एक विधि एक माउस बृहदांत्र ट्यूमर मॉडल में बृहदांत्र Microbiome जैव विविधता पर पर्यावरण संवर्धन के प्रभाव को परिभाषित करने के लिए

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

पर्यावरण संवर्धन (EE) एक पशु आवास वातावरण है कि तंत्र है कि जीवन शैली, तनाव, और रोग के बीच कनेक्शन आबाद प्रकट किया जाता है । इस प्रोटोकॉल का वर्णन एक प्रक्रिया है कि बृहदांत्र tumorigenesis और EE के एक माउस मॉडल का उपयोग करता है विशेष रूप से microbiota जैव विविधता में परिवर्तन है कि पशु मृत्यु दर को प्रभावित कर सकते है परिभाषित करते हैं ।

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हाल के कई अध्ययनों से मानव रोग में सुधार पर एक समृद्ध वातावरण में रहने के लाभकारी प्रभाव सचित्र है । चूहों में, पर्यावरण संवर्धन (EE) माउस प्रतिरक्षा प्रणाली को सक्रिय करने के द्वारा tumorigenesis कम कर देता है, या ट्यूमर microenvironment में सुधार microbiome विविधता सहित घाव की मरम्मत प्रतिक्रिया, उत्तेजक द्वारा ट्यूमर असर पशु अस्तित्व को प्रभावित करता है । यहां प्रदान की एक विस्तृत प्रक्रिया के लिए एक माउस बृहदांत्र ट्यूमर मॉडल में microbiome की जैव विविधता पर पर्यावरण संवर्धन के प्रभाव का आकलन है । पशु प्रजनन और पशु जीनोटाइप और माउस कॉलोनी एकीकरण के लिए विचार के बारे में सावधानियों का वर्णन कर रहे हैं, जिनमें से सभी अंततः माइक्रोबियल जैव विविधता को प्रभावित । इन सावधानियों ध्यान अधिक वर्दी microbiome संचरण की अनुमति हो सकती है, और फलस्वरूप गैर उपचार निर्भर प्रभाव है कि अध्ययन निष्कर्षों को मिल सकता है कम हो जाएगा । इसके अलावा, इस प्रक्रिया में, microbiota परिवर्तन लंबी अवधि के पर्यावरण संवर्धन के बाद बाहर पेट से एकत्र मल से अलग डीएनए के 16S rDNA अनुक्रमण का उपयोग विशेषता है । आंत microbiota असंतुलन भड़काऊ आंत्र रोग और पेट के कैंसर के रोगजनन के साथ जुड़ा हुआ है, लेकिन यह भी मोटापे और मधुमेह के अंय लोगों के बीच । महत्वपूर्ण बात, EE और microbiome विश्लेषण के लिए इस प्रोटोकॉल को विभिंन रोगों की एक किस्म में microbiome रोगजनन की भूमिका का अध्ययन जहां मजबूत माउस मॉडल मौजूद है कि मानव रोग दोहराऊंगा कर सकते है का उपयोग किया जा सकता है ।

Introduction

पर्यावरण संवर्धन (EE) अध्ययन सामाजिक उत्तेजना (बड़े आवास पिंजरों, पशुओं के बड़े समूहों) को प्रभावित करने के लिए जटिल आवास मापदंडों का उपयोग, संज्ञानात्मक उत्तेजना (झोपड़ियों, सुरंगों, घोंसले में सामग्री, प्लेटफार्मों) और शारीरिक गतिविधि (चल रहा है पहियों) । EE कई प्रयोगशालाओं द्वारा उपयोग किया गया है वृद्धि की गतिविधि के प्रभाव को समझने के लिए और सुधार सामाजिक और रोग दीक्षा और प्रगति पर संज्ञानात्मक बातचीत माउस मॉडल की एक विस्तृत सरणी का उपयोग कर, प्रेरित खालित्य सहित नाई, अल्जाइमर रोग, Rett सिंड्रोम, और कई ट्यूमर और पाचन रोग मॉडल1,2,3,4,5,6

कई माउस मॉडल चूहों में बृहदांत्र tumorigenesis अध्ययन करने के लिए विकसित किया गया है । शायद सबसे अच्छी तरह से परिभाषित मॉडल Apcन्यूनतम माउस है । apcमिनट माउस १९९०7में विलियम कबूतर की प्रयोगशाला में विकसित किया गया था, और आमतौर पर मानव कोलोरेक्टल कैंसर के साथ जुड़े रहे हैं कि Apc जीन में उत्परिवर्तन के एक माउस मॉडल के रूप में इस्तेमाल किया गया है. apc उत्परिवर्तनों बंदरगाह मानव के विपरीत, APCंयूनतम चूहों मुख्य रूप से छोटे आंत्र ट्यूमर का विकास, बृहदांत्र ट्यूमर के बहुत ही दुर्लभ घटना के साथ । हालांकि, Tcf4में एक एकल knockin नॉकआउट heterozygous उत्परिवर्तन के साथ एक Tcf4हेत एलील, काफी बृहदांत्र tumorigenesis बढ़ जाती है जब Apcमिनट एलील8के साथ संयुक्त । हाल ही में, बृहदांत्र tumorigenesis के इस माउस मॉडल के लिए बृहदांत्र tumorigenesis6पर EE के प्रभाव का निर्धारण किया गया है । Bice एट अलमें । अध्ययन, पुरुषों और चार अलग माउस लाइनों (वंय-प्रकार (WT) की महिलाओं पर EE के शारीरिक और phenotypic प्रभाव, Tcf4हेत/+ सुरक्ष+/+, Tcf4+/+ apcमिनट/ Tcf4 हेत ु/ Apcमिनट/) परिभाषित किया गया । शायद सबसे दिलचस्प लग रहा था कि EE काफी दोनों पुरुष और महिला बृहदांत्र ट्यूमर-असर जानवरों की उंर बढ़ जाती है । यह है कि EE कम से कम बृहदांत्र tumorigenesis के साथ जुड़े लक्षणों में से कुछ, और पशु स्वास्थ्य में सुधार कर सकते है प्रदर्शन किया । उल्लेखनीय है, पुरुषों में इस सुधार की उम्र कम tumorigenesis का प्रत्यक्ष परिणाम नहीं है, और इसके बजाय सुधार microbiome जैव विविधता6सहित एक ट्यूमर घाव हीलिंग प्रतिक्रिया की दीक्षा से जुड़ा हुआ था.

कई अपनाओ विशिष्ट अध्ययन रोचक परिणामों के साथ प्रकाशित किया गया है । तथापि, एक तकनीकी दृष्टिकोण से, महत्वपूर्ण परिणाम अक्सर अंय प्रयोगशालाओं के लिए अनुवाद नहीं कर रहे हैं । विभिंन प्रयोगशालाओं के बीच समान अपनाओ के तरीके को बनाए रखना एक अविश्वसनीय रूप से जटिल मुद्दा है, न केवल संवर्धन उपकरणों और आवास के कारण इस्तेमाल किया, लेकिन यह भी बिस्तर, भोजन, वेंटिलेशन, प्रजनन, आनुवंशिकी, कमरे में गतिविधि, और पशु प्रोटोकॉल आवश्यकताओं, दूसरों के बीच9,10,11। एक उदाहरण पशु एकता है, जहां जानवरों को चाकू से माउस कॉलोनी में एकीकृत किया जाना चाहिए, इसलिए आनुवंशिक पृष्ठभूमि और आहार संरचना सामांय, गैर से बचने के लिए उपचार से संबंधित प्रभाव । इसके अलावा, कई EE अध्ययन रोग में microbiome के महत्व की प्राप्ति से पहले पूरा कर लिया गया है, और जिस तरह से है कि आम माउस पशुपालन प्रथाओं आंत microbiome10,12की संरचना को प्रभावित कर सकते हैं ।

प्रजनन रणनीति और पशु नियुक्ति अपनाओ में अगर ठीक से प्रदर्शन नहीं किया तो तनाव बढ़ सकता है । के बाद से EE अध्ययन दोनों पुरुष और महिला जानवरों और कई पादी की बड़ी संख्या का उपयोग, प्रयोगात्मक सेटअप मुश्किल हो सकता है कई कूड़े से पशुओं के लिए संयुक्त किया जा आवश्यकता दी । इसलिए, एक प्रजनन और प्रातः रणनीति अलग कूड़े से सही जीनोटाइप के प्रातः पशुओं के संयोजन के लिए अनुमति देने के लिए विकसित किया गया था । इस के लिए प्राथमिक औचित्य को कूड़े के बीच microbiota सामांय और तनाव को कम करने के लिए जब पशुओं प्रयोगात्मक वातावरण में ले जाया गया था । microbiome को बांध10से प्रेषित किया गया । कालोनी के लिए माइक्रोबियल विविधता प्रदान करने के लिए, महिलाओं जैक्सन लैब्स से खरीदे गए थे और एक महीने के लिए कॉलोनी में एकीकृत प्रयोग से पहले9,10,12शुरू किया । पशुओं के बीच microbiome जैव विविधता को और सामान्य करने के लिए, महिलाओं को प्रजनन से पहले सह-स्थित किया गया था । प्रजनन के बाद, सांप्रदायिक आवास पालन और नर्सिंग पिल्ले से बचने की क्षमता के दौरान मातृ देखभाल13,14के तनाव के स्तर में सुधार, संभवतः आगे microbiome सामांयीकरण । microbiome पर गैर-EE संबंधित प्रभाव को रोकने के लिए, सभी प्रायोगिक पशुओं के इस सांप्रदायिक आवास से लड़ने और अतिरिक्त तनाव है कि जब एक प्रयोगात्मक पिंजरे में विभिन्न कूड़े से कई पुरुषों के संयोजन हुआ रोका । अंत में, सभी पादी के पशुओं के बराबर संख्या पिंजरों में शामिल थे । यह पादी भर में सुधार microbiota जैव विविधता के लिए अवसर प्रदान की है, और coprophagia के योगदान को हटा दिया (पशुओं के मल का उपभोग करने की प्रवृत्ति) या संभव जीनोटाइप-समग्र अध्ययन के लिए विशिष्ट व्यवहार मतभेद

यह प्रोटोकॉल एक ऐसी कार्यनीति प्रदान करता है जो microbiome अनुसंधान के ज्ञात पहलुओं को शामिल करने के लिए पिछले EE अध्ययनों को विस्तृत करती है, जिसमें microbiota सामांयीकरण के लिए microbiota ट्रांसमिशन और एनिमल कॉलोनी एकीकरण, अधिक समान microbiome आबादी सक्षम करना है प्रायोगिक पशुओं के बीच । इन सावधानियों ध्यान गैर की क्षमता के कारण आवश्यक है उपचार संबंधित microbiota मतभेदों को पाया अध्ययन निष्कर्षों के लिए । गैर-ee संबंधित microbiota परिवर्तन को दूर करने के शोधकर्ताओं विशेष रूप से रोग के विकास और प्रगति के दौरान microbiota संरचना पर अपनाओ की भूमिका को परिभाषित करने के लिए सक्षम हो जाएगा ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी तरीके यहां वर्णित प्रोटोकॉल के अनुसार में प्रदर्शन किया गया संस्थागत पशु देखभाल और उपयोग समिति (IACUC) यूटा के विश्वविद्यालय में द्वारा अनुमोदित ।

1. प्रयोगात्मक डिजाइन और EE और नियंत्रण पिंजरे सेटअप

नोट: संदर्भ के लिए, प्रयोगात्मक डिजाइन की एक रूपरेखा (चित्रा 1) सचित्र है ।

  1. सेट अप नियंत्रण (NE) और EE पिंजरों (चित्रा 2) ।
    1. NE पिंजरों की स्थापना के लिए, पारंपरिक नियंत्रण पिंजरों (1 तालिका) कि कमी संवर्धन उपकरणों का उपयोग autoclaved ।
    2. बड़े पिंजरों के लिए, एक grommet और सुरंग (सामग्री की मेज) को समायोजित करने के लिए काफी बड़ा है कि पिंजरे प्रति एक छेद ड्रिल ।
    3. पिल्ला पालन और EE पिंजरों स्थापित करने के लिए, एक निष्फल grommet सुरक्षित सुरंग और 2 निष्फल प्लेटफार्मों के साथ दो बड़े autoclaved पिंजरों कनेक्ट मंजिल अंतरिक्ष (तालिका 1) को बढ़ाने के लिए । ee प्रयोगों के लिए, प्रदान निष्फल पहियों, सुरंगों, igloos, झोपड़ियों, क्रॉल गेंदों, और घोंसले में सामग्री अपनाओ पिंजरों के भीतर ।
    4. एक हवादार रैक में दोनों EE और NE पिंजरों जगह बराबर वेंटिलेशन प्रदान करते हैं ।
      नोट: दो बड़े पिंजरों के साथ 2 प्लेटफार्मों (तालिका 1) 12 की एक अधिकतम के लिए अनुमति दें पिल्ला पालन के प्रति गर्भवती महिलाओं सेटअप15 ( सामग्री की तालिकादेखें, दस्तावेज़ में ३.२ कदम है, और 2 तालिका) ।
    5. फ़ीड चूहों विज्ञापन libitum विकिरणित मानक चाउ और autoclaved रिवर्स असमस पानी ।
    6. बाँझ बिस्तर सामग्री के साथ चूहों प्रदान करें ।
      नोट: खाली पिंजरों और पशुओं के साथ पिंजरों के सभी जोड़तोड़ डाकू में किया जाना चाहिए संक्रमण को रोकने के लिए । बड़े पिंजरों के पिंजरे में हेरफेर के लिए, एक चिपकने वाला फिल्म के साथ पिंजरे में छेद कवर ।
  2. प्रजनन के लिए पशुओं को तैयार करें । समूह घर १५ २-एक बड़े पिंजरे में महीने पुरानी महिलाओं (तालिका1) संभोग करने से पहले 2 सप्ताह के लिए । अलग से 2 सप्ताह के लिए 2 महीने पुराने littermate पुरुषों संभोग करने से पहले ।
    नोट: प्रजनन के लिए महिलाओं की संख्या प्रयोग और पशुओं की संख्या के लिए आवश्यक पर निर्भर है । इस अध्ययन में, 15 महिलाओं को प्राप्त करने के लिए उपयोग किया गया 12 महिलाओं को दूर कर दिया, जो अधिकतम संख्या है पिल्ला पालन सेटअप में अनुमति दी 1.1.2 (2 तालिका) में वर्णित है.
  3. प्रजनन के लिए, पूर्वज और बांध पशु, 2 महिलाओं प्रति 1 पुरुष गठबंधन । सुबह में पहली जांच योनि प्लग के लिए होना चाहिए, जो एक दृश्य संकेत है कि जानवरों रात के दौरान साथी है हो सकता है ।
    नोट: घर पुरुषों और महिलाओं को एक साथ जब तक प्रत्येक महिला खामियों को दूर किया है । एक योनि प्लग नेत्रहीन पहचाना जा सकता है, अगर यह बाहरी है ।
    1. आंतरिक प्लग का पता लगाने के लिए, एक जांच योनि खोलने में डाला जाता है और अगर योनि प्लग मौजूद है, जांच आसानी से डाला नहीं है (16; अनुभाग 4.3.6 देखें) ।
      नोट: सुबह का रिकॉर्ड एक प्लग ½ दिन के रूप में पता चला है, के बाद से संभोग रात में हुई ।
    2. एक बार महिलाओं योनि प्लग है, उंहें एक बड़े अंय साथी महिलाओं के साथ समूह के आवास के लिए पिंजरा पालन करने के लिए स्थानांतरण (संवर्धन उपकरणों के बिना 1.1.2 चरण में सेटअप) ।
    3. नए विचाराधीन समूह के साथ साथी महिलाओं की जगह संभोग के लिए महिलाओं को घर में रखा और एक 7 दिन की अवधि में कूड़े की एक अधिकतम संख्या प्राप्त करने के लिए सहवास जारी है ।
      नोट: सभी जानवरों एक दूसरे के 7 दिनों के भीतर एक प्रसव की तारीख होनी चाहिए ।
  4. गर्भवती महिलाओं को समूह के आवास में जन्म देने के लिए अनुमति दें ताकि सभी कूड़े एक बड़े के अंदर उठाया पिल्ला पालन पिंजरा है (संवर्धन उपकरणों के बिना 1.1.2 कदम में सेटअप) ।
    1. पिल्ला संख्या और जन्मतिथि का ट्रैक रखें, और उम्र के 7 दिनों में genotyping पिल्ले शुरू करते हैं ।
      1. उनकी उंगलियों पर टैटू पिल्ले एक संख्या कोड के साथ उम्र के 7 दिनों में उन्हें13,17की पहचान करने के लिए.
      2. ७०% इथेनॉल के साथ पैर की अंगुली साफ और धीरे एक माइक्रो-टैटू युक्ति युक्त त्वचा की सतह में पैर की अंगुली17 ( सामग्री की तालिकादेखें) के समानांतर स्याही डालें ।
      3. 7 दिन पुराने नवजात शिशुओं से ऊतक का एक छोटा सा टुकड़ा incising द्वारा पूंछ सुझावों से genotyping के लिए कैंची के साथ ऊतक ले लीजिए ।
    2. ऊतक से जीनोमिक डीएनए को अलग और 18में वर्णित के रूप में एक पारंपरिक हॉटशॉट विधि का उपयोग कर पीसीआर प्रदर्शन.
    3. मां के साथ बड़े पिंजरों में 14-21 दिन में सेक्स द्वारा अलग जानवरों ।
      नोट: पुराने पिल्ले अपने दम पर फ़ीड करने में सक्षम हैं कि सुनिश्चित करें, और छोटे पिल्ले अपने दम पर फ़ीड करने के लिए काफी पुराने तक नर्स के लिए जारी है ।
    4. 21-28 दिन में, पुरुष और मादा पशुओं को अलग से जीनोटाइप द्वारा वितरित NE या EE वातावरण में, पिंजरे के प्रति प्रत्येक जीनोटाइप के बराबर अनुपात रखने के लिए सुनिश्चित कर (चित्रा 2) ।
      नोट: सुनिश्चित करें कि प्रत्येक पूर्वोत्तर या EE पिंजरे में अनुमत पशुओं की कुल संख्या IACUC (तालिका 2) द्वारा अनुमत अधिकतम संख्या पर आधारित है । NE पिंजरों सबसे अधिक 5 जानवरों (2 तालिका) में है । ee पिंजरों में, सामाजिक उत्तेजना के लिए, कोई 20 से कम है, और अंतरिक्ष प्रतिबंध के साथ, कोई अधिक से अधिक ४१ जानवरों EE पिंजरे में अनुमति दी जानी चाहिए (तालिका 2) ।

2.16 सप्ताह की आयु में मल संग्रह

  1. मल संग्रह शुरू 1 से 2 दिन पहले बलिदान करने के लिए, और अलग से बाँझ उपकरण का उपयोग कर विच्छेदन के दौरान बलिदान के दिन पर मल इकट्ठा ।
    नोट: एक ही समय में 1-2 दिन संग्रह करने से पहले मल एकत्रित करने की संभावना है कि कोई स्टूल संग्रह के समय मौजूद है के कारण एक नमूना के नुकसान से बचने में मदद मिल सकती है ।
    1. जीवित पशुओं से मल इकट्ठा करने के लिए, ध्यान से एक साफ पिंजरे के ऊपर जानवर scruff । एक बाँझ microfuge ट्यूब में बाँझ संदंश का उपयोग कर स्टूल ले लीजिए.
      नोट: जानवरों आमतौर पर मल जब मैटीरियल, जो तेजी से मल संग्रह के लिए सीधे एक बाँझ microfuge ट्यूब में अनुमति देता है समाप्त होगा । अगर कोई जानवर तुरंत ख़ारिज नहीं लगाता है, तो उसे साफ पिंजरे में रखें और जानवर को ख़ारिज (आमतौर पर 1 ज तक) की प्रतीक्षा करें ।
    2. कुर्बानी के दिन पर स्टूल लीजिए ।
      1. पशु euthanizing के लिए, एक घंटी isoflurane में लथपथ एक कपास की गेंद के साथ एक छोटे कंटेनर युक्त जार में पशु जगह है । एक बार सांस लेने की समाप्ति (आमतौर पर 2 मिनट के बाद) मनाया जाता है, अपनी पीठ पर जानवर रखना बृहदांत्र विच्छेदन अनुमति देते हैं ।
      2. माउस पेट में ७०% इथेनॉल लागू करें ।
      3. संदंश के साथ मूत्रमार्ग खोलने के लिए त्वचा पूर्वकाल लिफ्ट, और ribcage तक पहुंचने तक ventral midline के साथ कटौती करने के लिए कैंची का उपयोग करें, और प्रत्येक पैर की ओर पहला चीरा के आधार से कटौती. त्वचा वापस गुना और एक ही पैटर्न में पेरिटोनियल दीवार के माध्यम से कटौती करने के लिए कैंची का उपयोग करें ।
      4. संदंश का उपयोग करने के लिए गुदा में बाहर बृहदांत्र काटना करने के लिए और मलाशय से बाहर बृहदांत्र अलग समझ । जबकि संदंश के साथ खड़ी बृहदांत्र खींच, कैंची का उपयोग करने के लिए अन्त्रपेशी के माध्यम से काटने के लिए बृहदांत्र जारी ।
      5. बस अंधान्त्र नीचे बृहदांत्र काट और यह फिल्टर कागज पर रखना । संदंश का प्रयोग करें बृहदांत्र ट्यूब के ऊपर उठा, लुमेन खोलने के लिए खुली कैंची के एक पक्ष की अनुमति के लिए डाला जाएगा । कट longitudinally, समीपस्थ के लिए बाहर, और splay बृहदांत्र लंबाई खुला ।
      6. बाँझ संदंश का उपयोग कर एक बाँझ microfuge ट्यूब में बाहर बृहदांत्र से स्टूल ले लीजिए ।
  2. में एक microfuge ट्यूब में स्टोर स्टूल-८० ˚ सी बैक्टीरियल डीएनए अलगाव के समय तक ।
    नोट: बलिदान के दिन, मल के अलावा, बृहदांत्र और छोटी आंत, microsomes, वसा ऊतक, आदिसे पूरे रक्त, सीरम, प्लाज्मा, सामान्य और ट्यूमर ऊतक जैसे अन्य नमूनों को इकट्ठा । अध्ययन में निर्धारित प्रश्नों के समाधान के लिए ।

3. मल से जीनोमिक डीएनए अलगाव

नोट: एक स्टूल रोगज़नक़ का पता लगाने प्रोटोकॉल निंनलिखित मल से माइक्रोबियल डीएनए को अलग करने के लिए एक वाणिज्यिक किट का उपयोग । नमूने के लिए सीधे निकालें-८० ˚ सी फ्रीजर और सूखी बर्फ पर स्टोर जबकि वजन ।

  1. एक स्वच्छ microfuge ट्यूब कमरे के तापमान (आरटी) मल lysis बफर की १.४ मिलीलीटर युक्त करने के लिए २२० मिलीग्राम मल के लिए स्थानांतरण ( सामग्री की तालिकादेखें).
  2. अच्छी तरह से homogenize ठोस करने के लिए 1 मिनट के लिए भंवर नमूना (चित्रा 2बी). ९५ ˚ C करने के लिए 5 मिनट के लिए निलंबन गर्मी सभी बैक्टीरिया (ग्राम पॉजिटिव बैक्टीरिया सहित) लाइसे करने के लिए ।
  3. भंवर 15 एस के लिए नमूने और फिर २०,००० एक्स जी पर 1 मिनट के लिए मल ठोस गोली के लिए केंद्रापसारक । 2-एमएल microfuge ट्यूब करने के लिए supernatant स्थानांतरण । प्रत्येक नमूने के लिए एक गोली जोड़ें पीसीआर अवरोधकों को अवशोषित करने के लिए, भंवर जब तक गोली भंग है, और 1 मिनट के लिए आरटी पर नमूना मशीन ।
  4. 3 मिनट के लिए २०,००० x g पर नमूना केंद्रापसारक और एक नया microfuge ट्यूब के लिए supernatant हस्तांतरण । २०,००० के लिए एक्स जी पर केंद्रापसारक 3 min. Aliquot 15 proteinase K के μL (20 मिलीग्राम/एमएल स्टॉक) में एक नया १.५ एमएल microfuge ट्यूब । proteinase K युक्त ट्यूब में नमूने के पिपेट २०० μL ।
  5. ट्यूब करने के लिए guanidinium क्लोराइड lysis बफर के २०० μL जोड़ें, 15 एस के लिए अच्छी तरह से भंवर ( सामग्री की तालिकादेखें) और 10 मिनट के लिए ७० ˚ C पर नमूना मशीन. जोड़ें २०० μL के लिए इथेनॉल की ट्यूबों (96-100%) और भंवर द्वारा अच्छी तरह से मिश्रण ।
  6. एक 2-एमएल संग्रह ट्यूब में एक सिलिका आधारित स्पिन कॉलम प्लेस और नमूने कॉलम में लागू होते हैं । ढक्कन बंद करें और २०,००० x g पर 1 मिनट के लिए केंद्रापसारक
  7. एक नया 2 मिलीलीटर संग्रह ट्यूब करने के लिए स्तंभ स्थानांतरण और जोड़ें ५०० μL की धुलाई बफ़र 1 स्तंभ के लिए, स्तंभ कैप और 1 मिनट के लिए केंद्रापसारक पर २०,००० x g. स्तंभ एक नया 2 एमएल संग्रह ट्यूब के लिए स्थानांतरण और जोड़ें ५०० μL के लिए स्तंभ धोने बफर 2 , टोपी बंद करो और 3 मिनट के लिए २०,००० x g पर केंद्रापसारक ।
  8. टोपी के साथ बंद कर दिया, एक नया 2 मिलीलीटर संग्रह ट्यूब के लिए कॉलम हस्तांतरण, और २०,००० x g पर एक अतिरिक्त 1 मिनट के लिए केंद्रापसारक को हटाने के लिए अवशिष्ट धोने बफर । एक १.५ एमएल लेबल microfuge ट्यूब और elute नमूना २०० EDTA युक्त रेफरेंस बफर की झिल्ली को जोड़कर ( सामग्री की तालिकादेखें) के लिए कॉलम स्थानांतरित.
  9. बंद टोपी और आरटी पर 1 मिनट के लिए मशीन २०,००० एक्स जी में 1 मिनट के लिए नमूना केंद्रापसारक ।

4. डीएनए एकाग्रता दृढ़ संकल्प और पीसीआर के लिए नमूना तैयारी

नोट: एक fluorometer और एक व्यावसायिक रूप से उपलब्ध dsDNA फ्लोरोसेंट परख का उपयोग करने के लिए प्रत्येक नमूने में जीनोमिक डीएनए एकाग्रता का निर्धारण ( सामग्री की तालिकादेखें) । फ्लोरोसेंट डाई बाँधना चाहिए डबल असहाय डीएनए विशेष रूप से ।

  1. प्रत्येक नमूने के 1:200 कमजोर पड़ने को तैयार करें (१९९ µ एल dsDNA मास्टर मिक्स में प्रत्येक नमूने के 1 µ एल) और मानकों के एक 1:50 कमजोर पड़ने । dsDNA सेटिंग का उपयोग कर किसी fluorometer पर विश्लेषण करें ।
    नोट: पीसीआर में डीएनए की एक उच्च मात्रा निरोधात्मक जा सकता है, इसलिए इस्तेमाल किया डीएनए की मात्रा पीसीआर की अंतिम मात्रा के 10% से अधिक नहीं होना चाहिए । एक fluorometer नमूना में डीएनए के सही माप सक्षम बनाता है, के रूप में केवल फ्लोरोसेंट डाई को बाध्य डीएनए fluoresce जाएगा, अंतिम गणना डीएनए एकाग्रता के लिए संदूषण के संभावित योगदान को नष्ट करने । सटीक quantitation के इस स्तर के बहाव अनुक्रमण आवेदन के लिए आवश्यक है ।
  2. तैयार पीसीआर टेंपलेट्स 10 मिमी Tris, पीएच ८.५ के उपयुक्त मात्रा के साथ 5 एनजी/μL को पतला करने के लिए प्रत्येक नमूने के टेंपलेट शेयर काम करना ।
  3. -20 डिग्री सेल्सियस पर नमूनों की दुकान ।

5.16S वांछित वी क्षेत्रों के लिए डिजाइन प्राइमर

  1. डिजाइन प्राइमरों को चुन कर इच्छित V 16S rRNA क्षेत्रों बढ़ाना ।
  2. जांच मैच के साथ प्राइमरों का विश्लेषण, राइबोसोमल डेटाबेस परियोजना19से, विभिंन संघ के लिए अनुमानित हिट दर निर्धारित करने के लिए ।
    नोट: v1-v3 क्षेत्रों के लिए, वर्तमान अध्ययन प्रकाशित प्राइमरों Bosshard आगे20है, जो 8 की स्थिति में V1 क्षेत्र के भीतर बांध और ५३३ रिवर्स21, जो V3 क्षेत्र के भीतर ५३३ की स्थिति में बांध का इस्तेमाल किया । प्राइमर इंडेक्सिंग के लिए जारी रखें एडाप्टर अनुक्रम शामिल होना चाहिए ।
  3. जब प्राइमर डिजाइनिंग, प्रत्येक पुस्तक के 5 ' समाप्त होता है पर adapter अनुक्रम शामिल हैं, के रूप में 16S metagenomics अनुक्रमण पुस्तकालय की तैयारी22 (तालिका 3) के लिए सिफारिश की ।
  4. कारतूस शुद्धि के साथ इन बड़े प्राइमरों संश्लेषित । शुष्क प्राइमरों का पुनर्गठन और 10 मिमी Tris, पीएच ८.५ में 1 माइक्रोन के लिए एक पीसीआर काम कर स्टॉक पतला ।

6. Amplicon पीसीआर को बढ़ाना के साथ V क्षेत्र (s) बदस्तूर एडाप्टर अनुक्रम संलग्न 22

  1. तालिका 4में वर्णित के रूप में amplicon पीसीआर रिएक्शन मिक्स सेट अप करें ।
  2. प्लेट पर एक चिपकने वाला स्पष्ट पीसीआर प्लेट सील प्लेस और amplicon पीसीआर तालिका 5में मापदंडों का उपयोग कर चलाने ।
  3. वैकल्पिक) एक agarose जेल या एक उच्च संवेदनशीलता डीएनए परख है कि amplicon आकार के मात्रात्मक माप ( सामग्री की तालिकादेखें) में सक्षम बनाता है पर amplicon पीसीआर उत्पादों भागो ।
    नोट: इस अध्ययन से amplicon आकार ५५० बीपी (चित्रा 3) है ।

7. पीसीआर चुंबकीय मोतियों का प्रयोग सफाई 22

  1. amplicon पीसीआर प्लेट जल्दी से १,००० x g पर 1 मिनट के लिए संघनित्र इकट्ठा करने के लिए ।
    नोट: संदूषण को कम करने के लिए पीसीआर प्लेटों की जगह पीसीआर ट्यूब स्ट्रिप्स का इस्तेमाल किया जा सकता है । ट्यूब ढक्कन त्यागें और पुनः प्रयोग कभी नहीं ।
  2. भंवर चुंबकीय मोतियों को समान रूप से उंहें फैलाने के लिए, और प्रत्येक amplicon पीसीआर को चुंबकीय मोतियों की 20 μL अच्छी तरह से जोड़ने के लिए, तो पिपेट पूरी मात्रा ऊपर और नीचे धीरे से 10 बार ।
  3. 5 मिनट के लिए आर टी पर गर्मी । 2 मिनट के लिए एक चुंबकीय स्टैंड पर पीसीआर प्लेट प्लेस जब तक चुंबकीय मोती एकत्र कर रहे है और supernatant स्पष्ट है । supernatant को निकालें और छोड़ें ।
  4. २०० μL ताजा ८०% इथेनॉल के साथ धो मोती जबकि पीसीआर प्लेट चुंबकीय स्टैंड पर है और आरटी पर चुंबकीय स्टैंड पर 30 एस के लिए मशीन । supernatant को सावधानीपूर्वक निकालें ।
  5. एक दूसरी बार के लिए धो दोहराएं । अब, एक ठीक पिपेट टिप का उपयोग करने के लिए कुओं से किसी भी अवशिष्ट इथेनॉल को हटाने और 10 मिनट के लिए हवा सुखाने की अनुमति ।
  6. चुंबकीय स्टैंड से पीसीआर प्लेट निकालें और प्रत्येक अच्छी तरह से 10 मिमी Tris पीएच ८.५ के ५२.५ μL जोड़ें । 2 मिनट के लिए कमरे के तापमान पर मोतियों और गर्मी को निलंबित करने के लिए ऊपर और नीचे 10 बार पिपेट ।
  7. चुंबकीय मोतियों को इकट्ठा करने के लिए पीसीआर प्लेट को चुंबकीय स्टैंड पर ट्रांसफर करें और supernatant के ५० μL को क्लीन पीसीआर प्लेट में ट्रांसफर कर लें । प्लेट और स्टोर पर एक चिपकने वाला स्पष्ट पीसीआर प्लेट सील प्लेस-20 ˚ सी एक सप्ताह के लिए ।

8. सूचकांक पीसीआर के लिए एक थाली योजना की तैयारी

नोट: एक V1-V3 पुस्तकालय उत्पन्न करने के लिए, एक दूसरी पीसीआर एक सूचकांक किट के साथ प्रदर्शन किया गया था ( सामग्री की तालिकादेखें). प्रत्येक नमूने के लिए अद्वितीय दोहरे अनुक्रमणिका संयोजनों को मैप करने के लिए एक डिफ़ॉल्ट अनुक्रमण योजना का उपयोग किया गया (चित्र 3B और 23) ।

  1. सुनिश्चित करें कि प्रत्येक नमूने 2 सूचकांक प्राइमरों (यानी, दोहरी अनुक्रमण) का एक अनूठा संयोजन है ।

9. 22 वर्णित के रूप में अनुकूलक अनुक्रम के लिए बारकोड संलग्न करने के लिए सूचकांक पीसीआर प्रदर्शन ।

  1. स्थानांतरण २.५ पीसीआर amplicons के μL (क्लीन amplicons) एक नया ९६ अच्छी तरह से प्लेट और एक सूचकांक प्लेट स्थिरता में जगह के लिए अनुक्रमण में सहायता ।
  2. तैयार प्लेट ग्राफिक (चित्रा 3बी) के उदाहरण के रूप में सूचकांक 1 और सूचकांक 2 प्राइमरों की व्यवस्था ।
    नोट: दृश्य cues प्राइमर मिश्रण अप से बचने के लिए प्रदान की जाती हैं: सूचकांक 2 प्राइमर ट्यूबों सफेद टोपियां और स्पष्ट समाधान होना चाहिए, जबकि 1 प्राइमर ट्यूबों नारंगी टोपियां और पीला समाधान होना चाहिए ।
  3. तालिका 6में वर्णित के रूप में इंडेक्स पीसीआर मिक्स रिएक्शन को असेंबल करे । ऊपर और नीचे 10 बार pipetting द्वारा मिश्रण । एक चिपकने वाला स्पष्ट पीसीआर प्लेट सील के साथ कवर और 1 मिनट के लिए कमरे के तापमान पर १,००० x g पर इकट्ठा करने के लिए केंद्रापसारक ।
  4. तालिका 7में पैरामीटर्स का उपयोग करके अनुक्रमणिका पीसीआर चलाएं ।

10. शुद्धि अंतिम पीसीआर लाइब्रेरी

नोट: यह पीसीआर क्लीन अप चरण 7 के ऊपर समान है, और सूचकांक पीसीआर22की पीसीआर क्लीन अप करने के लिए चुंबकीय मोतियों का उपयोग करता है ।

  1. 1 मिनट के लिए १,००० x g पर जल्दी से 10 कदम से पीसीआर प्लेट केंद्रापसारक इकट्ठा करने के लिए ।
  2. भंवर चुंबकीय मोतियों को समान रूप से उंहें फैलाने के लिए, तो प्रत्येक amplicon पीसीआर को चुंबकीय मोतियों की 20 μL अच्छी तरह से जोड़ने के लिए, तो पिपेट पूरी मात्रा ऊपर और नीचे धीरे से 10 बार मिश्रण करने के लिए ।
  3. 5 मिनट के लिए आर टी पर मशीन ।
  4. चुंबकीय मोतियों को एकत्र कर रहे हैं और supernatant स्पष्ट है जब तक 2 मिनट के लिए एक चुंबकीय स्टैंड पर पीसीआर प्लेट प्लेस । supernatant को निकालें और छोड़ें ।
  5. २०० μL ताजा ८०% इथेनॉल के साथ धो मोतियों जबकि पीसीआर प्लेट चुंबकीय स्टैंड पर है और चुंबकीय स्टैंड पर कमरे के तापमान पर 30 एस के लिए मशीन । supernatant को सावधानीपूर्वक निकालें ।
  6. एक दूसरी बार के लिए धो दोहराएं ।
  7. दूसरा धोने के बाद, एक ठीक पिपेट टिप का उपयोग करने के लिए कुओं से किसी भी अवशिष्ट इथेनॉल को हटाने और 10 मिनट के लिए हवा सुखाने की अनुमति ।
  8. चुंबकीय स्टैंड से पीसीआर प्लेट निकालें और प्रत्येक अच्छी तरह से 10 मिमी Tris पीएच ८.५ के ५२.५ μL जोड़ें । 2 मिनट के लिए कमरे के तापमान पर मोतियों और गर्मी को निलंबित करने के लिए ऊपर और नीचे 10 बार पिपेट ।
  9. चुंबकीय मोतियों को इकट्ठा करने के लिए पीसीआर प्लेट को चुंबकीय स्टैंड पर ट्रांसफर करें और supernatant के ५० μL को क्लीन पीसीआर प्लेट में ट्रांसफर कर लें । प्लेट और स्टोर पर एक चिपकने वाला स्पष्ट पीसीआर प्लेट सील प्लेस-20 ˚ सी एक सप्ताह के लिए ।
  10. वैकल्पिक) एक agarose जेल या एक उच्च संवेदनशीलता डीएनए परख है कि amplicon आकार के मात्रात्मक माप में सक्षम बनाता है पर सूचकांक पीसीआर उत्पादों भागो ( सामग्री की तालिकादेखें) ।
    नोट: इस अध्ययन से अंतिम अनुक्रमित पुस्तकालय आकार ६६८ बीपी (चित्रा 3सी-डी) था ।

11. यों, सामांय, और अनुक्रमण के लिए अनुक्रमित पुस्तकालयों पूल

  1. एक fluorometer और एक dsDNA फ्लोरोसेंट परख किट के साथ प्रत्येक नमूने के डीएनए एकाग्रता का निर्धारण (सामग्री की तालिका देखें) ।
    1. नमूने के एक 1:200 कमजोर पड़ने तैयार (1 µ एल में प्रत्येक नमूने के १९९ µ l dsDNA मास्टर मिश्रण है, जो बफर और एजेंट शामिल हैं) अनुक्रमित नमूनों और मानकों में से प्रत्येक के लिए (१९० µ एल dsDNA मास्टर मिक्स और मानक के 10 µ एल). dsDNA सेटिंग का उपयोग कर किसी fluorometer पर विश्लेषण करें ।
  2. डीएनए एकाग्रता गणना के बाद, औसत पुस्तकालय आकार की गणना करके पुस्तकालयों को सामान्य. संक्षेप एडाप्टर लंबाई, सूचकांक लंबाई, और वी amplicon प्राइमरों से आकार के द्वारा यह मत करो, और agarose जेल द्वारा उत्पादों को देखने के लिए कुछ वास्तविक आकार की गणना आकार के समान है (चित्रा 3सी, 22देखें) ।
    1. वैकल्पिक रूप से, एक उच्च संवेदनशीलता डीएनए परख है कि डीएनए अखंडता की मात्रात्मक माप, amplicon आकार, और एकाग्रता (सामग्री की मेज, चित्रा 3डी) सक्षम बनाता है का उपयोग ।
      नोट: इस अध्ययन में, औसत पुस्तकालय आकार संक्षेप एडेप्टर लंबाई, सूचकांक लंबाई, और प्राइमरों से V1-V3 amplicon आकार के आधार पर गणना की गई थी । औसत आकार ६६८ बीपी था ।
    2. नमूनों की सांद्रता तालिका 8में सूत्र का उपयोग करके सामान्यीकृत होती है ।
  3. sequencing के लिए एक एकल ट्यूब में 4 एनएम और पूल 5 μL से प्रत्येक 4 एनएम नमूना के लिए नमूने पतला ।

12. एक अगली पीढ़ी अनुक्रमण प्रणाली का उपयोग कर पुस्तकालय अनुक्रम और डेटा पार्स

  1. लायब्रेरी अनुक्रम ।
    नोट: इस अध्ययन के लिए, यूटा के विश्वविद्यालय उच्च प्रवाह जीनोमिक्स कोर पुस्तकालय विकार और नमूना अनुक्रमण प्रदर्शन किया (के रूप में 6,22में वर्णित) ।
  2. डेटा को पार्स ।
    नोट: pooled नमूनों से डेटा को अलग करने के लिए, अनुक्रमणिका पढ़ता पहचाना और अलग किया गया (जैसा 22में वर्णित) ।
  3. FASTQ फ़ाइलें उत्पंन और अनुवर्ती डेटा विश्लेषण के लिए इस का उपयोग ।

13.16S Amplicon लाइब्रेरी से अनुक्रम डेटा का विश्लेषण करें

नोट: यह कदम Bice एट अल., २०१७6में वर्णित के रूप में किया जाता है ।

  1. आसानी से उपलब्ध डेटा विश्लेषण उपकरण स्थापित करें ( सामग्री तालिकादेखें; 24).
  2. अनुक्रम डेटा से fastq फ़ाइलों को इकट्ठा करें (जैसा कि25,26) में बताया गया है । सभी जुदा अनुक्रम छोड़ें ।
  3. de नोवो खुला वर्गीकरण इकाई (ओटू) खरीदना प्रोटोकॉल (के रूप में 27में वर्णित) का अनुसरण विश्लेषण निष्पादित करें ।
    1. बिन sampleID और समूह अनुक्रम द्वारा एक एकल fastq फ़ाइल में अनुक्रम ९७% या अधिक समानता के साथ OTUs में, के रूप में वर्णित 28। १५० और ७५% प्रतिशत पहचान29,30के न्यूनतम अनुक्रम लंबाई के साथ कोर सेट के प्रतिनिधि अनुक्रम संरेखित करें । 28वर्णित के रूप में वर्गीकरण असाइन करें ।
      नोट: नमूनों और बिन्नी31का विश्लेषण किया जा सकता है, वर्गीकरण असाइनमेंट और ओटू तालिका निर्माण के बाद३२
    2. नमूना पहचान के लिए लिंक और मैपिंग फ़ाइल३३,३४को मान्य करने के लिए नमूने की वर्णनात्मक नाम और विशेषताओं की पहचान करता है एक मैपिंग फ़ाइल बनाएँ ।
    3. कोई ओटू नेटवर्क बनाएं जो मैपिंग फ़ाइल३५का उपयोग करके नमूना विवरणों से OTUs लिंक करता है ।
    4. सापेक्ष बहुतायत के संदर्भ में वर्गीकरण सारांश भूखंडों के माध्यम से taxa संक्षेप में गणना३६
    5. नमूनों के लिए उपयुक्त वर्दी अनुक्रमण गहराई पर नमूनों की अल्फा विविधता का अन्वेषण करें. अल्फ़ा विविधता के लिए उपयुक्त गहराई को परिभाषित करने के लिए, ३७में वर्णित के रूप में, बायोम सारांश-तालिका आदेश का उपयोग करके प्रत्येक नमूने में स्वीकार्य कुल गणनाएं सारांशित करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

कई अध्ययनों से यह प्रदर्शित किया है कि मन के अभ्यास शरीर चिकित्सा स्वास्थ्य परिणामों में सुधार । इसी तरह, चूहों में, पर्यावरण संवर्धन सुधार उम्र और ट्यूमर घाव मरंमत6सहित परिणामों में सुधार । इसलिए, एक EE प्रक्रिया इस phenotype में microbiota की भूमिका को परिभाषित करने के उद्देश्य के साथ विकसित किया गया था, जबकि पहले microbiome का सामान्यीकरण प्रयोग (चित्र 1) की दीक्षा से पहले । महत्वपूर्ण बात यह है कि सभी प्रजनन पशुओं के लिए माउस कॉलोनी में एकीकृत कर रहे है कम एक महीने प्रजनन के प्रारंभ करने से पहले, और नवजात पिल्ले सह रहे है एक बड़े पिंजरे में माताओं के साथ घर के लिए प्रयोग करने से पहले microbiota संचरण सामांय । जब जानवरों के बीच 21 और 28 दिन पुराने हैं, प्रत्येक जीनोटाइप की बराबर संख्या उनके संबंधित आवास में, या तो EE या NE वातावरण (चित्रा 2) में प्रातः कर रहे हैं । 16 सप्ताह में, सभी जानवरों से मल एकत्र और homogenized है (चित्रा 2बी), बैक्टीरियल डीएनए अलगाव द्वारा पीछा किया । अंत में, 16S amplicons मल microbiome डीएनए से परिवर्धित और बारकोड एक साथ सभी microbiome पुस्तकालयों के अनुक्रमण के लिए अनुमति देने के लिए अनुक्रमित कर रहे हैं (चित्रा 3) । दोनों NE और EE स्थितियों में WT और ट्यूमर असर जानवरों में पहचान अद्वितीय दृश्यों चित्रा 4में दिखाया गया है । दिलचस्प है, EE WT पशुओं में जैव विविधता में सुधार नहीं करता है, लेकिन विशाल ट्यूमर असर जानवरों (चित्रा 4) में जैव विविधता बढ़ जाती है, का प्रदर्शन है कि इस विधि जैव विविधता में सुधार की अनुमति देता है । जैव विविधता में यह वृद्धि जाति Proteobacteria की वृद्धि हुई उपस्थिति के लिए जिंमेदार ठहराया जा सकता है, वर्गों Alphaproteobacteria और Betaproteobacteria में महत्वपूर्ण वृद्धि के साथ, और रोगजनक Gammaproteobacteria में कम हो जाती है (चित्रा 5 ; पूरक तालिका 1) । सबसे बड़ी वृद्धि Betaproteobacteria वर्ग में है जीनस Sutterella, एक संभावना गुप्त IgA गिरावट में शामिल खाना खानेवाला (चित्रा6 भी ३८ देखें) है ।

Figure 1
चित्र 1 : प्रयोगात्मक समयरेखा का प्रतिनिधित्व. लघु बैंड 7 दिन खिड़कियों का प्रतिनिधित्व करते हैं, के रूप में प्रोटोकॉल के सबसे 7 में पूरा दिन वेतन वृद्धि है । यह भी प्रयोग भर में पिल्ला उंर की सीमा के दृश्य में एड्स । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 : EE और NE आवास की स्थिति और मल homogenates (के रूप में प्रोटोकॉल में वर्णित) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3 : 16S Microbiome ग्रंथालय तयारी. () शुद्ध पीसीआर amplicon उत्पादों मल जीनोमिक डीएनए से व्युत्पंन । () अनुक्रमण प्लेट ग्राफिक प्रयुक्त सॉफ्टवेयर (सामग्री की तालिका, 23) के अनुसार डिजाइन । दोहरी सूचकांक संयोजन, I7 (सूचकांक 1; पंक्ति) और I5 (अनुक्रमणिका 2; स्तंभ), प्रत्येक नमूने के लिए दिखाए जाते हैं । प्रत्येक इंडेक्स में 8 बीपी की लंबाई है । नमूना संख्या EE अध्ययन से संबंधित माउस संख्याओं का संदर्भ लें । () शुद्ध सूचकांक पीसीआर उत्पाद । () अंतिम शुद्ध और परित 16S पुस्तकालयों का गुणवत्तापूर्ण विश्लेषण । (ए, सी, डी) काले तीर ५५० बीपी amplicon और ६६८ बीपी अनुक्रमित पुस्तकालय निरूपित । लाल तीर गैर-विशिष्ट उत्पादों को निरूपित करते है जो D में दिखाए गए अनुसार शुद्धि के बाद समाप्त होते हैं आकार संदर्भ के लिए नमूने में जोड़े गए ऊपरी और निचले मार्कर आकार मार्कर हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : अल्फा विविधता में परिवर्तन के बाद EE Tcf4हेत/+ Apcंयूनतम/ WT और Tcf4हेत/ की अल्फा विविधता + Apcमिनट/ ट्यूमर असर जानवरों । पर २०,००० पुस्तकें, ne और WT के ee, p= ०.६४ और ne और ee का Tcf4हेत/+ Apcमिनट/, पी= ०.०३ वेल्च सुधार के साथ दो नमूने टी परीक्षण का उपयोग कर । Bice एट अल., २०१७6से अनुकूलित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्र 5 : ee-मध्यस्थता परिवर्तन के बाद ee Tcf4हेत/+ Apcंयूनतम/ आर-ggplot2 उत्पंन बॉक्स-मूंछ भूखंड जाति Proteobacteria और कक्षाएं Alphaproteobacteria, Betaproteobacteria, और Gammaproteobacteria की बहुतायत में परिवर्तन टिप्पण । Outliers हलकों के रूप में विख्यात हैं । * *p= ०.००५ वेल्च सुधार के साथ दो-नमूना t-परीक्षण का उपयोग कर । त्रुटि पट्टी माध्य (SEM) के मानक त्रुटि का उपयोग करते हुए परिकलित । Bice एट अल., २०१७6से अनुकूलित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्र 6 : Sutterella के सापेक्ष बहुतायत में परिवर्तन Tcf4हेत/+ Apcमिनट/ Outliers हलकों के रूप में विख्यात हैं । * *p= ०.००५ वेल्च सुधार के साथ दो-नमूना t-परीक्षण का उपयोग कर । त्रुटि सलाखों SEM. Bice एट अल., २०१७6से अनुकूलित का उपयोग कर की गणना की । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Supplemental Table 1
पूरक तालिका 1: मल से पृथक किए गए बैक्टीरिया का वर्गीकरण NE और EE चूहों से एकत्र. (A) जाति, (B) वर्ग, (C) आदेश, (D) परिवार, और () जीनस स्तर पर पादी भर में वर्गीकरण । ण् की तुलना और उसी जीनोटाइप के अपनाओ या WT को Tcf4हेत/+ सुरक्षन्यूनतम/ P-मान वेल्च सुधार के साथ एक दो-नमूना t-परीक्षण का उपयोग कर परिकलित की जाती हैं । Bice एट अल., २०१७6से अनुकूलित । इस फ़ाइल को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

आइटम कुल क्षेत्रफल (इंच2) कुल क्षेत्रफल (cm2) पिंजरे का आकार (इंच) एल एक्स डब्ल्यू एक्स एच पिंजरे का आकार (सेमी) एल एक्स डब्ल्यू एक्स एच
एक नियंत्रण पिंजरे (NE) ६८.२५ ४४०.३२ १०.५ x ६.५ एक्स ५.५ २६.६७ x १६.५१ एक्स १३.९७
एक बड़ा पिंजरा (EE) २६४.३६ १७०६.३२ १३.८७ x १९.०६ एक्स ७.७५ ३५.२४ x ४८.४२ एक्स १९.६९
दो बड़े पिंजरों (EE) ५२८.७२ ३४१२.६४ 2 @ १३.८७ x १९.०६ x ७.७५ 2 @ ३५.२४ x ४८.४२ x १९.६९
दो प्लेटफार्म (EE) ९३ ६०० 2 @ ११.८ x ३.९४ x २.९५ 2 @ 30 x 10 x ७.५
दो बड़े पिंजरों के साथ दो प्लेटफार्मों (EE) ६२१.७२ ४०१३ 2 @ १३.८७ x १९.०६ x ७.७५ + 2 @ ११.८ x ३.९४ x २.९५ 2 @ ३५.२४ x ४८.४२ x १९.६९ + 2 @ 30 x 10 x ७.५

तालिका 1: EE और NE पिंजरे आकार और फर्श अंतरिक्ष ।

पिंजरे में पशुओं की अनुमति आवश्यक इंच प्रति पशु वर्ग EE केज क्षेत्र (इंच2) कुल पशुओं की अनुमति
25 तक 12 ६२२ में2 (४०१३ cm2) 25 तक
25 + 15 ६२२ में2 (४०१३ cm2) ४१ तक
कूड़े के साथ महिला ५१ ६२२ में2 (४०१३ cm2) 12 तक

तालिका 2: फर्श अंतरिक्ष के आधार पर पिंजरों में जानवरों की अनुमति दी संख्या 15 .

Amplicon पीसीआर प्राइमर्स
आगे 5 '-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
रिवर्स 5 '-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
लोकस विशिष्ट अनुक्रम बोल्ड में दिखाए जाते हैं और गैर-बोल्ड बदस्तूर एडेप्टर अनुक्रम है ।

तालिका 3: Amplicon पीसीआर प्राइमरों ।

Amplicon पीसीआर रिएक्शन सेट अप
वॉल्यूम
माइक्रोबियल डीएनए (5ng/μl) २.५ μl
फॉरवर्ड प्राइमर (1 माइक्रोन; से कदम 5.1.2) ५.० μl
रिवर्स प्राइमर (1 माइक्रोन; से कदम 5.1.2) ५.० μl
2x HotStart तैयार मिश्रण १२.५ μl
कुल २५.० μl

तालिका 4: Amplicon पीसीआर मिक्स ।

Amplicon पीसीआर की स्थापना की
९५ ° c 3 मिनट के लिए
के 25 चक्र:
९५ ° c 30 सेकंड के लिए
५५ ° c 30 सेकंड के लिए
७२ ° c ६० सेकंड के लिए
७२ ° c 3 मिनट के लिए
4 ° c पर होल्ड करें

तालिका 5: Amplicon पीसीआर कार्यक्रम की स्थापना की ।

सूचकांक पीसीआर बारकोड विधानसभा
डीएनए २.५ μl
इंडेक्स प्राइमरी 1 (N7XX) २.५ μl
इंडेक्स प्राइमरी 2 (S5XX) २.५ μl
2x HotStart तैयार मिश्रण १२.५ μl
पीसीआर ग्रेड पानी 5 μl
कुल 25 μl

तालिका 6: अनुक्रमणिका पीसीआर मिक्स ।

सूचकांक पीसीआर सेटअप
९५ ° c 3 मिनट के लिए
8 चक्र:
९५ ° c 30 सेकंड के लिए
५५ ° c 30 सेकंड के लिए
७२ ° c 30 सेकंड के लिए
७२ ° c 5 मिनट के लिए
4 ° c पर होल्ड करें
पर स्टोर-20 ° c

तालिका 7: अनुक्रमणिका पीसीआर प्रोग्राम सेट करें ।

नमूना एकाग्रता सूत्र पूलिंग के लिए
(एनजी/μl में डीएनए एकाग्रता) x १०६ = एनएम में एकाग्रता
(६६० g/मोल x औसत पुस्तकालय आकार)
इस अध्ययन से एक उदाहरण है:
(८५.२ एनजी/μl) x 10 ^ 6 = १९३.३ एनएम
(६६० g/मोल x ६६८ bp)

तालिका 8: नमूना पूलिंग करने से पहले मानक के लिए सूत्र

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यह प्रक्रिया सामांय या ट्यूमर असर जानवरों के पर्यावरण संवर्धन के बाद मल से अलग microbiota के विश्लेषण के लिए अनुमति देता है । क्योंकि इन बड़े प्रयोगों जो विभिंन लिंगों और पादी के कई जानवरों को प्राप्त करने के लिए प्रजनन शामिल हैं, प्रयोग के प्रारंभ करने से पहले पशुओं के बीच microbiome सामांय microbiome पर गैर-EE संबंधित प्रभाव से बचने के लिए आवश्यक है वैविध्य.

NE और EE शर्तों के बीच संगतता के लिए, प्रजनन प्रक्रिया को सुनिश्चित करना है कि सभी चूहों शुरू में एक ही रोगाणुओं के संपर्क में है और, इसलिए, इसी तरह की microbiome सामग्री की उंमीद कर रहे है आयोजित किया जाता है । यह संभव है, और संभावना है, कि माउस जीनोटाइप microbiome संरचना को प्रभावित करता है । इस कारण से, जीनोटाइप प्रति माउस संख्या NE और EE शर्तों के बीच बनाए रखा है निश्चित है कि किसी भी जानवर है कि मल का उपभोग है microbiome की एक समान विविधता का सामना करेंगे ।

EE प्रयोगों को डिज़ाइन करते समय कई कठिनाइयां स्पष्ट होती हैं । सबसे पहले, प्रयोगों के लिए आवश्यक जानवरों की कुल संख्या प्रयोगात्मक विवरण पर निर्भर है, लेकिन कुल संख्या भी पिंजरे में अनुमति जानवरों की संख्या से सीमित है । उदाहरण के लिए, एक प्रारंभिक EE प्रयोग में ऐतिहासिक डेटा माउस उत्तरजीविता आसपास के पशुओं की संख्या की गणना करने के लिए उपयोग किया गया अस्तित्व में सुधार अंतर्निहित तंत्र को परिभाषित पिछले प्रयोगों में मनाया । इस डेटा से, तुलना समूह में 17 पशुओं की कुल एक ८०% बिजली के लिए एक दो पक्षीय टी परीक्षण में अस्तित्व में एक अंतर का पता लगाने के लिए आवश्यक थे, जहां अल्फा = 0.05 । तो, 20-24 बनाम नियंत्रण समूह में 4-5 पशु (या ४१ तक) पशु प्रति पिंजरे प्रयोगात्मक समूह में एक शक्ति गणना को समायोजित करना होगा । इसलिए, कई नियंत्रण समूह पिंजरों प्रयोगात्मक पिंजरे के साथ की जरूरत है । इसके अलावा, जटिल पादी के साथ, यह हर जीनोटाइप की पर्याप्त पशु संख्या प्राप्त करने के लिए मुश्किल है, जो प्रजनन के लिए आवश्यक महिलाओं की बड़ी संख्या आवश्यक । हालांकि, अंय मॉडलों के साथ जहां कम ट्रांसजेनिक मतभेद मौजूद हैं, एक ही जीनोटाइप के अधिक पशुओं इस प्रणाली में विश्लेषण किया जा सकता है और कम प्रजनकों आवश्यक हैं । संयुक्त राज्य अमेरिका में, 12 गर्भवती महिलाओं अंतरिक्ष के2 (2 तालिका) में ६३३ में स्थित किया जा सकता है । इस के साथ मुद्दा यह है कि के रूप में पिल्ले बड़े हो, वे और अधिक स्थान ले लो । यह देखते हुए कि पुरुष पिल्ले 14-21 दिनों में महिला पिल्ले से अलग कर रहे हैं, कुछ देशों में अंतरिक्ष नियम के लिए एक अनुमोदित अपवाद संभव हो सकता है । अंयथा, पुरुष और महिला पिल्ले genotyped और चयनित किया जा सकता है, और फिर माताओं के साथ एक छोटी उंर में अलग करने के लिए अधिकतम माउस संख्या से नीचे रहने । यह इन अध्ययनों के लिए अनुमोदन प्राप्त करने के लिए और अंतरिक्ष प्रतिबंधों पर स्थानीय नियमों का पालन करने के लिए आवश्यक है । अंत में, microbiota के साथ, microbiota संरचना में भी छोटे मतभेदों का पता लगाने के लिए आवश्यक पशुओं की संख्या के लिए एक प्राथमिकताओंकी गणना करने के लिए मुश्किल है । जबकि इस अध्ययन में, microbiota में महत्वपूर्ण अंतर समूह प्रति 4 पशुओं के साथ पाया गया, यह संभव है कि पशुओं की संख्या में वृद्धि microbiota कि ee चूहों के बीच अधिक चर रहे है प्रकट होता है या केवल थोड़ा ee द्वारा बदल रहे हैं ।

यह विधि आलेख वर्णन करता है कि विशेष उपकरण और बिस्तर जो सतह पर आवश्यक प्रकट नहीं हो सकता है, जो उपयोग किया जाता है । हालांकि, कई गैर स्पष्ट मुद्दों है कि निरंतरता को प्रभावित और सामना किया जा सकता है इन बहुत बड़े, महंगी, और समय लेने वाली पढ़ाई पर तैयार करने से पहले संबोधित किया जाना चाहिए । एक प्रमुख मुद्दा पिंजरे वेंटिलेशन है । एक पिंजरे में पशुओं की बड़ी संख्या के साथ, वेंटिलेशन एक मुद्दा बन जाता है, और एक मुद्दा है कि ज्यादातर शोधकर्ताओं के खाते में नहीं ले जब नियंत्रण और प्रयोगात्मक पिंजरों के बीच सुसंगत वातावरण प्रदान करने का प्रयास है । वर्णित सेटअप में सभी पिंजरों प्रयोगात्मक और नियंत्रण पिंजरों भर वेंटिलेशन बराबर के लिए एक हवादार कैबिनेट में रखा जाता है । यह पूरा नहीं किया जा सकता है जब पिंजरों कि एक हवादार कैबिनेट में फिट नहीं का उपयोग कर । अन्य साधन प्रयोगात्मक और नियंत्रण जानवरों के बीच वेंटिलेशन सामान्य करने के लिए परीक्षण किया जा सकता है और लगातार लागू है, लेकिन इस अध्ययन में इन तरीकों का पता लगाया नहीं कर रहे हैं. बिस्तर के साथ इसी तरह की निरंतरता मुद्दों उठता । बृहदांत्र कैंसर मॉडल इस अध्ययन में इस्तेमाल प्रणाली में, पशुओं कि पाचन रोग बिस्तर के कुछ प्रकार के निगलना होगा, विशेष रूप से मकई सिल बिस्तर, पाचन रुकावटों और बीमारी के लिए अग्रणी । यह ध्यान में रखना महत्वपूर्ण है अगर जानवरों को बिस्तर निगलना जब अंयथा कब्जा नहीं है, के रूप में नियंत्रण के माहौल में जाना जाता है । इस घटना और बाद में असंगत स्वास्थ्य प्रभाव होगा सभी डेटा को प्रभावित करेगा ।

राइबोसोमल 16S जीन को बैक्टीरियल आबादी के अध्ययन के लिए एक साधन के रूप में इस्तेमाल किया गया है । यह नौ क्षेत्रों है कि आनुवंशिक परिवर्तनशीलता, V1-V9 एक्सप्रेस, और interspersed क्षेत्रों है कि जीवाणु प्रजातियों३९के बीच अपेक्षाकृत अपरिवर्तित रहना शामिल हैं । V1-V3 क्षेत्र, विशेष रूप से, प्रजातियों के स्तर की पहचान३९के उच्चतम संभाव्यता प्रदान करता है । इसी तरह की V1-V3 के अध्ययन पर कोलोरेक्टल कैंसर (सीआरसी) और उन्नत कोलोरेक्टल ग्रंथ्यर्बुद ब्याज की तीन संघ में परिवर्तन पाया: Bacteroidetes, Firmicutes, और Proteobacteria21,४०,४१. यह भी बताया गया है कि व्यायाम माइक्रोबियल आबादी को शिफ्ट करने और Firmicutes४२में वृद्धि करने के लिए नेतृत्व कर सकते हैं । इस कारण से, इस अध्ययन के लिए V1-V3 प्राइमर का उपयोग करके microbiome आबादी की पहचान एक 16S metagenomic पुस्तकालय तैयारी प्रोटोकॉल के बाद22 संभावित इन संघ ज्ञात पर पर्यावरण संवर्धन के प्रभाव को परिभाषित करने के लिए ग्रंथ्यर्बुद और सीआरसी में बदल सकता है । इस प्रक्रिया को बढ़ाना और अनुक्रम 16S rRNA जीन के अंय चर क्षेत्रों को संशोधित किया जा सकता है । एक तरह से जांच मैच का उपयोग करने के लिए नमूने में मौजूद microbiota के वंशावली वर्गीकरण को समझने के लिए है कि जांच के द्वारा पहचान की जाएगी । इस तरह, जांच के लिए विशेष रूप से परिभाषित और phylogenetically रुचि के रोगाणुओं वर्गीकृत करने के लिए लक्षित किया जा सकता है । यह मल नमूनों में मौजूद microbiota के एक अलग लक्षण वर्णन की अनुमति देता है, और ट्यूमर असर चूहों कि रोग प्रगति को प्रभावित कर सकते हैं के microbiome में अतिरिक्त ई-निर्भर परिवर्तन प्रकट हो सकता है ।

इस प्रक्रिया का उपयोग करना, जीनस Sutterella ट्यूमर असर जानवरों के EE के बाद सबसे बदल जीनस के रूप में पहचाना गया था । इस प्रक्रिया के लिए अध्ययन है कि किसी भी विधि के लिए मानव रोग के आनुवंशिक रूप से संशोधित मॉडल में microbiome संरचना पर एक गड़बड़ी के प्रभाव का विश्लेषण का उपयोग समायोजित अनुकूलित किया जा सकता है । उदाहरण के लिए, ई के स्थान पर, चूहों को परिभाषित करने के लिए कि क्या Sutterella टीका 16 में माइक्रोबियल जैव विविधता और घाव की मरंमत में वृद्धि करने के लिए पर्याप्त है कि Sutterella के साथ inoculated जा सकता है सप्ताह पुराने पुरुष ट्यूमर असर जानवरों ।

निस्संदेह, इस प्रोटोकॉल का सबसे अनूठा पहलू है microbiota को सामान्य करने से पहले अपनाओ और microbiome विविधता को बनाए रखने के लिए ई अध्ययन भर में चिंता का विषय है । चूंकि microbiome अध्ययन लगातार सुधार कर रहे हैं, यह संभावना है कि निस्र्पक के लिए और अधिक मजबूत तरीके microbiome पैदा होगा, और इस प्रोटोकॉल में microbiome लक्षण अप्रचलित हो जाएगा । उदाहरण के लिए, वर्तमान अध्ययन के साथ, जांच को बढ़ाना 16S rRNA पूर्वाग्रह है, जांच है कि चुना है पर निर्भर करता है, और microbiome में मौजूद सभी बैक्टीरिया की विशेषताएं नहीं है । जबकि microbiome सर्वेक्षण और विशेषताएं निस्संदेह में सुधार होगा तरीकों का इस्तेमाल किया, डिजाइन और अपनाओ प्रयोग चलाने के बुनियादी नींव जबकि मन में microbiome के सामांय रखने के अपनाओ प्रयोगों का एक आवश्यक पहलू रहेगा ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक घोषणा करते है कि वे हितों का कोई टकराव नहीं है ।

Acknowledgements

हम पुस्तकालय अनुक्रमण के लिए यूटा जीनोमिक्स कोर के विश्वविद्यालय में बी डैले धन्यवाद, और सांख्यिकीय सलाह के लिए यूटा के विश्वविद्यालय जैव सांख्यिकी कोर में K. बाउचर, और राष्ट्रीय कैंसर संस्थान पुरस्कार P30 CA042014 द्वारा समर्थित इन तकनीकी कोर के लिए उपयोग. वर्णित इस परियोजना को राष्ट्रीय कैंसर संस्थान अनुदान P01 CA073992 और K01 CA128891 और व्याध कैंसर फाउंडेशन ने समर्थन दिया था.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics