 3 мин и передать новой трубки отцентрифугировать супернатант. Центрифуга на 20000 x g для 3 мин аликвота 15 мкл протеиназы K (20 мг/мл бульона) в новой трубки отцентрифугировать 1,5 мл. Пипетка 200 мкл пример в пробирку, содержащую протеиназы K.
  5. Добавить 200 мкл буфера lysis хлорид Гуанидиновые на трубу, вихревой тщательно для 15 s (см. Таблицу материалы) и инкубации образца на 70 градусов на 10 минут добавить 200 мкл этанола (96-100%), для трубы и перемешать хорошо, vortexing.
  6. Место кремния на основе спин столбец в коллекции 2-мл пробирку и применять образцы к столбцу. Закройте крышкой и центрифуги за 1 мин на 20000 x g.
  7. Передать новой коллекции 2-мл пробирку столбца и добавьте 500 мкл буфера 1 умывальник на столбец, Крышка центрифуги за 1 мин на 20000 x g. столбце передать новой коллекции 2-мл пробирку и столбца и добавить 500 мкл буфера мытья 2 в столбце , закрыть крышкой и центрифуги на 20000 x g 3 мин.
  8. С закрытой крышкой передача столбце для новой коллекции 2-мл пробирку и центрифуги для дополнительного 1 мин на 20000 x g для удаления остаточного мыть буфера. Передача столбце 1,5 мл, помечены отцентрифугировать трубки и элюировать пример, добавив 200 мкл Элюирующий буфер, содержащий ЭДТА мембраны (см. Таблицу материалы).
  9. Закройте крышкой и инкубировать на RT 1 мин центрифуги образца за 1 мин на 20000 x g. удалить столбец.

4. ДНК определения концентрации и подготовка проб для ПЦР

Примечание: Использовать флуориметр и флуоресцентные assay коммерчески доступных dsDNA для определения геномной ДНК концентрация каждого образца (см. Таблицу материалы). Люминесцентную краску необходимо привязать двойной мель ДНК специально.

  1. Подготовить 1: 200 разбавления каждого образца (1 мкл каждого образца в 199 мкл dsDNA Мастер микс) и 1:50 разрежения стандартов. Анализировать на флюорометр с помощью параметра dsDNA.
    Примечание: Большое количество ДНК в PCR может быть ингибирующее, таким образом, объем ДНК используется не должно быть более чем 10% от окончательного объема ПЦР. Флюорометр позволяет точное измерение ДНК в образце, как только ДНК, обязан Флюоресцентная краска будет флуоресцировать, устраняя возможный вклад загрязнителей окончательные рассчитанные концентрации ДНК. Этот уровень точный количественный имеет важное значение для вниз по течению виртуализации приложения.
  2. Подготовьте шаблоны ПЦР, разбавляют до 5 нг/мкл с соответствующим объемом 10 мм трис, рН 8,5 сделать рабочий шаблон запасов каждого образца.
  3. Хранить образцы при-20 ° C.

5. дизайн праймеров к 16S желаемого V регионов

  1. Праймеры дизайн выборочно усилить желаемого V 16S рРНК регионов.
  2. Анализировать грунты с зонд матч, с19рибосомных проекта базы данных, чтобы определить приблизительное хит ставки для различных типов.
    Примечание: Для регионов V1-V3 используется текущий исследование Опубликовано грунтовки Bosshard вперед20, которые связывают в позиции 8 в регионе V1 и 533 обратный21, которая связывает в позиции 533 в регионе V3. Грунты должны включать навеса адаптер последовательности для индексации.
  3. При проектировании грунты, включают адаптер последовательности на 5' концах каждого праймера, как это рекомендовано для 16S метагеномики секвенирования библиотеки подготовка22 (Таблица 3).
  4. Синтезировать эти большие грунты с очистки картриджа. Воссоздания сморщившимися праймеров и разбавленных PCR работающих запасов до 1 мкм в 10 мм трис, рН 8,5.

6. Ампликон ПЦР для того чтобы усилить регион(ы) V с навеса адаптер последовательности придает 22

  1. Настройка Ампликон ПЦР реакция смеси, как описано в таблице 4.
  2. Место клей ясно ПЦР пластины печать на тарелку и запустить Ампликон ПЦР с помощью параметров в таблице 5.
  3. (Необязательно) Запустите Ампликон ПЦР продукты на геля агарозы или высокая чувствительность анализа ДНК, которая позволяет количественное измерение размера ампликон (см. Таблицу материалы).
    Примечание: Ампликон размер этого исследования составляет 550 bp (рисA).

7. ПЦР очистки с использованием магнитной бусины 22

  1. Центрифуга Ампликон ПЦР-планшете быстро на 1000 x г за 1 мин для сбора конденсата.
    Примечание: ПЦР трубки полос может использоваться вместо ПЦР планшетов для сведения к минимуму загрязнения. Отменить трубки крышки и никогда не использовать.
  2. Вихревые магнитные бусы равномерно разогнать их, и добавить 20 мкл магнитной бусины для каждого Ампликон ПЦР хорошо, затем Пипетка всего тома вверх и вниз медленно 10 раз.
  3. Инкубируйте на RT на 5 мин место пластину ПЦР на магнитного стенд за 2 мин до тех пор, пока магнитные шарики собраны и супернатант ясно. Снимите и выбросьте супернатант.
  4. Мыть бусы с 200 мкл свежие 80% этанола пока пластину ПЦР на магнитной стоять и Инкубируйте 30 s на RT на магнитную подставку. Осторожно удалите супернатант.
  5. Повторите мыть во второй раз. Теперь используете кончик тонкой Пипетка удалить любые остаточные этанола из скважин и позволить воздушной сушки за 10 мин.
  6. Снять пластину ПЦР из магнитного стенд и добавьте 52,5 мкл 10 мм трис рН 8,5 каждой скважины. Пипетка вверх и вниз в 10 раз, чтобы приостановить бусины и инкубации при комнатной температуре на 2 мин.
  7. Передать магнитного стенд для сбора магнитные бусы и передачи 50 мкл супернатант на чистую тарелку ПЦР ПЦР-планшете. Место клей ясно ПЦР пластины печать на тарелку и хранить на уровне-20 ° c до одной недели.

8. Подготовка схемы пластины индекс PCR

Примечание: Для создания библиотеки V1-V3, второй ПЦР была выполнена с индексом комплекта (см. Таблицу материалы). По умолчанию схема индексирования используется для сопоставления уникальный индекс двойной комбинации для каждой выборки (рис. 3B и 23).

  1. Убедитесь, что каждый образец имеет уникальное сочетание 2 индекс грунтовки (т.е., двойной индексации).

9. Выполните индекс PCR приложить адаптер последовательности как описано 22 штрих-кодов.

  1. Передать новые 96 хорошо пластины и место в матче пластины индекс для помощи в индексации 2,5 мкл ПЦР ампликонов (чистый ампликонов).
  2. Организовать индекс 1 и индекс 2 грунты, как показано в примере графического подготовленный пластины (рис. 3B).
    Примечание: Визуальные сигналы предоставляются избежать грунтовка перепутаны: индекс 2 праймера трубы должны иметь белые шапки и ясное решение, а индекс 1 грунтовка труб шапки оранжевый и желтый раствор.
  3. Соберите индекс реакции PCR Mix, как описано в таблице 6. Смешайте закупорить вверх и вниз по 10 раз. Обложка с клей ясно ПЦР пластины печать и центрифуги для сбора на 1000 x g при комнатной температуре в течение 1 мин.
  4. Запуск индекс PCR с помощью параметров в таблице 7.

10. очистить окончательный ПЦР Библиотека

Примечание: Этот ПЦР очистки идентичен к шагу 7 выше и для выполнения ПЦР Clean-Up индекс PCR22использует магнитные бусы.

  1. Центрифуга для ПЦР-планшете от шаг 10 быстро на 1000 x г за 1 мин для сбора конденсата.
  2. Вихревые магнитные бусы равномерно разогнать их, а затем добавить 20 мкл магнитной бусины для каждого Ампликон ПЦР хорошо, затем Пипетка весь объем вверх и вниз медленно 10 раз перемешать.
  3. Инкубируйте на RT на 5 мин.
  4. ПЦР место пластину на магнитного стенд за 2 мин до тех пор, пока магнитные бусы, собираются и супернатанта ясно. Снимите и выбросьте супернатант.
  5. Мыть бусы с 200 мкл свежие 80% этанола пока пластину ПЦР на магнитной стоять и Инкубируйте 30 s при комнатной температуре на магнитную подставку. Осторожно удалите супернатант.
  6. Повторите мыть во второй раз.
  7. После второй мыть используйте кончик тонкой Пипетка удалить любые остаточные этанола из скважин и позволить воздушной сушки за 10 мин.
  8. Снять пластину ПЦР из магнитного стенд и добавьте 52,5 мкл 10 мм трис рН 8,5 каждой скважины. Пипетка вверх и вниз в 10 раз, чтобы приостановить бусины и инкубации при комнатной температуре на 2 мин.
  9. Передать магнитного стенд для сбора магнитные бусы и передачи 50 мкл супернатант на чистую тарелку ПЦР ПЦР-планшете. Место клей ясно ПЦР пластины печать на тарелку и хранить на уровне-20 ° c до одной недели.
  10. (Необязательно) Запуск индекс продуктов ПЦР на геля агарозы или высокая чувствительность анализа ДНК, которая позволяет количественное измерение размера ампликон (см. Таблицу материалы).
    Примечание: Размер окончательного индексированных библиотеки из этого исследования был 668 bp (рис. 3C-D).

11. количественно, нормализации и бассейн индексированные библиотек для виртуализации

  1. Определения концентрации ДНК каждого образца с флуориметр и набор флуоресцентных пробирного dsDNA (см. таблицу материалы).
    1. Подготовьте 1: 200 разбавления образца (1 мкл каждого образца в 199 мкл dsDNA Мастер микс, который включает буфер и реагента) для каждого из индексированных образцов и стандартов (190 мкл dsDNA мастер смеси и 10 мкл стандарта). Анализировать на флюорометр с помощью параметра dsDNA.
  2. После расчета концентрации ДНК нормализовать библиотеки путем вычисления среднего библиотека размер. Сделать это путем суммирования адаптер длины, индекс длины и размер V ампликон из грунтовки и просмотреть продукты, геля агарозы, чтобы быть уверенным, что фактический размер похож на расчетный размер (см.рис. 3C, 22).
    1. Кроме того используют пробирного ДНК высокой чувствительности, которая позволяет количественное измерение целостности ДНК, ампликон размера и концентрации (таблица материалов, Рисунок 3D).
      Примечание: В этом исследовании средняя библиотека размер был рассчитываются на основе суммирования адаптер длины, индекс Длина и размер V1-V3 ампликон из грунтовки. Средний размер был 668 bp.
    2. Концентрации образцов нормализуются с использованием формулы в таблице 8.
  3. Развести образцы 4 Нм и бассейн 5 мкл от каждого образца 4-Нм в одну трубу для виртуализации.

12. последовательность библиотеку с помощью следующего поколения системы виртуализации и анализа данных

  1. Последовательности библиотеки.
    Примечание: Для этого исследования университет штата Юта высокой пропускной способности геномики Core осуществляется библиотека денатурации и пример последовательности (как описано в 6,22).
  2. Синтаксический анализ данных.
    Примечание: Чтобы отделить данные от проб имелось, индекс чтений были определены и отделены (как описано в 22).
  3. Генерировать файлы FASTQ и использовать это для последующего анализа данных.

13. Анализ последовательности данных из библиотеки ампликон 16S

Примечание: Этот шаг выполняется, как описано в Bice и др., 20176.

  1. Установка свободно имеющиеся данные инструменты анализа (см. Таблицу материалов; 24).
  2. Соберите demultiplexed fastq файлов из последовательности данных (как описано в25,26). Отменить все разобранные последовательности.
  3. Анализ после de novo открытых таксономическая единица (ОТУ) выбора протокола (как описано в 27).
    1. Бин последовательности в один fastq файл sampleID и группы последовательностей с 97% или большее сходство в OTUs, как описано в 28. Совместите представитель последовательности основного набора с минимальным последовательности длиной 150 и 75% удостоверение29,30. Назначьте таксономии как описано28.
      Примечание: Образцы могут быть binned и проанализированы31, следуют таксономических назначения и OTU таблица строительство32.
    2. Создайте файл сопоставления, определяющий описательные имена и характеристики образцов ссылка на образец идентификации и проверки сопоставления файла33,34.
    3. Сделайте OTU сеть, которая связывает OTUs образец описания с помощью сопоставления файла35.
    4. Рассчитайте таксономии резюме с точки зрения относительного изобилия, резюмируя таксонов через участки36.
    5. Исследуйте альфа-разнообразие образцов в единой последовательности глубины соответствующие образцы. Чтобы определить соответствующую глубину Альфа разнообразия, суммируйте общее количество наблюдается в каждом примере командой биома резюмировать таблицы, как описано в 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Несколько исследований показали, что практика психофизической медицины улучшает результаты в отношении здоровья. Аналогичным образом мышей, экологическая обогащению улучшает исходы, включая улучшение жизни и опухоли раны ремонт6. Поэтому EE процедура была разработана с целью определения роли микрофлору в этот фенотип во время первой нормализации микрофлора до начала эксперимента (рис. 1). Важно отметить, что все племенные животные интегрированы в колонии мыши для по крайней мере за один месяц до начала размножения, и новорожденных щенков совместно размещены с матерями в большой клетке нормализовать микрофлору передачи до эксперимента. Когда животные между 21 и 28 дней, равное количество каждого генотипа воспитаны в их соответствующих жилья, EE или СВ сред (рисA). В 16 недель собрали стул из всех животных и гомогенизированные (рис. 2B), после чего бактериальной ДНК изоляции. Наконец 16S, которую ампликонов усиливаются от стула, микрофлора ДНК и штрих индексируются для секвенирования всех библиотек микрофлора одновременно (рис. 3). Уникальные последовательности, определенные в WT и опухоли, принимая животных в условиях NE и EE приведены на рисунке 4. Интересно, что EE не улучшить биоразнообразия в WT животных, но значительно увеличивает биоразнообразия в опухоли подшипник животных (рис. 4), демонстрируя, что этот метод позволяет улучшения биологического разнообразия. Это увеличение биоразнообразия может объясняться увеличение присутствия тип бактерии по алфавиту, с значительным увеличение классы Alphaproteobacteria и Betaproteobacteria и уменьшается в патогенные Gammaproteobacteria (Рисунок 5 ; Справочная таблица 1). Это самый большой рост в Betaproteobacteria класс — род Sutterella, вероятно, синантропных участвующих в секретируемые IgA деградации (рис. 6, также см.38).

Figure 1
Рисунок 1 : Представление временной шкалы, экспериментальной. Короткие полосы представляют windows 7-дневный, как большая часть протокола осуществляется в 7-дневный шагом. Это также помогает в визуализации различных возрастов щенка через эксперимент. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : EE и NE жилищных условий и табурет гомогенатах (как описано в протоколе). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Подготовка библиотеки микрофлора 16S. (A) неочищенную ПЦР ампликон продуктов, полученных из табуретки геномной ДНК. ()B) индексации пластины графика разработан в соответствии с программное обеспечение, используемое (Таблица материалов, 23). Комбинации, двойного индекса, I7 (индекс 1; Строка) и I5 (индекс 2; Колонка), отображаются для каждой выборки. Каждый индекс имеет 8 bp в длину. Пример номера относятся к числа соответствующих мыши от EE исследований. (C) продукты неочищенную индекс PCR. (D) анализ качества окончательного очищенной и пуле 16S библиотек. (A, C, D) Черные стрелки обозначают 550 ампликон bp и 668 bp индексированных библиотеки. Красные стрелки обозначают неспецифичные продукты, которые устраняются после очистки, как показано в D. Верхняя и Нижняя маркеры размера маркеров, добавлены примеры для размера ссылкой. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 : Изменения в альфа-разнообразии после EE из Tcf4Het / + Apcмин / + животные. Альфа-разнообразие WT и Tcf4Het / + Apcмин / + опухоли, принимая животных. На 20 000 гласит, NE и EE WT, p= 0,64 и NE и EE из Tcf4Het / + Apcмин / +, p= 0,03, используя двухвыборочный t тест с коррекцией Уэлч. Адаптировано из Bice и др., 20176. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5 : EE-опосредованной изменения после EE из Tcf4Het / + Apcмин / + животные. R-ggplot2 создается поле столбик участки, обозначающий изменения в изобилии тип бактерии по алфавиту и классов Alphaproteobacteria, Betaproteobacteria и Gammaproteobacteria. Нетипичные отмечены как круги. p= 0,005, используя двухвыборочный t тесты с коррекцией Уэлч. Планки погрешностей вычисляется Среднеквадратичная ошибка среднего значения (SEM). Адаптировано из Bice и др., 20176. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6 : Изменения в относительном изобилии Sutterella после EE из Tcf4Het / + Apcмин / + животные. Нетипичные отмечены как круги. p= 0,005, используя двухвыборочный t тест с коррекцией Уэлч. Планки погрешностей, рассчитанных с использованием SEM. адаптировано из Bice и др., 20176. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Supplemental Table 1
Справочная таблица 1: классификация бактерий, изолированы от стула, собранных от NE и EE мышей. Классификация различных генотипов на уровне Фила (A), (B) класс, порядка (C), (D) семья и род (E). Сравнение NE и EE же генотип или WT для Tcf4Het / + Apcмин / +. P-значения вычисляются с помощью двухвыборочный t тест с коррекцией Уэлч. Адаптировано из Bice и др., 20176. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Элемент Общая площадь (2дюйма) Общая площадь (2см) Кейдж размер (дюйм) L x W x H Клетка размер (см) L x W x H
Один элемент управления Кейдж (NE) 68,25 440.32 10.5 x 6.5 x 5.5 26.67 x 16.51 x 13.97
Один большой клетке (EE) 264.36 1706.32 13.87 x 19.06 х 7,75 35.24 x 48.42 x 19,69
Два больших клетках (EE) 528.72 3412.64 2 @ 13.87 x 19.06 х 7,75 2 @ 35.24 x 48.42 x 19,69
Две платформы (EE) 93 600 2 @ 11,8 x 3.94 x 2.95 2 @ 30 x 10 x 7.5
Две большие клетки с двумя платформами (EE) 621.72 4013 2 @ 13.87 x 19.06 х 7,75 + 2 @ 11,8 x 3.94 x 2.95 2 @ 35.24 x 48.42 x 19,69 + 2 @ 30 x 10 x 7.5

Таблица 1: EE и NE Кейдж размеров и площадей.

Животные допускаются в клетке Требуемые дюйма квадрат на одно животное EE область отсека (2дюйма) Общая животных разрешено
До 25 12 622 на2 (4013 см2) до 25
25 + 15 622 на2 (4013 см2) до 41
Самка с помет 51 622 на2 (4013 см2) до 12

Таблица 2: допускается количество животных в клетках, основанный на площади 15 .

Ампликон ПЦР праймеры
Вперед 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Реверс 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Локус специфических последовательностей указаны жирным шрифтом и не жирный — последовательность адаптер навеса.

Таблица 3: Ампликон ПЦР праймеры.

Ампликон ПЦР реакции, Настройка
Объем
Микробные ДНК (5ng/мкл) 2.5 мкл
Вперед грунтовка (1 мкм; от шаг 5.1.2) 5.0 мкл
Обратный грунтовка (1 мкм; от шаг 5.1.2) 5.0 мкл
2 x HotStart готовые смеси 12,5 мкл
Итого 25,0 мкл

Таблица 4: Ампликон ПЦР Mix.

Ампликон ПЦР Настройка
95 ° C 3 минуты
25 циклов:
95 ° C на 30 секунд
55 ° C за 30 секунд
72 ° C для 60 секунд
72 ° C 3 минуты
Держите при температуре 4 ° C

Таблица 5: Ампликон ПЦР программа создана.

Индекс PCR штрих Ассамблея
ДНК 2.5 мкл
Грунтовка индекс 1 (N7XX) 2.5 мкл
Индекс грунт 2 (S5XX) 2.5 мкл
2 x HotStart готовые смеси 12,5 мкл
ПЦР класс воды 5 мкл
Итого 25 мкл

Таблица 6: индекс PCR Mix.

Индекс PCR установки
95 ° C 3 минуты
8 циклов:
95 ° C на 30 секунд
55 ° C за 30 секунд
72 ° C на 30 секунд
72 ° C за 5 минут
Держите при температуре 4 ° C
Хранить при температуре от-20 ° C

Таблица 7: индекс PCR программы установить вверх

Образец концентрации формулы для объединения
(Концентрация ДНК в нг/мкл) x 106 = концентрация в Нм
(660 г/моль x размер средняя библиотека)
Пример из этого исследования является:
(85.2 нг/мкл) x 10 ^ 6 = 193.3 Нм
(660 г / моль x 668 bp)

Таблица 8: Формула для нормализации до объединения образцов

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Эта процедура позволяет для анализа микробиоты, изолированных от стула после экологическая обогащению нормальный или опухоли, принимая животных. Потому что эти большие экспериментов, которые включают размножения для получения многих животных разных полов и генотипов, нормализующее микрофлора между животными до начала эксперимента важно избежать не EE воздействия на микрофлора биоразнообразие.

Для обеспечения согласованности между NE и EE условий процесс размножения проводится для обеспечения всех мышей первоначально подверженности же микробы и, поэтому, как ожидается, будут иметь аналогичные микрофлора содержимое. Это возможно, и вероятно, что мышь генотип влияет состав микрофлора. По этой причине мышь чисел на генотип поддерживаются между NE и EE условия, чтобы быть уверенным, что любое животное, которое потребляет табурет столкнутся аналогичные разнообразие микрофлора.

Некоторые трудности проявляются при проектировании EE экспериментов. Во-первых общее количество животных для экспериментов зависит от экспериментальных детали, но общее число ограничивается количество животных в клетке. Например исторических данных близлежащих мыши выживания в предварительного эксперимента EE были использованы для вычисления числа животных, чтобы определить механизм базового выживания улучшение наблюдается в предыдущих экспериментах. Из этих данных, в общей сложности 17 животных в группе сравнения необходимы для 80% мощности обнаружить различия в выживаемости в двухсторонняя t тест, где альфа = 0,05. Таким образом 4-5 животных в контрольной группе против 20-24 (или до 41) животных в клетке в экспериментальной группе должна учитывать мощность вычислений. Таким образом несколько управления группа клетки необходимы наряду с экспериментальной клетке. Кроме того со сложными генотипов, трудно получить достаточного числа животных каждого генотипа, который требует большого числа необходимых размножающихся самок. Однако с другими моделями, где меньше трансгенных различия присутствуют, больше животных же генотипа могут быть проанализированы в этой системе и меньше селекционеров являются необходимыми. В Соединенных Штатах 12 беременных женщин могут быть размещены в 6332 пространства (Таблица 2). Проблема с этим является, что, как щенков старше, они занимают больше места. Учитывая, что мужских детёнышей отделены от женского щенков в 14-21 дней, утвержденные исключения правила пространства в некоторых странах может быть осуществимо. В противном случае, мужские и женские щенков может быть генотипируемого и выбран и затем отдельно в более молодом возрасте с матерями, чтобы оставаться ниже максимальной мыши чисел. Важно, чтобы получить одобрение для этих исследований и соблюдать местные правила ограничений пространства. Наконец с микробиоты, количество животных, необходимых для обнаружения даже небольшие различия в составе микробиоты трудно вычислить априори. В этом исследовании, существенные различия в микробиоты были найдены с 4 животных на группы, вполне возможно, что увеличение этого числа животных будет выявить микробиоты, более переменной между EE мышей или лишь слегка изменен EE.

Этот метод статья описывает особенности используются оборудование и постельных принадлежностей, который на поверхности может оказаться необходимым. Однако несколько не очевидные вопросы, которые затрагивают последовательность можно столкнуться и должны быть рассмотрены до приступать на эти очень большой, дорогой и времени исследования. Одной из основных проблем является клетка вентиляции. С большим количеством животных в клетке вентиляция становится проблемой и является проблемой, что большинство исследователей не принимать во внимание при попытке обеспечить последовательное средах между элементом управления и экспериментальной клетки. Все клетки в описанных установки помещаются в вентилируемых сравнять счет вентиляции через экспериментальный и контроль клетки. Это не может быть достигнуто при использовании клетки что делать, не вписываются в вентилируемых. Другие средства для нормализации вентиляции между экспериментальной и контролировать животных может быть протестированы и последовательно применяется, но эти методы не рассматриваются в настоящем исследовании. Аналогичные вопросы согласованности возникают с постельным бельем. В системе модель рака толстой кишки, используемые в данном исследовании, животных, которые пищеварительные болезни будет глотать некоторых видов постельных принадлежностей, особенно кукурузного початка постельные принадлежности, ведущих к пищеварительной завалов и болезни. Важно иметь это в виду, если животных известны глотать постельные принадлежности, когда заняты не иначе, как в среде управления. Это явление и последующими несовместимыми здоровье окажут глубокое воздействие на все данные.

Гена 16S рибосомных использовалась как средство для изучения бактериальных популяций. Он содержит девять регионов, которые выражают генетической изменчивости, V1-V9 и перемежаются сохранившихся регионов, которые остаются относительно неизменными между бактериальных видов39. V1-V3 региона, в частности, обеспечивает наибольшую вероятность идентификации видов уровне39. Подобные V1-V3 исследования на колоректального рака (CRC) и расширенный аденома толстой кишки обнаружил изменения в трех типах интерес:40,21,Bacteroidetes, Фирмикуты и бактерии по алфавиту41. Он также сообщил, что упражнения могут переложить микробной популяции и приведет к увеличению Фирмикуты42. По этой причине это исследование определены микрофлора населения с помощью грунтовки V1-V3 после 16S метагеномных библиотека приготовительный протокол22 потенциально определить последствия экологических обогащения на эти типы, известный должна быть изменена в аденома и КПР. Эта процедура может быть изменен для усиления и последовательности других переменных регионах 16S рРНК генов. Одним из способов является использование зонда матч понять филогенетическое классифицирование микрофлору в пример, в котором будут определяться зонд. Таким образом зонды могут быть направлены конкретно определить и классифицировать филогенетически микробы интерес. Это позволяет различных характеристик микробиоты, присутствующих в образцов стула и может выявить дополнительные EE-зависимые изменения в микрофлора опухоли, принимая мышей, которые могут повлиять на развитие болезни.

С помощью этой процедуры, род, который Sutterella была определена в качестве наиболее измененные род после EE опухоли, принимая животных. Эта процедура может быть адаптирована с учетом исследования, которые используют любой метод, означало для анализа последствий возмущений на микрофлора композиция генетически модифицированных моделях заболеваний человека. Например вместо EE, мышей может быть прививанным с Sutterella чтобы определить, является ли прививки Sutterella достаточно увеличить микробного разнообразия и ранение ремонт 16-недельных мужчин опухоли, принимая животных.

Несомненно самый уникальный аспект этого протокола является заботой нормализующее микрофлору до EE и сохранение разнообразия микрофлора во всем EE исследования. Так как микрофлора исследования постоянно улучшаются, вполне вероятно, что возникнут более надежные методы для характеризующие микрофлора, и характеристика микрофлора в этот протокол будет устарели. Например с нынешнего исследования, датчики, используемые для того чтобы усилить 16S рРНК имеют уклон, в зависимости от датчиков, которые выбираются и не характеризуют всех бактерий, присутствующих в микрофлора. Хотя методы, используемые для обследования и характеризуют микрофлора несомненно улучшится, основой проектирования и запуска EE экспериментов, хотя помня о нормализации микрофлора будет оставаться важным аспектом EE экспериментов.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что они имеют без конфликта интересов.

Acknowledgements

Мы благодарим B. Далли в ядре Университет Юты геномика для библиотеки виртуализации и K. Буше в ядре биостатистики университета Юты статистический совет, и доступ к эти технические ядер, поддержке Национального института рака премии Р30 CA042014. Описанный проект была поддержана национальной CA073992 P01 гранты института рака и K01 CA128891 и Фонд рака егерь.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics