Een methode om de effecten van milieu verrijking op de dikke darm Microbiome biodiversiteit in een muismodel van het Colon-Tumor definiëren

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Milieu verrijking (EE) is een dierverblijven omgeving die wordt gebruikt voor het onthullen van de mechanismen die ten grondslag liggen aan de verbindingen tussen de levensstijl, stress en ziekte. Dit protocol beschrijft een procedure maakt die gebruikmaakt van een muismodel van dikke darm tumorvorming en EE aan wijzigingen in microbiota biodiversiteit die mogelijk van invloed op dierlijke sterfte specifiek te definiëren.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Verschillende recente studies hebben laten zien dat de gunstige effecten van het leven in een verrijkte omgeving op het verbeteren van ziekten bij de mens. Bij muizen, milieu verrijking (EE) tumorvorming vermindert door het activeren van het immuunsysteem van de muis, of tumor invloed dieren overleven beïnvloedt door het stimuleren van de wond reparatie reactie, met inbegrip van verbeterde microbiome diversiteit, in de communicatie van de tumor. Voorwaarde hier een gedetailleerde procedure is voor het beoordelen van de effecten van milieu verrijking op de biodiversiteit van de microbiome in een muismodel van de dikke darm-tumor. Voorzorgsmaatregelen met betrekking tot het fokken van dieren en overwegingen voor dierlijke genotype en muis integratie van de kolonie zijn beschreven, die uiteindelijk van invloed zijn op microbiële biodiversiteit. Acht te slaan op deze voorzorgsmaatregelen kan toestaan meer uniforme microbiome transmissie, en bijgevolg niet-behandeling afhankelijke effecten die studie bevindingen verwarren kunnen zal verlichten. Verder in deze procedure, worden microbiota wijzigingen gekenmerkt met behulp van 16S rDNA rangschikken van DNA geïsoleerd uit ontlasting verzameld van de distale dubbelpunt na lange termijn milieu verrijking. Gut microbiota onbalans wordt geassocieerd met de pathogenese van de ziekte en dikke darm kanker ontstoken darm, maar ook van obesitas en diabetes o.a.. Nog belangrijker is, kan dit protocol voor EE en microbiome analyse worden gebruikt om de rol van microbiome pathogenese te bestuderen in een verscheidenheid van ziekten waar de robuuste Muismodellen bestaan die ziekten bij de mens kan recapituleren.

Introduction

Milieu verrijking (EE) studies maken gebruik van complexe huisvesting parameters om sociale stimulatie (grote behuizing kooien, grotere groepen van dieren), cognitieve stimulatie (hutten, tunnels, nesten materialen, platformen) en fysieke activiteit (running wielen). EE is gebruikt door vele labs te begrijpen van de effecten van verhoogde activiteit en verbeterde sociale en cognitieve interacties op de inleiding van de ziekte en de progressie met behulp van een breed scala aan muismodellen, met inbegrip van knippen geïnduceerde alopecia, Alzheimer's disease, Rett syndroom, en verschillende tumor en spijsverterings ziekte modellen1,2,3,4,5,6.

Verschillende Muismodellen zijn ontwikkeld om te bestuderen van de dikke darm tumorvorming bij muizen. Misschien is het meest duidelijk omschreven model de ApcMin muis. De ApcMin muis werd ontwikkeld in het laboratorium van William duif in 19907, en is gebruikt als een muismodel van mutaties in het gen van de APC die vaak gekoppeld aan menselijke colorectaal carcinoom zijn. In tegenstelling tot mensen herbergen APC mutaties, ApcMin muizen voornamelijk kleine intestinale tumoren, met zeer zelden van dikke darm tumoren te ontwikkelen. Een Tcf4Het allel met een enkele knockin-knock-out heterozygote mutatie in Tcf4, verhoogt echter enorm dikke darm tumorvorming in combinatie met de ApcMin allel8. Deze muismodel van dikke darm tumorvorming is onlangs gebruikt om te bepalen van de effecten van EE op dikke darm tumorvorming6. In de Bice et al. studie, de fysiologische en fenotypische effecten van EE op mannetjes en vrouwtjes van vier verschillende muis lijnen (wild-type (WT), Tcf4Het / + Apc+/ +, Tcf4+/ + ApcMin / +, en Tcf4 Het / + APCMin / +)) zijn gedefinieerd. Misschien was het meest interessante bevinding dat EE aanzienlijk de levensduur van zowel mannelijke als vrouwelijke dikke darm tumor-dragende dieren verhoogt. Dit aangetoond dat EE ten minste verminderen kan enkele van de symptomen dubbelpunt tumorvorming is gekoppeld, en dierlijke gezondheid te verbeteren. Opmerkelijk, deze verbeterde levensduur bij mannen is niet een direct gevolg van de verminderde tumorigenesis, en in plaats daarvan was gekoppeld aan de opening van een tumor wond genezing reactie, met inbegrip van verbeterde microbiome biodiversiteit6.

Verschillende EE specifieke studies zijn gepubliceerd met interessante resultaten. Vanuit technisch oogpunt zijn belangrijke resultaten echter vaak niet vertaalbaar naar andere laboratoria. Handhaving van identieke EE methodologieën tussen verschillende laboratoria is een ongelooflijk complexe zaak, niet alleen als gevolg van verrijking apparaten en huisvesting gebruikt, maar ook beddengoed, voedsel, ventilatie, fokken, genetica, activiteit in de kamer, en dierlijke protocol eisen, o.a.9,10,11. Een voorbeeld is de integratie van het dier, waar dieren moeten worden stabiel geïntegreerd in de kolonie van de muis, dus het normaliseren van genetische achtergrond en dieet samenstelling, ter vermijding van gerelateerde effecten van de niet-behandeling. Verder veel EE studies zijn afgerond vóór de realisatie van het belang van de microbiome in de ziekte en de manier waarop dat gemeenschappelijke muis veehouderijpraktijken kunnen invloed hebben op de samenstelling van de gut microbiome10,12.

Fok strategie en dier plaatsing in EE stress kan verhogen als niet naar behoren uitgevoerd. Sinds EE studies gebruik maken van grote aantallen van zowel mannelijke en vrouwelijke dieren en meerdere genotypen, kunnen experimentele opzet moeilijk gezien de behoefte van de dieren uit verschillende nesten worden gecombineerd. Daarom werd een fok- en spenen strategie ontwikkeld zodat voor het combineren van de juiste genotype uit verschillende nesten gespeende dieren. De primaire reden hiervoor was te normaliseren van de microbiota onder nesten en ter vermindering van stress bij de dieren werden verplaatst naar de experimentele omgeving. De microbiome werd overgebracht van de dam10. Om microbiële diversiteit naar de kolonie, werden vrouwtjes gekocht van Jackson Labs en geïntegreerd in de kolonie voor één maand voordat het experiment begon9,10,12. Als u wilt verder normaliseren microbiome biodiversiteit tussen dieren, waren vrouwen mede gehuisvest vóór fokken. Zogende pups verbeterd na fokken, gemeenschappelijke huisvesting tijdens het fokken en de mogelijkheid om te ontsnappen aan de stress niveaus van maternale zorg13,14, eventueel microbiome normalisatie te bevorderen. Om te voorkomen dat niet-EE gerelateerde effecten op de microbiome, deze gemeenschappelijke huisvesting van alle proefdieren voorkomen vechten en extra stress dat is opgetreden toen het combineren van verschillende mannen uit verschillende nesten in een experimentele kooi. Tot slot, gelijke aantallen dieren van alle genotypen werden opgenomen in de kooien. Dit bood de gelegenheid voor verbeterde microbiota biodiversiteit over genotypen, en verwijderd van de bijdrage van Coprofagie (van het dier de neiging om te consumeren kruk) of mogelijke genotype-specifiek gedrags verschillen aan de algemene studie.

Dit protocol biedt een strategie die vorige EE studies breidt tot bekende aspecten van microbiome onderzoek, met inbegrip van de integratie van de microbiota transmissie en dier de kolonie voor microbiota normalisatie, om meer uniforme microbiome populaties tussen de proefdieren. Acht te slaan op deze voorzorgsmaatregelen is van essentieel belang als gevolg van het vermogen van de niet-behandeling verwante microbiota verschillen te beschamen van de bevindingen van de studie. Elimineren van niet-EE gerelateerde microbiota wijzigingen zullen onderzoekers specifiek de rol te definiëren van EE op microbiota samenstelling tijdens de ontwikkeling van de ziekte en de progressie.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle methoden die hier beschreven werden verricht overeenkomstig de protocollen die zijn goedgekeurd door de institutionele Animal Care en gebruik Comité (IACUC) aan de Universiteit van Utah.

1. de proefopzet en EE en Cage instellen

Opmerking: Ter vergelijking, een overzicht van het experimentele ontwerp is geïllustreerd (Figuur 1).

  1. Controle (NE) en EE kooien instellen (Figuur 2).
    1. Gebruiken voor het instellen van NE kooien, gesteriliseerde met autoclaaf conventionele controle kooien (tabel 1) dat het gebrek aan verrijking apparaten.
    2. Voor grote kooien, boor een gat per kooi dat is groot genoeg voor een pakkingring en tunnel (Tabel van materialen).
    3. Als u wilt instellen van pup fokken en EE kooien, sluit u twee grote gesteriliseerde met autoclaaf kooien met een beveiligde tunnel van gesteriliseerde pakkingring en 2 gesteriliseerde platforms te verhogen vloeroppervlak (tabel 1). Bieden voor EE experimenten, gesteriliseerde uitgevoerd wielen, tunnels, iglo's, hutten, crawl ballen en materiaal binnen de kooien EE nesten.
    4. Plaats zowel de EE en de NE kooien in een geventileerde rek om gelijke ventilatie.
      Opmerking: Twee grote kooien met 2 platformen (tabel 1) toestaan voor een maximum van 12 zwangere vrouwtjes per pup fokken van instelling15 (Zie Tabel van materialen, stap 3.2 in document en tabel 2).
    5. Feed muizen ad libitum bestraald standaard chow en gesteriliseerde met autoclaaf omgekeerde osmosewater.
    6. Muizen voorzien van beddengoed steriele materialen.
      Opmerking: Alle manipulaties van lege kooien en kooien met dieren moeten gebeuren in de kap om verontreiniging te voorkomen. Dekking voor de manipulatie van de kooi van grote kooien, het gat in de kooi met een zelfklevende film.
  2. Dieren voor te bereiden voor de fokkerij. Groep huis 15 2 - maand oude vrouwtjes in een enkele grote kooi (tabel 1) voor 2 weken voorafgaand aan paring. Apart huis 2 - maand oude littermate mannetjes voor 2 weken voorafgaand aan paring.
    Opmerking: Het aantal vrouwtjes voor de fokkerij is afhankelijk van het experiment en het aantal dieren nodig. In deze studie, 15 vrouwtjes werden gebruikt om het verkrijgen van 12 aangesloten vrouwtjes, die is het maximum aantal toegestane in de pup fokken setup beschreven in 1.1.2 (tabel 2).
  3. Voor de fokkerij, combineren vader en dam dieren, 1 mannetje per 2 vrouwtjes. De eerste controle in de ochtend moet voor vaginale stekkers, die mogelijk een visuele teken dat de dieren tijdens de nacht hebben gekruist.
    Opmerking: Huis mannetjes en vrouwtjes elkaar totdat elke vrouw heeft aangesloten. Een vaginale plug kan worden geïdentificeerd visueel, als er externe.
    1. U wilt opsporen verinnerlijkte stekkers, een sonde is ingebracht in de vaginale opening, en als de stekker van de vaginale aanwezig is, de sonde niet gemakkelijk ingevoegd (16; zie punt 4.3.6).
      Opmerking: Het registreren van de ochtend die een stekker is gedetecteerd als ½ dag, sinds de paring is opgetreden in de nacht.
    2. Zodra de vrouwtjes hebben vaginale stekkers, kunt u deze overbrengen naar een grote pup fokken van kooi voor groepshuisvesting met andere erop vrouwtjes (Setup in stap 1.1.2 zonder verrijking apparaten).
    3. Vervangen gekruist vrouwtjes met nieuwe unmated groep gehuisvest wijfjes voor paring en blijven paring om te verkrijgen van een maximum aantal nesten in een periode van 7 dagen.
      Opmerking: Alle dieren moeten een leverdatum binnen 7 dagen na elkaar.
  4. Toestaan dat zwangere vrouwen om geboorte te geven in de groep huisvesting zodat alle nesten worden gefokt in één grote pup fokken kooi (Setup in stap 1.1.2 zonder verrijking apparaten).
    1. Bijhouden van cijfers van de pup en geboortedata en beginnen genotypering pups op de leeftijd van 7 dagen.
      1. Tattoo pups op hun tenen op leeftijd met een numerieke code te identificeren13,17van 7 dagen.
      2. Reinigen van de teen met 70% ethanol en voorzichtig het invoegen van een micro-tattoo apparaat met inkt in het huidoppervlak parallel aan de teen17 (Zie Tabel van materialen).
      3. Verzamelen weefsel met een schaar voor genotypering van de staart tips gebeuren een klein stukje weefsel uit de 7 - dagen oude pasgeborenen door te snijden.
    2. Isoleer genomic DNA van weefsel en uitvoeren van PCR met een conventionele HotSHOT-methode zoals beschreven in 18.
    3. Afzonderlijke dieren per geslacht in 14-21 dagen in grote kooien met moeders.
      Opmerking: Zorgen dat de oudere pups kunnen voeden zich met hun eigen, en dat de jongere pups te verplegen tot oud genoeg te voeden met hun eigen blijven.
    4. 21-28 dagen, distribueert mannelijke en vrouwelijke dieren afzonderlijk genotype in omgevingen met NE of EE, om ervoor te zorgen dat gelijke verhoudingen van elk genotype per kooi(Figuur 2).
      Opmerking: Ervoor zorgen dat het totale aantal dieren toegestaan in elke kooi NE of EE is gebaseerd op het maximale aantal toegestane door IACUC (tabel 2). De NE kooien hebben hooguit 5 dieren (tabel 2). EE kooien, voor sociale stimulatie, niet minder dan 20, en met de ruimtebeperkingen, niet meer dan 41 dieren mogen in de kooi van het EE (tabel 2).

2. de ontlasting collectie op 16 weken oud

  1. Beginnen kruk collectie 1 tot 2 dagen vóór de te offeren, en afzonderlijk verzamelen kruk op de dag van offer tijdens dissectie met behulp van steriele tools.
    Opmerking: Verzamelen kruk op hetzelfde moment 1-2 dagen voorafgaand aan de collectie kan helpen om te voorkomen dat het verlies van een monster te wijten aan de mogelijkheid dat geen ontlasting aanwezig op het moment van collectie is.
    1. Te verzamelen kruk van levende dieren, zorgvuldig nekvel het dier over een schone kooi. Verzamelen van ontlasting met behulp van steriele pincet in een steriele microfuge buis.
      Opmerking: Dieren verdwijnt meestal ontlasting wanneer geïmmobiliseerd, dat voorziet in snelle ontlasting collectie direct in een steriele microfuge buis. Als een dier niet onmiddellijk poepen wanneer geïmmobiliseerd, plaatst u deze in een schone kooi en wacht voor het dier om te poepen (meestal maximaal 1 uur).
    2. Verzamelen van ontlasting op de dag van het offer.
      1. Voor de euthanizing van het dier, plaatst u het dier in een glazen stolp met een kleine container met een katoenen bal gedrenkt in Isofluraan. Zodra de beëindiging van de ademhaling wordt waargenomen (meestal na 2 min), leg het dier op zijn terug naar allow dissectie van de dikke darm.
      2. 70% ethanol toepassen in de buik van de muis.
      3. Til de huid anterior to de urethrale opening met pincet, gebruik van schaar te snijden langs de ventral midline tot het bereiken van de ribbenkast en gesneden uit de basis van de eerste snede naar elk been. Vouw terug de huid en het gebruik van schaar te snijden door de peritoneale muur in hetzelfde patroon.
      4. Gebruik pincet te begrijpen van de distale dikke darm op de anus te ontleden en loskoppelen van de distale dikke darm uit het rectum. Gebruik tijdens het trekken van de dikke darm verticaal met pincet, schaar te snijden via het mesenterium vrij te geven van de dikke darm.
      5. Snijd de dikke darm vlak onder de blindedarm en leg het op filterpapier. Pincet gebruiken om op te heffen van de top van de dikke darm buis, openen de lumen zodat één kant open schaar moet worden ingevoegd. Snijd de lengterichting, DISTAAL naar proximaal en splay open de dikke darm lengte.
      6. Ontlasting van de distale dikke darm in een steriele microfuge buis met behulp van steriele pincet verzamelen.
  2. Winkel ontlasting in een microfuge buis op-80 ˚C tot tijd van bacteriële DNA isolatie.
    Opmerking: Op de dag van opoffering, naast de kruk, andere monsters zoals bloed, serum, plasma, normale en tumor weefsel van de dikke darm en dunne darm, microsomes, vetweefsel, etcte verzamelen. om vragen te stellen die zijn gedefinieerd in de studie.

3. genomic DNA isolatie uit ontlasting

Opmerking: Gebruik maken van een commerciële kit te isoleren van de microbiële DNA uit ontlasting na een kruk protocol voor de detectie van de ziekteverwekker. Verwijder monsters direct voor de-80 ˚C vriezer en winkel op droog ijs terwijl een gewicht.

  1. Tot 220 mg van ontlasting overbrengen in een schone microfuge buis met 1,4 mL lysisbuffermengsel kamertemperatuur (RT)-kruk (Zie Tabel van materialen).
  2. Vortex monster voor 1 min te grondig Meng vaste stoffen (Figuur 2B). Verwarm de schorsing naar 95 ˚C voor 5 min lyse van alle bacteriën (met inbegrip van gram-positieve bacteriën).
  3. Vortex monsters voor 15 s en vervolgens centrifuge bij 20.000 x g gedurende 1 minuut aan de kruk-lichamen pellet. Supernatant overbrengen in een 2-mL microfuge buis. Voeg een tablet te absorberen PCR-remmers, vortex totdat de tablet wordt ontbonden, elke steekproef en Incubeer het monster bij RT voor 1 min.
  4. Centrifugeer het monster bij 20.000 x g gedurende 3 minuten en het supernatant overbrengen in een nieuwe microfuge buis. Centrifugeer bij 20.000 x g gedurende 3 min. aliquoot 15 μL van proteïnase K (20 mg/mL stockoplossing) in een nieuwe 1,5 mL microfuge buis. Pipetteer 200 μl van het monster in de buis met proteïnase K.
  5. Voeg 200 l guanidinium chloride lysis-buffermengsel aan de buis, vortex grondig voor 15 s (Zie Tabel van materialen) en Incubeer het monster bij 70 ˚C voor 10 min. 200 toevoegen μL van ethanol (96-100%) tot de buizen en meng goed door vortexing.
  6. Plaats een silica gebaseerd spin kolom in een collectie van 2-mL-buis en de monsters op de kolom. Sluit het deksel en centrifuge voor 1 min bij 20.000 x g.
  7. Overbrengen van de kolom naar een nieuwe collectie-tube van 2 mL en 500 μL van was buffer, 1 naar de kolom, cap de kolom en centrifuge voor 1 min op 20.000 x g. overdracht de kolom naar een nieuwe collectie-tube van 2 mL en voeg toe 500 μL van was buffer 2 aan de kolom toevoegen , sluit het GLB en de centrifuge op 20.000 x g gedurende 3 minuten.
  8. Met het GLB gesloten, de kolom overbrengen naar een nieuwe collectie-tube van 2 mL, en Centrifugeer gedurende een extra 1 min bij 20.000 x g te verwijderen van de resterende was buffer. De kolom overbrengen in een 1,5 mL label microfuge buis en elueer steekproef door het toevoegen van 200 μL van elutie buffer met EDTA aan het membraan (Zie Tabel van materialen).
  9. Sluit het GLB en Incubeer bij RT gedurende 1 min. Centrifuge het monster voor 1 min op 20.000 x g. negeren de kolom.

4. DNA concentratie vastberadenheid en bereiding van de monsters voor PCR

Opmerking: Gebruik maken van een Fluorimeter en een commercieel beschikbare dsDNA fluorescerende kwantitatieve analyse aan de genomic DNA-concentratie in elk monster te bepalen (Zie Tabel van materialen). De fluorescente kleurstof moet dubbele gestrande DNA specifiek binden.

  1. Maak een verdunning van de 1:200 van elk monster (1 µL van elk monster in 199 µL dsDNA master mix) en een 1:50 verdunning van normen. Analyseren op een Fluorimeter dsDNA instelling gebruikt.
    Opmerking: Een hoog volume van DNA in de PCR kan remmende, het volume van DNA gebruikt moet daarom niet meer dan 10% van het uiteindelijke volume van de PCR. Een Fluorimeter kunt nauwkeurige meting van DNA in het monster, zoals alleen DNA gebonden aan de fluorescente kleurstof fluoresceren, het elimineren van de mogelijke bijdrage van verontreinigende stoffen bij de laatste berekende DNA-concentratie. Dit niveau van nauwkeurige kwantificatie is essentieel voor de toepassing van de stroomafwaartse sequencing.
  2. PCR sjablonen verdund tot 5 ng/μL met het juiste volume van 10 mM Tris, pH 8,5 te maken werken sjabloon voorraden van elk monster voor te bereiden.
  3. Winkel monsters bij-20 ° C.

5. ontwerp inleidingen tot de 16S gewenst V regio 's

  1. Inleidingen om selectief versterken de gewenste V 16S rRNA regio's ontwerpen.
  2. Inleidingen met sonde Match, uit de Ribosomal databaseproject19, analyseren om te bepalen van de geschatte hit tarief voor verschillende stammen.
    Opmerking: Voor V1-V3 regio's, de huidige studie gebruikt gepubliceerd inleidingen Bosshard voorwaartse20, dat bindt op positie 8 binnen de V1-regio, en 533 omgekeerde21, die bindt op positie 533 binnen de V3-regio. Inleidingen dient overstek adapter sequenties voor indexering.
  3. Bij het ontwerpen van inleidingen, omvatten adapter sequenties op de 5' einden van elke primer, zoals aanbevolen voor 16S metagenomics sequencing bibliotheek voorbereiding22 (tabel 3).
  4. Het synthetiseren van deze grote inleidingen met cartridge zuivering. Gedroogde inleidingen reconstrueren en Verdun een PCR voorraad 1 μM werken in 10 mM Tris, pH 8,5.

6. Amplicon PCR te versterken de regio('s) V met Overhang Adapter sequenties verbonden 22

  1. Instellen van de amplicon PCR reactie mix zoals beschreven in tabel 4.
  2. Plaats een zelfklevende duidelijk PCR plaat zegel op de plaat en uitvoeren van de amplicon PCR met behulp van de parameters in tabel 5.
  3. (Optioneel) Amplicon PCR producten op een agarose gel of een hoge gevoeligheid DNA-test waarmee kwantitatieve meting van amplicon grootte uitvoeren (Zie Tabel van materialen).
    Opmerking: De grootte van de amplicon van deze studie is 550 bp (Figuur 3A).

7. PCR Schoonmaakbeurt met behulp van magnetische kralen 22

  1. Centrifugeer de amplicon PCR plaat snel bij 1.000 x g gedurende 1 minuut voor het verzamelen van condensatie.
    Opmerking: PCR buis stroken kunnen worden gebruikt in plaats van PCR platen om te minimaliseren van verontreiniging. Negeren van de buis deksels en nooit opnieuw gebruiken.
  2. Vortex de magnetische kralen gelijkmatig verspreiden hen, en toevoegen van 20 μL van magnetische kralen aan elke amplicon PCR goed, daarna Pipetteer het gehele volume omhoog en omlaag langzaam 10 keer.
  3. Incubeer bij RT gedurende 5 min. plaats de PCR-plaat op een magnetische staan gedurende 2 minuten totdat magnetische kralen worden verzameld en de bovendrijvende substantie duidelijk is. Verwijderen en verwijder het supernatant.
  4. Wash kralen met 200 μl verse 80% ethanol terwijl de PCR-plaat op de magnetische staan en incubeer 30 s bij RT op de magnetische stand. Verwijder voorzichtig het supernatant.
  5. Herhaal de wash voor een tweede keer. Gebruik nu een fijne pipette uiteinde te verwijderen van alle resterende ethanol uit de putten en lucht drogen gedurende 10 minuten.
  6. Verwijder de PCR-plaat uit de magnetische stand en voeg 52.5 μL van 10 mM Tris pH 8,5 aan elk putje. Pipetteer omhoog en omlaag van 10 keer te schorten kralen en Incubeer bij kamertemperatuur gedurende 2 minuten.
  7. De PCR-plaat overbrengen in de magnetische stand magnetische kralen verzamelen en overbrengen van 50 μL van de bovendrijvende substantie naar een schone PCR-plaat. Plaats een zelfklevende duidelijk PCR plaat zegel op de plaat en bewaren bij-20 ˚C voor maximaal een week.

8. bereiding van een plaat-regeling voor Index PCR

Opmerking: Voor het genereren van een V1-V3-bibliotheek, een tweede PCR werd uitgevoerd met een index kit (Zie Tabel van materialen). Een standaardschema voor indexering werd gebruikt om de kaart combinaties van de unieke dual index voor elk monster (Figuur 3B en 23).

  1. Ervoor zorgen dat elk monster een unieke combinatie van 2 index inleidingen heeft (dat wil zeggen, dubbele indexeren).

9. Voer Index PCR streepjescodes toevoegen aan de adapter sequenties beschreven 22 .

  1. 2.5 μL van PCR waarbij (schone waarbij) overbrengen in een nieuwe 96 goed plaat en breng dit in een index plaat meubilair om hulp bij het indexeren.
  2. Regelen van de index 1 en index 2 inleidingen zoals in het voorbeeld van de afbeelding bereid plaat (Figuur 3B).
    Opmerking: Visuele aanwijzingen zijn toegevoegd om te voorkomen van verwisselingen van de primer: index 2 primer buizen moeten witte doppen en heldere oplossing, terwijl index 1 primer buizen oranje caps en gele oplossing moeten.
  3. Monteer de index Mix van de PCR reactie zoals beschreven in tabel 6. Meng door pipetteren op en neer 10 keer. Bedek met een zelfklevende duidelijk PCR plaat zegel en centrifugeer om te verzamelen bij 1.000 x g bij kamertemperatuur voor 1 min.
  4. Voer de index PCR met behulp van de parameters in tabel 7.

10. het zuiveren van definitieve PCR bibliotheek

Opmerking: Deze PCR-opschonen is identiek aan stap 7 hierboven, en gebruikt magnetische kralen voor het uitvoeren van PCR Clean-Up van de index PCR22.

  1. Centrifugeer de PCR-plaat uit stap 10 snel bij 1.000 x g gedurende 1 minuut voor het verzamelen van condensatie.
  2. Vortex de magnetische kralen gelijkmatig verspreiden hen, dan toevoegen van 20 μL van magnetische kralen aan elke amplicon PCR Nou, pipetteer dan het gehele volume omhoog en omlaag langzaam 10 keer te mengen.
  3. Incubeer bij RT gedurende 5 min.
  4. Plaats PCR plaat op een magnetische staan gedurende 2 minuten totdat de parels van de magnetische verzameld en supernatant zijn is duidelijk. Verwijderen en verwijder het supernatant.
  5. Wash kralen met 200 μl verse 80% ethanol terwijl de PCR-plaat op de magnetische staan en incubeer 30 s bij kamertemperatuur op de magnetische stand. Verwijder voorzichtig het supernatant.
  6. Herhaal de wash voor een tweede keer.
  7. Na de tweede wash, gebruik een fijne pipette uiteinde te verwijderen van alle resterende ethanol uit de putten en lucht drogen gedurende 10 minuten.
  8. Verwijder de PCR-plaat uit de magnetische stand en voeg 52.5 μL van 10 mM Tris pH 8,5 aan elk putje. Pipetteer omhoog en omlaag van 10 keer te schorten kralen en Incubeer bij kamertemperatuur gedurende 2 minuten.
  9. De PCR-plaat overbrengen in de magnetische stand magnetische kralen verzamelen en overbrengen van 50 μL van de bovendrijvende substantie naar een schone PCR-plaat. Plaats een zelfklevende duidelijk PCR plaat zegel op de plaat en bewaren bij-20 ˚C voor maximaal een week.
  10. (Optioneel) Index PCR producten op een agarose gel of een hoge gevoeligheid DNA-test waarmee kwantitatieve meting van amplicon grootte uitvoeren (Zie Tabel van materialen).
    Opmerking: De grootte van de uiteindelijke geïndexeerde bibliotheek van deze studie was 668 bp (Figuur 3C-D).

11. kwantificeren, normaliseren en bundelen van de geïndexeerde bibliotheken voor het rangschikken

  1. Bepaal de concentratie van de DNA van elk monster met een Fluorimeter en een dsDNA fluorescerende assay kit (zie tabel van materialen).
    1. Maak een 1:200 verdunning van het monster (1 µL van elk monster in 199 µL dsDNA master mix, waaronder buffer en reagens) voor elk van de geïndexeerde monsters en normen (190 µL dsDNA master mix en 10 µL van standaard). Analyseren op een Fluorimeter dsDNA instelling gebruikt.
  2. Na de berekening van de concentratie DNA, de bibliotheken te normaliseren door het berekenen van de grootte van de gemiddelde bibliotheek. Doe dit door optelling van de lengten van de adapter, index lengtes en V amplicon grootte van inleidingen, en producten weergeven door agarose gel om er zeker van te zijn dat de werkelijke grootte is vergelijkbaar met de berekende grootte (Figuur 3C, Zie 22).
    1. U kunt ook gebruik maken van een hoge gevoeligheid DNA-test waarmee kwantitatieve meting van de integriteit, de grootte van de amplicon en de concentratie (tabel van materialen, Figuur 3D) DNA.
      Opmerking: In deze studie, was de gemiddelde bibliotheek grootte berekend op basis van de lengten van de adapter, index lengtes en V1-V3 amplicon grootte van inleidingen op te tellen. De gemiddelde grootte is 668 bp.
    2. Concentraties van monsters worden genormaliseerd met behulp van de formule in tabel 8.
  3. Verdun monsters naar 4 nM en zwembad 5 μl van elk monster 4-nM in een enkele buis voor het rangschikken.

12. volgorde van de bibliotheek met behulp van een volgende generatie Sequencing systeem en de gegevens parseren

  1. Het volgnummer van de bibliotheek.
    Opmerking: Voor deze studie, de Universiteit van Utah hoge doorvoer Genomics kern uitgevoerd denaturatie van de bibliotheek en de sequencing van de steekproef (zoals beschreven in 6,22).
  2. Parseren van de gegevens.
    Opmerking: Afzonderlijke gegevens van samengevoegde monsters, werden index leest geïdentificeerd en gescheiden (zoals beschreven in 22).
  3. Genereren FASTQ bestanden en dit gebruiken voor verdere gegevensanalyse.

13. Analyseer Sequenced Data uit de 16S Amplicon bibliotheek

Opmerking: Deze stap wordt uitgevoerd zoals beschreven in Bice et al.., 20176.

  1. Installeren van vrij beschikbare gegevens analysehulpmiddelen (Zie Tabel of Materials; 24).
  2. Monteren demultiplexed fastq bestanden uit de gesequenceerd gegevens (zoals beschreven in25,,26). Gooi alle gedemonteerde sequenties.
  3. Na een DOVO open taxonomische eenheid (OTU) protocol (zoals beschreven in 27) plukken-analyses uitvoeren.
    1. Bin sequenties in een enkele fastq bestand door sampleID en groep sequenties met 97 gewichtspercenten of meer gelijkenis in OTUs, zoals beschreven in 28. Uitlijnen van representatieve sequenties voor core set met minimale reeks lengte van 150 en 75% procent identiteit29,30. Taxonomie als beschreven28toewijzen.
      Opmerking: Monsters kunnen worden weggegooid en31, gevolgd door de taxonomische toewijzing en OTU tabel bouw32geanalyseerd.
    2. Maak een toewijzingsbestand waarmee beschrijvende namen en kenmerken van monsters link naar monster identificatie en valideren van de toewijzing bestand33,34.
    3. Maak een OTU netwerk die OTUs links naar beschrijvingen van de monster met behulp van een toewijzing bestand35.
    4. Berekenen taxonomie samenvattingen in termen van relatieve overvloed omdat taxa via percelen36worden samengevat.
    5. Verken Alfa diversiteit van de monsters op uniforme sequencing diepte worden monsters. Voor het definiëren van de juiste diepte voor de alpha diversiteit, totale aantallen waargenomen in elk monster met behulp van de opdracht bioom samenvatten-tabel, zoals beschreven in 37samen te vatten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Verschillende studies hebben aangetoond dat de praktijk van lichaam en geest geneeskunde gezondheidsresultaten verbetert. Ook bij muizen verbetert milieu verrijking resultaten met inbegrip van verbeterde levensduur en tumor wond reparatie6. Daarom werd een EE-procedure ontwikkeld met het oog op het definiëren van de rol van microbiota in dit fenotype terwijl eerste normaliseren de microbiome voorafgaand aan de opening van het experiment (Figuur 1). Nog belangrijker is, alle fokdieren zijn geïntegreerd in de muis kolonie voor ten minste één maand vóór de aanvang van de fok, en pasgeboren pups zijn mede gehuisvest met moeders in een grote kooi te normaliseren microbiota transmissie voorafgaand aan het experiment. Als dieren tussen 21 en 28 dagen oud, zijn gelijk aantal van elk genotype gespeend in hun respectieve huisvesting, EE of NE omgevingen(Figuur 2). Op 16 weken, kruk van alle dieren wordt verzameld en gehomogeniseerde (Figuur 2B), gevolgd door bacteriële DNA isolatie. Tot slot, kruk 16S waarbij worden versterkt van microbiome DNA en barcode geïndexeerd zodat gelijktijdig voor alle bibliotheken van de microbiome rangschikking (Figuur 3). De unieke sequenties geïdentificeerd in WT en tumor dieren indachtig NE zowel EE voorwaarden worden weergegeven in Figuur 4. Interessant, EE verbetert niet biodiversiteit in WT dieren, maar enorm verhoogt biodiversiteit in tumor-dragende dieren (Figuur 4), waaruit blijkt dat deze methode kan de verbetering van de biodiversiteit. Deze toename van de biodiversiteit kan worden toegeschreven aan de grotere aanwezigheid van de stam Proteobacteria, met een aanzienlijke toename van de klassen Alphaproteobacteria en Betaproteobacteria, en neemt af in pathogene Gammaproteobacteria (Figuur 5 ; Aanvullende tabel 1). De grootste stijging is in de Betaproteobacteria klasse is het geslacht Sutterella, een waarschijnlijk Commensalisme betrokken secreted IgA degradatie (Figuur 6, ook Zie38).

Figure 1
Figuur 1 : Een vertegenwoordiging van de experimentele tijdlijn. De korte banden vertegenwoordigen 7-daagse windows, zoals de meeste van het protocol is bereikt in stappen van de 7-daagse. Dit helpt ook bij visualisatie van het bereik van pup leeftijden over het experiment. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : EE en NE huisvesting voorwaarden en kruk homogenates (zoals beschreven in het protocol). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : 16S Microbiome bibliotheek voorbereiding. (A) ongezuiverde PCR amplicon producten afgeleid van kruk genomic DNA. ()B) Indexing plaat afbeelding ontworpen volgens de gebruikte software (Tabel van materialen, 23). De dubbele index combinaties, I7 (Index 1; Rij) en I5 (Index 2; Kolom), worden weergegeven voor elk monster. Elke index is 8 bp in lengte. De steekproef nummers verwijzen naar de respectieve muis nummers uit EE studies. (C) ongezuiverde Index PCR producten. (D) de analyse van de kwaliteit van finale gezuiverd en gebundeld 16S bibliotheken. (A, C, D) Zwarte pijlen duiden 550 bp amplicon en 668 bp geïndexeerde bibliotheek. Rode pijlen duiden niet-specifieke producten die zijn uitgeschakeld na zuivering zoals in D. Bovenste en onderste markers zijn grootte markeringen aan het monster voor grootte verwijzing toegevoegd. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Wijzigingen in alpha diversiteit na EE van Tcf4Het / + ApcMin / + dieren. Alfa diversiteit van WT en Tcf4Het / + ApcMin / + tumor rekening houdend met dieren. Op 20.000 leest, NE en EE van WT, p= 0.64 en NE en EE van Tcf4Het / + ApcMin / +, p= 0,03 twee-sample t-test met Welch correctie. Aangepast van Bice et al.., 20176. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5 : EE-gemedieerde wijzigingen na EE van Tcf4Het / + ApcMin / + dieren. R-ggplot2 gegenereerd vak-whisker percelen ter aanduiding van de wijzigingen in overvloed van de stam Proteobacteria en de klassen Alphaproteobacteria, Betaproteobacteria en Gammaproteobacteria. Uitschieters zijn genoteerd als cirkels. p= 0,005 twee gepaarde steekproeven met t-tests met Welch correctie. Foutbalken berekend aan de hand van de standaardfout van het gemiddelde (SEM). Aangepast van Bice et al.., 20176. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6 : Veranderingen in de relatieve overvloed van Sutterella na EE van Tcf4Het / + ApcMin / + dieren. Uitschieters zijn genoteerd als cirkels. p= 0,005 twee-sample t-test met Welch correctie. Foutbalken berekend aan de hand van SEM. aangepast van Bice et al.., 20176. Klik hier voor een grotere versie van dit cijfer.

Supplemental Table 1
Aanvullende tabel 1: indeling van bacteriën geïsoleerd van kruk verzameld van NE en EE muizen. Classificatie over genotypen op stam (A), (B) klasse (C) Order, (D) familie en (E) geslacht niveau. Vergelijkingen van NE en EE dezelfde genotype of WT te Tcf4Het / + ApcMin / +. P-waarden worden berekend met behulp van een twee-sample t-test met Welch correctie. Aangepast van Bice et al.., 20176. Klik hier om dit bestand te downloaden.

Item Totale oppervlakte (inch2) Totale oppervlakte (cm2) Cage grootte (inch) L x W x H Cage grootte (cm) L x W x H
Het ene besturingselement kooi (NE) 68.25 440.32 10.5 x 6.5 x 5.5 26.67 x 16.51 x 13.97
Eén grote kooi (EE) 264.36 1706.32 13.87 x 19.06 x 7,75 35.24 x 48.42 x 19.69
Twee grote kooien (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7,75 2 @ 35.24 x 48.42 x 19.69
Twee Platforms (EE) 93 600 2 @ 11,8 x 3,94 x 2.95 2 @ 30 x 10 x 7.5
Twee grote kooien met twee Platforms (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7,75 + 2 @ 11,8 x 3,94 x 2.95 2 @ 35.24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7.5

Tabel 1: EE en NE Cage maten en vloeroppervlak.

Dieren toegelaten in de kooi Vereiste Inches kwadraat Per dier EE kooioppervlakte (Inches2) Totale huisdieren toegestaan
Maximaal 25 12 622 in2 (4013 cm2) maximaal 25
25 + 15 622 in2 (4013 cm2) tot 41
Vrouw met strooisel 51 622 in2 (4013 cm2) maximaal 12

Tabel 2: toegestaan aantal dieren in kooien op basis van de vloeroppervlakte 15 .

Amplicon PCR inleidingen
Voorwaarts 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Omgekeerde 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Locus specifieke opeenvolgingen zijn vetgedrukt en de niet-vette is de overhang adapter volgorde.

Tabel 3: Amplicon PCR inleidingen.

Amplicon PCR reactie instellen
Volume
Microbiële DNA (5ng/l) 2.5 μl
Toekomen Primer (1 μM; uit stap 5.1.2) 5.0 μl
Omgekeerde Primer (1 μM; uit stap 5.1.2) 5.0 μl
2 x HotStart Ready Mix 12.5 μl
Totaal 25.0 μl

Tabel 4: Amplicon PCR Mix.

Amplicon PCR instellen
95 ° C gedurende 3 minuten
25 cycli van:
95 ° C gedurende 30 seconden
55 ° C gedurende 30 seconden
72 ° C gedurende 60 seconden
72 ° C gedurende 3 minuten
Houd bij 4 ° C

Tabel 5: Amplicon PCR programma ingesteld.

Index PCR barcode vergadering
DNA 2.5 μl
Index Primer 1 (N7XX) 2.5 μl
Index Primer 2 (S5XX) 2.5 μl
2 x HotStart Ready Mix 12.5 μl
PCR rang water 5 µl
Totaal 25 μl

Tabel 6: Index van de PCR-Mix.

Index PCR Setup
95 ° C gedurende 3 minuten
8 cycli van:
95 ° C gedurende 30 seconden
55 ° C gedurende 30 seconden
72 ° C gedurende 30 seconden
72 ° C gedurende 5 minuten
Houd bij 4 ° C
Opslag bij-20 ° C

Tabel 7: Index PCR programma ingesteld omhoog

Concentratie voorbeeldformule voor Pooling
(DNA concentratie in ng/µl) x 106 = concentratie in nM
(660 g/mol x gemiddelde bibliotheek grootte)
Een voorbeeld van deze studie is:
(85.2 ng/µl) x 10 ^ 6 = 193.3 nM
(660 g / mol x 668 bp)

Tabel 8: formule voor normalisatie voor bundeling van monsters

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Deze procedure kan voor de analyse van microbiota geïsoleerd uit ontlasting na milieu verrijking van normaal of tumor met dieren. Omdat dit grote experimenten waarbij fokken voor veel dieren van verschillende geslachten en genotypen, het normaliseren van de microbiome tussen de dieren vóór de aanvang van het experiment is essentieel om te voorkomen dat niet-EE gerelateerde effecten op microbiome biodiversiteit.

Voor consistentie tussen NE en EE voorwaarden geschiedt de kweek proces om ervoor te zorgen dat alle muizen aanvankelijk blootstelling aan de dezelfde microben en daarom naar verwachting hebben soortgelijke microbiome inhoud. Het is mogelijk, en waarschijnlijk, dat muis genotype beïnvloedt microbiome samenstelling. Om deze reden zijn muis nummers per genotype gehouden tussen NE en EE voorwaarden om er zeker van zijn dat elk dier die kruk verbruikt een vergelijkbare diversiteit van de microbiome zult tegenkomen.

Verschillende moeilijkheden zijn duidelijk zichtbaar bij het ontwerpen van EE experimenten. Ten eerste, het totale aantal dieren die nodig zijn voor de experimenten is afhankelijk van de experimentele details, maar het totale aantal wordt ook beperkt door het aantal dieren toegestaan in de kooi. Bijvoorbeeld, historische gegevens omliggende muis overleven in een voorlopige EE-experiment werden gebruikt voor het berekenen van het aantal dieren vast te stellen van het mechanisme onderliggende verbeterde overleving waargenomen in eerdere experimenten. Van deze gegevens, een totaal van 17 dieren in de vergelijkingsgroep nodig waren voor een 80% vermogen tot het detecteren van een verschil in overleving in een twee-zijdige t-toets waar Alfa = 0,05. 4-5 dieren in de controlegroep vs. 20-24 (of tot 41) dieren per kooi in de experimentele groep moeten dus zijn geschikt voor een vermogen berekening. Daarom zijn verschillende controle groep kooien nodig samen met de experimentele kooi. Verder, met complexe genotypen, het is moeilijk te verkrijgen van voldoende dierlijke aantal van elk genotype, die noodzakelijk is het grote aantal vrouwelijke fokdieren nodig. Echter, met andere modellen waar minder transgene verschillen zijn aanwezig, meer dieren van dezelfde genotype in dit systeem kunnen worden geanalyseerd en minder fokkers zijn noodzakelijk. In de Verenigde Staten, kunnen 12 zwangere vrouwtjes worden ondergebracht in de 633 in2 ruimte (tabel 2). De kwestie met dit is dat als pups ouder, ze meer ruimte in beslag nemen. Gezien het feit dat mannelijke pups zijn gescheiden van vrouwelijke pups op 14-21 dagen, wordt een goedgekeurde uitzondering op de regel van de ruimte in bepaalde landen mogelijk. Anders, mannelijke en vrouwelijke pups kunnen worden gegenotypeerd en geselecteerd, en klik vervolgens op een jongere leeftijd met moeders te blijven onder de maximale muis getallen gescheiden. Het is essentieel te krijgen van goedkeuring voor deze studies en het voldoen aan de lokale wetgeving omtrent de ruimtebeperkingen. Tot slot, met microbiota, het aantal dieren nodig om te ontdekken zelfs kleine verschillen in de samenstelling van de microbiota is moeilijk te berekenen een priori. Terwijl in deze studie, aanzienlijke verschillen in de microbiota bleken met 4 dieren per groep, is het mogelijk dat verhoging van het aantal dieren zou onthullen microbiota die zijn meer variabel tussen EE muizen of slechts in geringe mate worden gewijzigd door EE.

Deze methode beschreven de specifieke apparatuur en beddengoed die worden gebruikt, die op het oppervlak verschijnen niet essentieel. Echter diverse niet-duidelijk problemen die invloed hebben op consistentie kunnen worden opgetreden en moeten worden aangepakt voordat het aanbreken van deze zeer grote, dure en tijdrovende studies. Een groot probleem is kooi ventilatie. Met grote aantallen dieren in een kooi, ventilatie wordt een probleem, en is een kwestie die de meeste onderzoekers geen rekening houden doen wanneer u probeert te bieden consistente omgevingen tussen controle en experimentele kooien. Alle kooien in de beschreven instellingen staan in een geventileerde kast te egaliseren ventilatie in de experimentele kooien. Dit kan niet worden verwezenlijkt als met behulp van die niet passen in een geventileerde kabinet Ken kooien. Andere betekent te normaliseren ventilatie tussen experimentele dieren kon worden getest en toegepast, maar deze methoden zijn niet onderzocht in deze studie. Soortgelijke problemen consistentie met beddengoed. In de dikke darm kanker modelsysteem dat wordt gebruikt in deze studie, dieren die spijsvertering ziekte zal het inslikken van bepaalde soorten strooisel, vooral maïskolf dekbed(den) aanwezig, wat leidt tot spijsvertering blokkades en ziekte. Het is belangrijk dit in gedachten te houden als de dieren is bekend dat het inslikken van beddengoed toen niet anders bezetten, zoals in de controleomgeving. Alle gegevens zal diep van invloed op dit verschijnsel en de daaropvolgende inconsistent gezondheidseffecten.

Het gen ribosomal 16S is gebruikt als een middel om te studeren van bacteriële populaties. Het bevat negen regio's die uitdrukking geven aan genetische variabiliteit, V1-V9, en afgewisseld geconserveerde gebieden die relatief ongewijzigd tussen bacteriesoorten39 blijven. De V1-V3-regio, in het bijzonder biedt de hoogste kans op identificatie van soorten-niveau39. Soortgelijke V1-V3 studies op colorectale kanker (CRC) en Advanced colorectaal adenoom wijzigingen in drie stammen van belang gevonden: Bacteroidetes, Firmicutes en Proteobacteria21,40,41. Het is ook gemeld dat de oefening kan verschuiven van de microbiële populatie en tot een toename van de Firmicutes42 leiden. Om deze reden wordt in deze studie microbiome populaties geïdentificeerd met behulp van V1-V3 inleidingen na een 16S metagenomic bibliotheek prep protocol22 potentieel het definiëren van de effecten van milieu verrijking op deze stammen bekend moet worden gewijzigd in het adenoom en CRC. Deze procedure kan worden gewijzigd volgorde van andere variabele regio's van het 16S rRNA-genen te versterken. Unidirectioneel is met sonde Match te begrijpen de fylogenetische classificatie van microbiota aanwezig in het monster, dat wordt aangeduid met de sonde. Op deze manier kunnen sondes worden uitgevoerd om te specifiek en fylogenetisch classificeren microben van belang. Dit maakt een verschillende karakterisering van de microbiota aanwezig in de kruk monsters, en extra EE-afhankelijke wijzigingen in de microbiome van de tumor met muizen die invloed kunnen hebben op de progressie van de ziekte kan openbaren.

Met behulp van deze procedure, de Sutterella werd geïdentificeerd als de meest veranderde geslacht na EE van tumor, rekening houdend met dieren geslacht. Deze procedure kan worden aangepast voor studies die gebruik maken van een methode die is bedoeld voor het analyseren van de gevolgen van een verstoring op microbiome samenstelling in genetisch gemodificeerde modellen van ziekten bij de mens. Bijvoorbeeld, in plaats van EE, kunnen muizen worden geënt met Sutterella om te definiëren of Sutterella inoculatie volstaat te verhogen van de biodiversiteit van de microbiële en reparatie wond in 16-week-oude mannelijke tumor rekening houdend met dieren.

De meest unieke aspect van dit protocol is ongetwijfeld de bezorgdheid over het normaliseren van de microbiota voorafgaand aan EE en behoud van diversiteit van de microbiome gedurende de EE-studies. Aangezien microbiome studies voortdurend verbeteren zijn, is het waarschijnlijk dat meer robuuste methoden voor het karakteriseren van de microbiome ontstaat, en omvat de karakterisering van het microbiome in dit protocol achterhaald worden zal. Bijvoorbeeld, met de huidige studie hebben de sondes gebruikt om te vergroten van het 16S rRNA bias, afhankelijk van de sondes die worden gekozen, en niet alle bacteriën aanwezig zijn in de microbiome doen karakteriseren. Hoewel de methoden voor onderzoek en karakteriseren van de microbiome ongetwijfeld verbeteren zal, experimenten de fundamentele basis van ontwerpen en uitvoeren van EE terwijl rekening houdend met normalisering van de microbiome een essentieel aspect van de EE experimenten blijft.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat ze hebben geen conflicten van belang.

Acknowledgements

Wij danken B. Dalley in de kern van de Universiteit van Utah Genomics voor bibliotheek sequencing en K. Boucher in de kern van de Universiteit van Utah Biostatistiek voor statistisch advies en toegang tot deze technische kernen ondersteund door de National Cancer Institute award P30 CA042014. Het project beschreven werd gesteund door het nationaal kanker instituut subsidies P01 CA073992 en K01 CA128891 en de jager-Stichting tegen kanker.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics